Application of miR-4670-3p mimics in the preparation of drugs for the treatment of lung cancer
By designing miR-4670-3p mimics and combining them with nucleic acid transfection agents, we promoted lung cancer cell apoptosis and inhibited migration, solving the problems of large trauma and unclear molecular mechanisms in existing lung cancer treatments, and providing a new lung cancer treatment strategy.
Patent Information
- Application Number
- CN202310866732.8
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-07-14
- Publication Date
- 2025-09-12
- Estimated Expiration
- 2043-07-14
AI Technical Summary
Existing lung cancer treatments, such as surgery and radiotherapy, are highly invasive and cause significant damage to normal tissues. In addition, the molecular mechanism of lung cancer is unclear, and there is a lack of effective molecular targets and treatment strategies.
By using miR-4670-3p mimics, the positive and antisense chains designed through nucleotide sequences, combined with nucleic acid transfection agents such as lipid-based transfection agents, lung cancer cell apoptosis is promoted and cell migration is inhibited, and a new lung cancer treatment drug is developed.
miR-4670-3p mimics can significantly promote apoptosis of lung cancer cells and inhibit cell migration, providing new therapeutic targets and drugs for lung cancer and having diagnostic and therapeutic potential.
Smart Images

Figure CN117045671B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the field of biomedicine technology, and in particular to the use of miR-4670-3p mimics in the preparation of drugs for treating lung cancer. Background Art
[0002] The information disclosed in this background technology section is only intended to enhance understanding of the overall background of the invention and should not necessarily be regarded as an admission or any form of suggestion that the information constitutes the prior art already known to those skilled in the art.
[0003] Lung cancer is a common type of solid malignant tumor in clinical practice. Epidemiological studies have shown that lung cancer has become one of the malignant tumors with the highest morbidity and mortality. For the treatment of lung cancer, existing treatment methods mostly use surgery and radiotherapy. However, surgery has defects such as large trauma, high risk, and easy complications; while radiotherapy causes greater damage to the body's normal tissues. Therefore, it is urgent to identify new treatment strategies for effective treatment. However, the mechanism of lung cancer occurrence is very complex, and its exact molecular mechanism of pathogenesis is still not fully understood. Therefore, exploring the molecular mechanism of lung cancer occurrence, development, invasion and metastasis, and providing new ideas and new targets for further treatment of lung cancer has become a research hotspot.
[0004] MicroRNAs are short, non-coding, novel gene regulatory factors consisting of only 17-22 nucleotides, widely expressed in plants and animals. With the continuous advancement of sequencing and molecular biology technologies, an increasing number of microRNAs have been confirmed to play important regulatory roles in the development and progression of lung cancer. However, different microRNAs can affect different stages of lung cancer development and play different roles: some can act as oncogenes to promote lung cancer cell proliferation; some can act as tumor suppressors to promote lung cancer cell apoptosis; some can act as enhancers to increase lung cancer cell invasiveness and migration, promoting lung cancer cell metastasis; and some can act as predictive factors, playing an important role in the diagnosis and prognosis of lung cancer. Therefore, the role of microRNAs in the development and progression of lung cancer is difficult to predict, and screening microRNAs for potential lung cancer treatment from the vast number of microRNAs remains a technical challenge. Summary of the Invention
[0005] In view of the above-mentioned prior art, the purpose of the present invention is to provide the use of miR-4670-3p mimics in the preparation of drugs for the treatment of lung cancer.
[0006] The present invention is achieved through the following technical solutions:
[0007] The present invention provides a use of a miR-4670-3p mimic (miR-4670-3p mimics) in the preparation of a drug for treating lung cancer. The miR-4670-3p mimics are composed of a sense strand and an antisense strand, the nucleotide sequence of the sense strand being shown in SEQ ID NO.1; the nucleotide sequence of the antisense strand being shown in SEQ ID NO.2. The details are as follows:
[0008] S:UGAAGUUACAUCAUGGUCGCUU; (SEQ ID NO.1)
[0009] AS:GCGACCAUGAUGUAACUUCAUU. (SEQ ID NO.2)
[0010] Note: According to the WIPOST.26 standard, uracil "U" in the miRNA sequence in the table is represented by "T" in the sequence listing.
[0011] In the above application, the miR-4670-3p mimic achieves the treatment of lung cancer through the following pathways (1) or (2):
[0012] (1) Inhibit lung cancer cell migration;
[0013] (2) Promote apoptosis of lung cancer cells.
[0014] In the above application, the drug comprises: a miR-4670-3p mimic and a nucleic acid transfection agent.
[0015] Preferably, the nucleic acid transfection agent can be a lipid-based transfection agent, a polymer-based transfection agent, a magnetic particle-based transfection agent, an exosome for nucleic acid delivery, or a viral protein for nucleic acid delivery.
[0016] Beneficial effects of the present invention:
[0017] Researchers have discovered that miR-4670-3p is one of the most significantly downregulated microRNAs in lung cancer A549 cells. They also compared the relative expression of miR-4670-3p in lung cancer tissue and adjacent adjacent tissue from lung cancer patients, finding significantly lower miR-4670-3p expression in lung cancer tissue compared to adjacent adjacent tissue. Therefore, miR-4670-3p has the potential to serve as a target for lung cancer diagnosis or treatment.
[0018] Furthermore, to achieve lung cancer treatment, the present invention designed and synthesized a miR-4670-3p mimic. By transfecting the miR-4670-3p mimic into lung cancer cells, it was found that transfection with the miR-4670-3p mimic promoted lung cancer cell apoptosis and inhibited lung cancer cell migration, thereby inhibiting the progression of lung cancer. Therefore, the miR-4670-3p mimic of the present invention has the potential to be developed into a new lung cancer treatment drug. BRIEF DESCRIPTION OF THE DRAWINGS
[0019] Figure 1 : Quantitative statistics of miR-4670-3p expression levels in the serum of lung cancer patients and healthy controls.
[0020] Figure 2 : Quantitative statistics of miR-4670-3p expression levels in lung cancer tissues and adjacent adjacent tissues in lung cancer patients.
[0021] Figure 3 : miR-4670-3p mimics can induce apoptosis in lung cancer cells; Figure: A. A549 cells were treated with microRNA-negative control (NC) or miR-4670-3p mimics (miR-4670-3p) for 12 / 24 hours, and A549 cell survival was analyzed under a 10× microscope; B. A549 apoptosis induced by miR-4670-3p mimics was detected by Hoechst 33258, and photographed and analyzed under a 20× inverted fluorescence microscope; C. Quantification of cell apoptosis induced by Hoechst 33258 in each treatment group.
[0022] Figure 4 MiR-4670-3p mimics inhibit the migration of lung cancer A549 cells in vitro. Figure: A. A549 cells were treated with a microRNA negative control (NC) or a miR-4670-3p mimic (miR-4670-3p) for 6 and 12 hours, and cell migration was analyzed under a 10× microscope. B. Quantification of cell migration induced by each treatment group. DETAILED DESCRIPTION
[0023] It should be noted that the following detailed descriptions are illustrative and intended to provide further explanation of the present application. Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art to which the present application belongs.
[0024] In clinical diagnosis, serum testing offers significant advantages as a non-invasive diagnostic tool. The expression of small molecules such as microRNA in peripheral blood serum is often closely associated with the development of lung cancer. This study used quantitative real-time PCR to detect microRNA in the serum of healthy individuals and lung cancer patients, screening for differentially expressed microRNAs. The results revealed that miR-4670-3p expression was significantly downregulated in the serum of lung cancer patients. The nucleotide sequence of miR-4670-3p is shown in SEQ ID NO. 3 and is as follows:
[0025] UGAAGUUACAUCAUGGUCGCUU; (SEQ ID NO.3)
[0026] Note: According to the WIPOST.26 standard, uracil "U" in the miRNA sequence in the table is represented by "T" in the sequence listing.
[0027] After searching, there are currently few studies on miR-4670-3p, and there are no reports on its application in the occurrence and development of lung cancer. Therefore, it is preliminarily judged that miR-4670-3p may serve as a new target for the diagnosis or treatment of lung cancer.
[0028] Quantitative real-time PCR was used to further examine miR-4670-3p expression in lung cancer tissues and adjacent adjacent tissues from lung cancer patients. The results showed that miR-4670-3p expression was significantly lower in lung cancer tissues compared with adjacent adjacent tissues. These results further validated the potential of miR-4670-3p as a diagnostic or therapeutic target for lung cancer.
[0029] Based on this, and to develop new lung cancer therapeutics, the present invention designed and synthesized a miR-4670-3p mimic. By transfecting the miR-4670-3p mimic into lung cancer A549 cells, the results showed that the miR-4670-3p mimic promoted apoptosis and inhibited migration of A549 lung cancer cells in vitro. Therefore, the present invention provides a new target and therapeutic drug for the treatment of lung cancer, which is of great significance, and thus the present invention was proposed.
[0030] In order to enable those skilled in the art to more clearly understand the technical solution of the present application, the technical solution of the present application will be described in detail below with reference to specific embodiments.
[0031] The test materials used in the examples of the present invention are all conventional test materials in the field and can be purchased through commercial channels. Experimental methods without detailed conditions were carried out according to conventional test methods or the operating instructions recommended by the supplier.
[0032] Example 1: Serum microRNA analysis
[0033] 1. Test method:
[0034] 400 μL of frozen serum from patients with non-small cell lung cancer and normal subjects was collected respectively, and serum microRNA was extracted using the miRcute miRNA Extraction and Isolation Kit (spin column type) from Tiangen Biochemical Technology (Beijing) Co., Ltd. The purified microRNA was collected and stored at -80°C.
[0035] The extracted microRNA is reverse transcribed to obtain cDNA. The reverse transcription reaction system consists of the following:
[0036] 1.25 μL of miRNA reverse transcriptase mixture, 5 μL of 2×miRNA reverse transcription reaction solution, 2 μg-20 ng of total RNA, and DEPC water (Rnase-free water) to make up to 10 μL.
[0037] Using the cDNA obtained by the above reverse transcription reaction as a template, quantitative real-time PCR was used to detect the expression levels of miR-4670-3p in the serum of normal subjects and lung cancer patients.
[0038] The reaction system for quantitative real-time PCR is as follows:
[0039] 2 μL of template, 0.8 μL of miRNA-specific primer (10 μM), 0.8 μL of miRNA Qpcr 3' universal primer (10 μM), 0.4 μL of fluorescent quantitative PCR reference dye (4 μM), and DEPC water (Rnase-free water) are added to 20 μL.
[0040] miRNA-specific primer sequence: 5'-GGTTACATCATGGTCGCTTAAA-3' (SEQ ID NO. 4)
[0041] The miRNA QPCR 3' universal primer is included in the miRNA cDNA first-strand synthesis kit of Accurate Biotechnology (Hunan) Co., Ltd.
[0042] Application 2 -△△Ct The relative expression of miR-4670-3p was calculated using the formula. GraphPad Prism software was used to analyze the expression of miR-4670-3p in different groups using a U test.
[0043] 2. Test results:
[0044] The results are as follows Figure 1 As shown, the results showed that the expression of miR-4670-3p in the serum of lung cancer patients was downregulated compared with that in normal human serum.
[0045] Example 2: Analysis of miR-4670-3p expression levels in lung cancer tissues and adjacent adjacent tissues
[0046] 1. Test method:
[0047] (1) Surgical resection of lung cancer tumor tissue and adjacent tissue more than 3.5 cm away from the tumor tissue was performed, and the collected tissue was stored at -80°C.
[0048] (2) During the experiment, the tumor tissue was removed, lysed by adding 500 μL of Trizol solution at 4°C for 30 min, and centrifuged at 1000 g for 10 min.
[0049] (3) The supernatant was then extracted with phenol-chloroform-isoamyl alcohol and precipitated with anhydrous ethanol. After the residual ethanol was completely evaporated, 50 μL of deionized water was added to dissolve the RNA.
[0050] (4) RNA was reverse transcribed into cDNA using a reverse transcription kit, and the expression level of miR-4670-3p was detected using a real-time fluorescence quantitative PCR kit. The detection method was the same as in Example 1.
[0051] 2. Test results:
[0052] The expression levels of miR-4670-3p in lung cancer tissues and adjacent tissues of lung cancer patients were detected by quantitative real-time PCR. -△△Ct The relative expression level of miR-4670-3p was calculated by the formula. The results are as follows Figure 2 As shown, the results showed that the expression of miR-4670-3p in lung cancer tissues was significantly decreased compared with adjacent adjacent tissues.
[0053] Example 3: Investigation of the effect of miR-4670-3p mimics on apoptosis and migration of lung cancer cells
[0054] 1. Test method:
[0055] (1) Design miR-4670-3p mimics and microRNA negative control (NC) as follows:
[0056] Sequence of miR-4670-3p mimic:
[0057] S:UGAAGUUACAUCAUGGUCGCUU; (SEQ ID NO.1)
[0058] AS:GCGACCAUGAUGUAACUUCAUU. (SEQ ID NO.2)
[0059] microRNA negative control:
[0060] S:UUCUCCGAAGGUGUCACGUTT; (SEQ ID NO.5)
[0061] AS:ACGUGACACGUUCGGAGAATT. (SEQ ID NO.6)
[0062] Note: According to the WIPOST.26 standard, uracil "U" in the miRNA sequence in the table is represented by "T" in the sequence listing.
[0063] (2) Cell transfection:
[0064] 1) One day before transfection, trypsinize the pre-transfected A549 cells and adjust the cell density to 2x10 5 Each dish was inoculated into a 60 mm culture dish and cultured in a 37°C, 5% CO2 incubator.
[0065] 2) After 16-24 hours, when the cell density reaches 80%, the complete culture medium in the dish (90% RPMI-1640 medium + 10% FBS, by volume) is replaced with RPMI-1640 medium.
[0066] 3) Dilute 5 μL of miR-4670-3p mimic or microRNA negative control in 500 μL RPMI-1640 medium.
[0067] 4) Take 7.5 μL of Lipofectamine 2000 liposomes and dilute them in 500 μL of RPMI-1640 culture medium.
[0068] 5) The diluted liposomes were mixed with mircoRNA (i.e., miR-4670-3p mimics or microRNA negative control) and incubated at room temperature for 20 minutes to obtain a mircoRNA liposome mixture.
[0069] 6) Add the mircRNA liposome mixture to the culture dish and shake gently to mix.
[0070] 7) After culturing in a 37°C, 5% CO2 incubator for 6-8 hours, replace the culture medium with complete culture medium and continue culturing. Observe and photograph under a microscope at 12 hours and 24 hours respectively.
[0071] (4) Hoechst 33258 live cell staining:
[0072] Part of the cells were taken for Hoechst33258 staining 12 hours after transfection to detect apoptotic cells and calculate the apoptosis rate.
[0073] Cell apoptosis rate = (number of apoptotic cells / total number of cells) × 100%
[0074] 1) Prepare staining solution: Dilute 0.1 mg / mL Hoechst 33258 stock solution 100-fold with complete culture medium to a final concentration of 10 μg / mL.
[0075] 2) Aspirate the complete culture medium after cell transfection, wash twice with 1× PBS, and add 2 mL / dish of Hoechst 33258 (10 μg / mL) staining solution;
[0076] 3) Incubate at 37°C for 15 min;
[0077] 4) Aspirate the stain, wash twice with 1× PBS, and then add 500 μL / dish of PBS;
[0078] 5) Observe and take photos under an inverted fluorescence microscope.
[0079] (5) A549 cell migration assay:
[0080] A549 cells were collected at 2×10 5 A549 cells were seeded at 100 μl / dish in 60 mm culture dishes and allowed to adhere for 24 hours to a density of approximately 80%. MiR-4670-3p mimics and negative controls were transfected using Lipofectamine 2000 liposomes, using the same transfection method as above. Six to eight hours after transfection, the culture medium was replaced with complete culture medium (90% RPMI-1640 + 10% FBS, by volume). The bottom of the dish was evenly streaked with a 200 μL pipette tip and photographed. Six to 12 hours later, the extent of cell migration was observed by photographing again.
[0081] Migration rate = [(0 h scratch width - 0 h scratch width after incubation) / 0 h scratch width] × 100%.
[0082] 2. Test results:
[0083] The results of cell apoptosis rate detection by Hoechst 33258 live cell staining are as follows Figure 3As shown in Figure 3, the results showed that compared with the NC group, the number of cells in the miR-4670-3p mimic transfection group decreased in a time-dependent manner ( Figure 3 Compared with the NC group, the number of apoptotic cells in the miR-4670-3p mimic transfection group increased significantly ( Figure 3 (B, C) showed that overexpression of miR-4670-3p could promote apoptosis of A549 cells and inhibit the development of lung cancer.
[0084] The results of the effect of miR-4670-3p mimics on A549 cell migration in vitro are as follows Figure 4 As shown, the results showed that compared with the NC group, the cell migration ability of the miR-4670-3p mimics transfection group was significantly weakened, indicating that miR-4670-3p mimics can inhibit the migration of lung adenocarcinoma cell A549 in vitro.
[0085] The above description is merely a preferred embodiment of the present application and is not intended to limit the present application. Various modifications and variations are possible for those skilled in the art. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present application shall be included within the scope of protection of the present application.
Claims
1. Use of miR-4670-3p mimics in the preparation of a drug for treating lung cancer, characterized in that: The miR-4670-3p mimic consists of a sense chain and an antisense chain. The nucleotide sequence of the sense chain is shown in SEQ ID NO.1; the nucleotide sequence of the antisense chain is shown in SEQ ID NO.
2.
2. The use according to claim 1, characterized in that The miR-4670-3p mimic achieves the treatment of lung cancer through the following pathways (1) or (2): (1) Inhibit lung cancer cell migration; (2) Promote apoptosis of lung cancer cells.
3. The use according to claim 1, characterized in that The medicine comprises: a miR-4670-3p mimic and a nucleic acid transfection agent.
4. The use according to claim 3, characterized in that The nucleic acid transfection agent is selected from one or more of a lipid-based transfection agent, a polymer-based transfection agent, a magnetic particle-based transfection agent, exosomes for nucleic acid delivery, or viral proteins for nucleic acid delivery.
Citation Information
Patent Citations
Application of miR-4311 simulant in preparation of medicine for treating lung cancer
CN114767703A
Regulated biocircuit systems
US20190192691A1