Cucumber transcription factor CsERF4 and its application

Abstract

The present invention relates to the technical field of genetic engineering, and in particular to a cucumber transcription factor CsERF4 Cucumber transcription factor of the present invention CsERF4 In response to infection by Botrytis cinerea, transient expression in tobacco inhibits Bax-induced cell death and CsERF4 Interacts with cucumber glutaredoxin CsGRX4. A PB2HA‑35S‑CsERF4 plant overexpression vector was constructed, and the transcription factor was discovered for the first time. CsERF4 Overexpression of transgenic strains can significantly improve resistance to gray mold. CsERF4 In response to infection by Botrytis cinerea, it inhibits Bax-induced cell death, and CsERF4 Cucumber glutaredoxin CsERX4 Interaction, through overexpression CsERF4 Improving the resistance of transgenic plants to gray mold.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and in particular to a cucumber transcription factor CsERF4 and an application thereof. Background Art

[0002] AP2 / ERF is a class of transcription factors widely present in plants. There are 122 AP2 / ERF transcription factor members in Arabidopsis, 139 in rice, and 103 in cucumber. Most ERF transcription factors actively participate in plant biotic or abiotic stress responses and play a positive or negative regulatory role in them, playing an important role in plant resistance to biotic and abiotic stresses.

[0003] AP2 / ERF transcription factors in plants are divided into four categories: AP2 type, RAV type, ERF type and DREB type. These four types of AP2 / ERF transcription factors are involved in different biological processes. At present, people have studied the processes and regulation of some ERF transcription factors involved in biotic stress and abiotic stress. The results showed that the Arabidopsis ERF gene AtERF15 positively regulated the defense response of Pseudomonas syringae Pst DC3000 and saprophytic fungi; overexpression of ERF96 enhanced the expression of defense-related genes, and the resistance of transgenic plants to gray mold was enhanced. The silencing strain inhibiting ERF96 was consistent with the disease resistance phenotype of the wild type. The Dewax deletion mutant encoding AP2 / ERF transcription factors showed gray mold susceptibility. The regulation of ERF genes on plant resistance is bidirectional. In addition to the above as positive regulatory factors involved in disease resistance, some ERF genes also participate in plant disease resistance as negative regulatory factors. For example, the disease-induced response ERF genes ERF4 (ERF078) and ERF9 (ERF080) negatively regulate the resistance of Arabidopsis to gray mold. Another ERF gene, ERF19, acts as a negative regulator of gray mold resistance, and overexpression enhances the susceptibility of plants. Zhang et al. showed that overexpression of ERF014 reduced the resistance of plants to gray mold, while silenced plants showed disease resistance.

[0004] In summary, most ERF family members in plants have differences in organization and function, and have different regulatory mechanisms in the defense response to Botrytis cinerea. For specific plant species and ERF genes, their role in disease regulation needs to be determined experimentally.

[0005] Cucumber belongs to the genus Cucumis in the Cucurbitaceae family and is one of the main vegetable crops in my country. Due to the characteristics of highly intensive cultivation, high multiple cropping index and single species in facility cultivation, there is a trend of increasing pests and diseases in the facility, especially the leaf fungal disease gray mold. Gray mold is caused by Botrytis cinerea Pers, which is mainly saprophytic. It mainly harms young fruits on cucumbers, causing them to soften and rot. The occurrence of this disease is characterized by strong epidemic, widespread occurrence and strong harm. In recent years, with the increase in the cultivation area of ​​facility cucumbers, the high humidity and closed environment in the facility is more likely to cause this fungal disease. Gray mold can not only infect the stems, leaves and other tissues of cucumbers, but also infect the flower organs and fruits of cucumbers, causing the cucumber plants and fruits to rot and even die, thereby affecting the cucumber yield. When the disease incidence rate is as high as 70% or more, the cucumber yield can be reduced by 20% to 30%, greatly reducing the economic income of farmers and seriously affecting the growth and development of cucumbers. Therefore, it is very important to discover or explore the important resistance genes of cucumber gray mold, so as to understand the resistance mechanism of cucumber gray mold and then create disease-resistant varieties of cucumber gray mold. There are 138 ERF gene family members in cucumber, which are divided into 10 subfamilies. There are no reports on the involvement of ERF in cucumber gray mold fungal diseases and their functions. It is still unclear which ERF transcription factors are involved in the defense response of gray mold. Therefore, exploring their resistance mechanism and determining their functions are of great significance for gray mold resistance breeding. Summary of the invention

[0006] In view of this, the present invention provides cucumber transcription factor CsERF4 and application thereof.

[0007] In order to solve the problems existing in the prior art, the technical solution of the present invention is: application of cucumber transcription factor CsERF4 in improving disease resistance to gray mold.

[0008] The application of the cucumber transcription factor CsERF4 in improving resistance to gray mold is characterized in that the cucumber transcription factor CsERF4 responds to infection by gray mold and inhibits Bax-induced cell death, and CsERF4 interacts with cucumber glutaredoxin CsERX4.

[0009] Overexpression of CsERF4 improved the resistance of transgenic plants to Botrytis cinerea.

[0010] Cucumber transcription factor CsERF4, the coding region sequence of the gene is shown in SEQ NO.1.

[0011] Compared with the prior art, the advantages of the present invention are as follows:

[0012] 1) Overexpression of the cucumber transcription factor CsERF4 of the present invention can significantly improve resistance to gray mold.

[0013] 2) The cucumber transcription factor CsERF4 of the present invention can respond to infection by Botrytis cinerea, and transient expression in tobacco can inhibit Bax-induced cell death, and CsERF4 interacts with cucumber glutaredoxin CsGRX4. A PB2HA-35S-CsERF4 plant overexpression vector was constructed, and it was first discovered that the transcription factor CsERF4 overexpression transgenic strain can significantly improve the resistance to Botrytis cinerea. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 It is to quantitatively analyze the gene expression of CsERF4 under Botrytis cinerea stress.

[0015] Figure 2 The transcription factor CsERF4 inhibits Bax-induced cell death; a: necrosis phenotype of injected tobacco leaf cells; b: statistics of necrosis area of ​​injected tobacco leaf cells.

[0016] Figure 3 Yeast two-hybrid assay was used to verify the interaction between CsERF4 and CsGRX4.

[0017] Figure 4 This is the identification of resistance to Botrytis cinerea in cucumber transcription factor CsERF4 overexpressing strains; a: symptom phenotype of Botrytis cinerea infection in CsERF4 overexpressing Arabidopsis transgenic strains and wild-type plants 2.5 days later; b: lesion area of ​​Botrytis cinerea infection in CsERF4 overexpressing Arabidopsis transgenic strains and wild-type plants 2.5 days later. DETAILED DESCRIPTION

[0018] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0019] The present invention proposes the application of cucumber transcription factor CsERF4 in improving resistance to gray mold. The disease resistance of transgenic plants to gray mold is improved by overexpressing CsERF4. Cucumber transcription factor CsERF4 responds to infection by gray mold and inhibits Bax-induced cell death, and CsERF4 interacts with cucumber glutaredoxin CsERX4.

[0020] The present invention includes overexpressing the gene CsERF4 or its homologous gene in plants to make them more resistant to gray mold; correspondingly, knocking out or inhibiting the expression of the gene makes the plants more susceptible to gray mold, and using the gene to improve the disease resistance of cucumbers to gray mold and cultivate disease-resistant germplasm.

[0021] The invention adopts homologous recombination technology, refers to the genome sequence of North China cucumber 9930, takes the first chain of cDNA synthesized by reverse transcription of total RNA of cucumber leaves as a template, amplifies the cucumber CsERF4 gene sequence for the first time by polymerase chain reaction technology, designs specific quantitative primers, and analyzes the gene expression of cucumber seedlings treated with gray mold.

[0022] In order to further study the specific function of cucumber transcription factor CsERF4 in improving gray mold resistance, the inhibition of Bax-induced cell death by CsERF4 was studied, and the full-length CDS coding region of the CsERF4 gene was amplified, a yeast expression vector was constructed, and yeast two-hybrid verification was performed. A plant expression vector was constructed, and overexpression strains were screened and obtained to identify gray mold resistance.

[0023] Cucumber transcription factor CsERF4 can be used to improve resistance to gray mold. The results of gray mold inoculation showed that the leaf lesion area of ​​two Arabidopsis transgenic lines overexpressing CsERF4 was 34% and 26% of the wild-type leaf lesion area, which was significantly smaller than the wild type, showing disease resistance. The above results indicate that overexpression of transcription factor CsERF4 in Arabidopsis improves the resistance of transgenic plants (Arabidopsis) to gray mold.

[0024] The following are the specific steps for the functional verification of cucumber transcription factor CsERF4 in improving gray mold resistance:

[0025] A. Obtain cucumber seedlings. Select cucumber seeds with full seeds and soak them in warm water. After soaking for 4-5 hours, place them in a 25-28℃ incubator for germination. After the seeds turn white, sow them in a nutrient pot filled with a matrix of peat soil and vermiculite with a volume ratio of 3:1. After sowing, place them in a light incubator (GZH-500A, Ningbo Jiangnan Instrument, Ningbo, Zhejiang) for growth. The temperature of the light incubator is 24-26℃, the photoperiod is 16 / 8h, and the light condition is 150μmol·m -2 ·s -1 , relative humidity 80% to 90%. Treatment is carried out when the seedlings have two leaves and one heart.

[0026] B. Search the CsERF4 gene sequence through the cucumber database and design specific quantitative primers avoiding the conserved domain: CsERF4-RT-F: 5'-CGG CTC TAC GTG CTG GAA T-3' and CsERF4-RT-R: 5'-ATT CTG GTG GGGGAA AGT TG-3'.

[0027] C. Analysis of gene expression in cucumber seedlings under Botrytis cinerea treatment. RNA was extracted from leaves of cucumber seedlings infected with Botrytis cinerea and reverse transcribed into cDNA, which was used as a template and specific primers were designed for real-time quantitative PCR to detect gene expression of cucumber transcription factor CsERF4 under Botrytis cinerea infection.

[0028] D. Quantitative analysis of the gene expression of CsERF4 under Botrytis cinerea stress. Botrytis cinerea infection induced the upregulation of CsE1RF01 expression. At 24 h after infection, the expression level of CsERF4 gene reached the highest level, which was 22.05 times that of 0 h. This indicates that CsERF4 responds to Botrytis cinerea infection, such as Figure 1 shown.

[0029] E. Amplify the full length CDS of cucumber CsERF4 gene. Using homologous recombination technology, the first strand of cDNA synthesized by reverse transcription of total RNA from cucumber leaves was used as a template to amplify the sequence SEQ NO.1 of cucumber CsERF4 gene. The sequence is as follows:

[0030] ATGGCTCCGAGGGAGAAGGCAGTTGCCGTCAAGCCTAGCGTCGGTA

[0031] ACGTGAAGGAAGTGCATTTTAGAGGAGTGAGGAAGCGGCCATGGGGGAG

[0032] ATATGCCGCTGAGATCAGAGATCCCAGTAAGAAAAGCCGGGTTTGGCTTG

[0033] GAACCTTTGATACCGCGGAGGAGGCGGCTCGAGCCTACGACAGCGCCGC

[0034] TAGAGATTTCCGCGGCGTTAAGGCCAAGACCAATTTCCCTTTGCCCTCCGA

[0035] TGATCAGCTTCTTAACCTTAACAATAAGATTAACAACATCAACAAATAATCA

[0036] GAGCCCGAGTCAGAGTAGCACGGTTGAGTCCTCTAGCCGGGAGCAAGCT

[0037] CTGATGGTTGATTCCTCCCCTTTGAATCTCAATCTAGGTCACGGTATTGGC

[0038] GGACTCACGAACGCTGGACCCATCAGTTTCCCATTTCAGCGTTACCAAAT

[0039] TCCCATGATCGGAGAAGTTTTTACCCGCGGCATACCGCCTTCGAATCACGT

[0040] TCTCTATTTCGATGCGGCTCTACGTGCTGGAATGATCAACAGTCATCCGAA

[0041] CCAACGGCTACACTTCGACCGTATTCGCGAAGCGGTGAGTGATTTCCGAC

[0042] GCGAGTTCGCCGGCAGCGGTGTTCAGAGCGACTCCGATTCCTCCTCCGTT

[0043] GTGGACATGAACGGTCAAGACCTCAAGCCCCGAGGAGGAAGTGGCGGCC

[0044] GCCTTGATTTGGATCTCAACTTTCCCCCACCAGAATCCGCCTGA

[0045] F. Transcription factor CsERF4 inhibits Bax-induced cell death. The transcription factor CsERF4 was injected into tobacco to detect its effect on Bax-induced cell death. The results are shown in Figure 2 As shown. Injection of buffer or transcription factor CsERF4 did not cause necrosis in tobacco cells, while injection of Bax induced tobacco cell death, and the percentage of induced cell death reached more than 80% ( Figure 2 a). Injection of Bax 24 hours after CsERF4 injection can significantly reduce cell death, and the cell death caused at this time is less than 20% ( Figure 2 b), there is a significant difference between the cell death induced by Bax and the cell death induced by CsERF4, indicating that CsERF4 significantly inhibits the cell death induced by Bax.

[0046] H. Construction of yeast expression vector and verification of yeast two-hybrid assay. The yeast expression vectors pGADT7-CsERF4 and pGBKT7-CsGRX4 were constructed using the gateway method.

[0047] 1 μg of yeast plasmid combination was transferred into yeast cell Y2H by PEG / LiAc transformation method according to the Matchmaker Gold Yeast Two-Hybrid System User Manual of Clontech. In the plasmid combination, empty vectors pGBKT7 and pGADT7 were used as blank controls, pGBKT7-GRX480+pGADT7-TGA2 was used as positive control, pGBKT7-GRX370+pGADT7-TGA2 was used as negative control, and pGBKT7-CsGRX4+pGADT7-CsERF4 was used as the test group. 10 μL was quantitatively spotted on the yeast culture medium of DDO, QDO and QDO / X, and inverted cultured at 30℃ for 3-5 days to observe the growth of single clones.

[0048] I. The coding sequence of cucumber CsERF4 was inserted into the downstream of CaMV35S promoter to construct a plant overexpression vector, which was then transferred into Columbia-type Arabidopsis by floral dipping method. Well-growing CsERF4 transgenic T2 generation strains (OE1 and OE2) were screened and obtained. Figure 4 In a, WT indicates Columbia-type Arabidopsis; OE2 and OE1 indicate CsERF4-overexpressing Arabidopsis transgenic lines; lowercase letters indicate the significant difference between CsERF4-overexpressing Arabidopsis transgenic lines and the wild type (p<0.05).

[0049] J. Identification of resistance to gray mold in CsERF4 overexpression strains and wild-type Arabidopsis plants. The gray mold suspension was titrated and inoculated into leaves of CsERF4 overexpression strains and wild-type Arabidopsis for disease resistance identification. The results showed that after 2.5 days of gray mold infection, the average lesion area of ​​the wild-type plants was 0.496 mm 2 , which were 2.87 times (0.173 mm) of the overexpression lines OE1 and OE2. 2 ) and 3.81 times (0.13mm 2 ), significantly greater than the overexpression strain, significantly greater than the overexpression strain ( Figure 3 ), and the lesion area was counted ( Figure 4 b), The results showed that heterologous overexpression of CsERF4 enhanced its resistance to Botrytis cinerea.

[0050] The above results indicate that overexpression of cucumber ERF transcription factor CsERF4 in Arabidopsis improves the plant's resistance to gray mold.

[0051] The above description is only a preferred embodiment of the present invention and is not intended to limit the protection scope of the present invention.

Claims

1. Cucumber transcription factor CsERF4 Application in improving the disease resistance of transgenic plants to gray mold, the plant is cucumber or Arabidopsis, the cucumber transcription factor CsERF4 The coding region sequence is shown in SEQ NO.

1.

2. The use according to claim 1, characterized in that: Cucumber transcription factor CsERF4 In response to infection by Botrytis cinerea, it inhibits Bax-induced cell death, and CsERF4 Cucumber glutaredoxin CsERX4 Interaction.

3. The use according to claim 1, characterized in that Through overexpression CsERF4 Improving the resistance of transgenic plants to gray mold.

Images