CRISPR / cas9-drug co-assembly biomimetic nano-system and preparation and application thereof

Abstract

The application discloses a CRISPR / Cas9-drug co-assembly biomimetic nano system and preparation and application thereof, and belongs to the technical field of biological medicines. The biomimetic nano system is composed of a natural product active small molecule drug as a nano inner core, a gene editing system and an auxiliary component co-assembled into a nano drug particle, and then a biomimetic membrane is further wrapped on the surface to form the biomimetic nano system; wherein the natural active small molecule drug is ursolic acid, the CRISPR / Cas9 gene editing system is a ribonucleoprotein complex containing a nuclear localization sequence, the auxiliary component is a cell-penetrating peptide, and the biomimetic membrane is a tumor cell membrane. The biomimetic nano system is constructed on the basis of revealing the combined immune regulation characteristics and molecular mechanisms of immune checkpoint PD-L1 gene therapy and natural product ursolic acid anti-tumor, has a significant inhibitory effect on the occurrence of liver cancer, and has a wide application prospect in the preparation of anti-liver cancer drugs.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to a CRISPR / Cas9-drug co-assembly biomimetic nanosystem and its preparation and application. Background Technology

[0002] Due to a complex combination of factors, including rapid population aging, socioeconomic development, and changes in the prevalence of related risk factors, cancer has become one of the leading causes of death worldwide. In 2020, 19.29 million new cancer cases and nearly 10 million cancer deaths were reported in 185 countries and regions globally. Currently, clinical treatment for cancer remains primarily based on surgical resection, radiotherapy, and chemotherapy. Chemotherapy is the most common treatment method, but due to the complex pathological processes of tumors, single-drug, traditional chemotherapy treatments are not very effective. High-dose administration can easily cause severe side effects and lead to drug resistance. In recent years, with advancements in medicine and technology, significant progress has been made in cancer treatment. However, finding safer and more effective drugs or treatments remains a crucial issue and challenge in cancer treatment.

[0003] Gene therapy has gradually become a research hotspot in recent years, providing new strategies for cancer treatment. Among these, the CRISPR / Cas9 system can efficiently, rapidly, and irreversibly knock out key oncogenes. Simultaneously, the CRISPR / Cas9 system can activate the immune system, utilizing its own immune system to eliminate tumor cells. In particular, immune checkpoint blockade (ICB) therapy targeting programmed cell death-1 (PD-1) and its ligand PD-L1 has brought new hope to cancer patients. However, due to the low immunogenicity of cancer patients, single gene therapy after targeted gene knockout cannot achieve effective treatment. Therefore, a natural, safe, and effective drug is needed to assist gene immunotherapy and promote T-cell infiltration in the tumor microenvironment. Chinese patent CN 107557393A discloses a magnetic nanomaterial-mediated CRISPR / Cas9 T-cell intracellular delivery system, its preparation method, and its applications. This nanocomposite demonstrates effective editing of target genes on T cells and shows promising application prospects in tumor immunotherapy.

[0004] Natural products, with their low toxicity, high efficiency, mild effects, and multi-level regulatory characteristics, have attracted widespread attention in the field of anti-tumor therapy. Ursolic acid (UA), a natural pentacyclic triterpenoid compound, possesses biological and pharmacological activities. It can inhibit tumor cell differentiation through different pathways, exhibiting significant anti-cancer effects with low toxicity. Importantly, ursolic acid has a unique immune-activating effect, stimulating the expression of related immune cytokines and effectively improving the body's recovery from immunosuppression to a normal physiological immune response, revealing its potential application in cancer immunotherapy. In recent years, many research teams have proposed nanomedicine delivery systems based on the "carrier-free" self-assembly concept. In these systems, the complexes act as both carriers and drugs, achieving high drug loading capacity and avoiding the potential toxicity and low drug loading capacity issues associated with traditional carriers. Furthermore, gene therapy drugs can be co-assembled with chemotherapy drugs to achieve carrier-free nanomedicine delivery systems. Chinese patent CN114522171A discloses a self-assembled nanoparticle of lentinan and ursolic acid, its preparation method, and its application. This nanoparticle forms a nanocomposite by self-assembling a hydrophilic carrier, lentinan, and a hydrophobic drug, ursolic acid, through hydrogen bonding. This nanocomposite exhibits good immunomodulatory capabilities, improving the immunosuppressive state of the tumor microenvironment and increasing the infiltration of T lymphocytes within the tumor. However, its application in the treatment of liver cancer based on the combination of gene therapy and drug therapy has not yet been reported.

[0005] This invention leverages mature nanotechnology to combine chemotherapy drugs with gene therapy. Through carrier-free self-assembly technology, it achieves an effective combination of gene therapy and chemotherapy, constructing a simple and efficient gene-chemotherapy drug nanodelivery system. This system utilizes the unique "drug delivery" properties of ursolic acid to co-assemble CRISPR / Cas9, camouflaging tumor cell membranes. Furthermore, by modifying the tumor cell membrane on the surface of the nanomedicine, its stability, targeting, and biocompatibility are enhanced. Ursolic acid not only exerts anti-tumor effects but also combines with gene therapy to block the immune checkpoint PD-L1, improving the immunosuppressive tumor microenvironment and achieving a synergistic effect between chemotherapy and gene therapy. This provides a new approach for multimodal combination therapy in cancer treatment. Summary of the Invention

[0006] The purpose of this invention is to provide a CRISPR / Cas9-drug co-assembled biomimetic nanosystem and its preparation and application. This invention co-assembles natural drug ursolic acid, a CRISPR / Cas9 system targeting the PD-L1 gene, and cell-penetrating peptides through intermolecular electrostatic and hydrophobic interactions to form nanoparticles. These nanoparticles are then encapsulated through tumor cell membranes, giving them excellent tumor recognition and immune escape capabilities, resulting in a tumor-self-targeting biomimetic nanodrug delivery system. This biomimetic nanoparticle integrates a multi-drug-multi-therapy combined application strategy, enabling better tumor suppression.

[0007] To achieve the above objectives, the present invention adopts the following technical solution:

[0008] A CRISPR / Cas9-drug co-assembly biomimetic nanosystem is constructed by using a natural active small molecule drug as the nanocore, co-assembling it with a CRISPR / Cas9 gene editing system and auxiliary components to form nanoparticles, and then further coating its surface with a biomimetic membrane.

[0009] Furthermore, the natural active small molecule drug is ursolic acid.

[0010] Furthermore, the CRISPR / Cas9 gene editing system is a ribonucleoprotein complex (Cas9 RNP) containing Cas9 protein with nuclear localization sequence and sgRNA targeting anticancer genes such as PD-L1, wherein the mass ratio of Cas9 protein to sgRNA is 1:1.

[0011] Furthermore, the auxiliary component is a cell-penetrating peptide.

[0012] Furthermore, the biomimetic membrane is a tumor cell membrane, specifically the cell membrane of human hepatocellular carcinoma HepG2 cells.

[0013] The preparation method of the CRISPR / Cas9-drug co-assembled biomimetic nanosystem includes the following steps:

[0014] 1) After dissolving natural active small molecule drugs, they are self-assembled into nanomedicines in water by solvent exchange. Then, the CRISPR / Cas9 gene editing system and auxiliary components are adsorbed on their surface to form nanomedicine particles (denoted as URC).

[0015] 2) The obtained nanoparticles are coated with a biomimetic membrane using a filter membrane to obtain the biomimetic nanosystem.

[0016] Furthermore, the mass ratio of the natural active small molecule drug, auxiliary ingredients, and CRISPR / Cas9 gene editing system used in step 1) is 60:1:3.

[0017] Furthermore, the nanoparticles obtained in step 1) have a particle size of 150 nm.

[0018] The CRISPR / Cas9-drug co-assembly biomimetic nanosystem can be used to prepare anti-liver cancer drugs.

[0019] The advantages of this invention are:

[0020] (1) This invention utilizes the unique "drug delivery" property of natural active small molecule ursolic acid as a nano core, and co-assembles Cas9 RNP and cell membrane peptide through intermolecular forces to form a simple and efficient nano delivery system, avoiding the potential toxicity of traditional carriers.

[0021] (2) The biomimetic nanomedicine prepared in this invention is based on CRISPR / Cas9 technology to achieve more thorough and efficient PD-L1 gene knockout, and selects natural product ursolic acid as nanomedicine to deliver CRISPR / Cas9. While killing tumor cells, ursolic acid can regulate the tumor immune microenvironment and work synergistically with the PD-L1 target to combine immune regulation mechanism, thereby overcoming the limitations of traditional chemotherapy and single gene therapy, and providing new strategies and methods for advanced combination therapy of malignant tumors.

[0022] (3) The biomimetic nanosystem prepared by the present invention has good stability under various physiological conditions.

[0023] (4) The preparation process of the biomimetic nanosystem of the present invention is simple and efficient. It integrates a multi-drug-multi-therapy strategy into the same nano-drug delivery system, which changes the limitations of traditional single chemotherapy in tumor inhibition and shows great potential in the field of liver cancer treatment. Attached Figure Description

[0024] Figure 1 This is a polyacrylamide gel image of the Cas9 RNP complexes prepared with different mass ratios of sgRNA and Cas9 protein in Example 1.

[0025] Figure 2 This is a particle size diagram of the nanoparticles prepared in Example 2.

[0026] Figure 3 This is a predicted analysis diagram of the interaction forces between the components in the nanoparticles prepared in Example 2.

[0027] Figure 4 This is a diagram showing the uptake of nanomedicine by HepG2 liver cancer cells in Example 3.

[0028] Figure 5 This is a graph showing the efficiency of gene knockout by nanomedicine particles in Example 4.

[0029] Figure 6 This is a graph showing the inhibitory effects of different substances on the proliferation of liver cancer cells in Example 5. Detailed Implementation

[0030] A CRISPR / Cas9-drug co-assembly biomimetic nanosystem is constructed by using a natural active small molecule drug as the nanocore, co-assembling it with a CRISPR / Cas9 gene editing system and auxiliary components to form nanoparticles, and then further coating its surface with a biomimetic membrane.

[0031] The natural active small molecule drug is ursolic acid.

[0032] The CRISPR / Cas9 gene editing system is a complex of ribonucleoproteins (Cas9 RNP) containing the nuclear localization sequence Cas9 protein and sgRNA targeting anticancer genes such as PD-L1.

[0033] The auxiliary component is a cell-penetrating peptide.

[0034] The biomimetic membrane is a tumor cell membrane, specifically the cell membrane of human hepatocellular carcinoma HepG2 cells.

[0035] To make the content of this invention easier to understand, the technical solution of this invention will be further described below with reference to specific embodiments, but this invention is not limited thereto.

[0036] Example 1

[0037] This embodiment provides a method for preparing a CRISPR / Cas9 gene editing system, the method comprising the following steps:

[0038] PD-L1-targeting oligonucleotide sequences (SgRNA-1 PD-L1 (Human)GTCCAGATGACTTCGGCCTT and SgRNA-2 PD-L1 (Human) TACCGCTGCATGATCAGCTA) were synthesized by Shanghai Sangon Biotech Co., Ltd. The reverse strand was also synthesized, and the two oligonucleotides were annealed to form complementary DNA double strands. These were then ligated to the pX459 plasmid digested with Bpil enzyme using the T4 enzyme. The ligated plasmid was transformed into competent *E. coli* DH5α cells, and positive clones were obtained through ampicillin-containing plate screening. Finally, gene sequencing confirmed the successful ligation of the PD-L1-targeting oligonucleotide sequences into the plasmid.

[0039] Using the recombinant pX459 plasmid containing the homologous sequence of the target gene as a template, oligonucleotide sequences containing trancrRNA and crRNA were obtained by PCR. The PCR program was: 95℃-5 min, (95℃-30s, 55℃-30s, 72℃-30s, 30 cycles), 72℃-5 min. The obtained double-stranded DNA fragment was used for in vitro transcription. An in vitro transcription kit was used to construct the following mixture: 2 μL DNA fragment, 4 μL 5× buffer, 4 μL NTP Mix, 2 μL T7 enzyme, and 4 μL DEPC water. The mixture was thoroughly mixed and incubated in a dry heat bath at 37℃ for 6 h to complete transcription. The concentration of the RNA product was quantified by micro-UV detection. Then, 70 μL DEPC water and 10 μL 3M NaAc were added to 20 μL of transcription reaction solution. Next, 100 μL of water-saturated phenol / chloroform mixture was added, thoroughly mixed, and centrifuged at 12000 rpm for 10 min. Collect the supernatant, add 2 volumes of anhydrous ethanol, and incubate at -20°C for 10 min. Centrifuge again under the same conditions, remove the supernatant, wash the precipitate with 1 mL of 70% ethanol, centrifuge again, and incubate until all ethanol has evaporated. Add 20 μL of DEPC water to dissolve the remaining precipitate, which is the PD-L1-targeted sgRNA, and store at -80°C. Mix the sgRNA obtained from in vitro transcription with the expressed Cas9 protein at different mass ratios, incubate at 220 rpm at room temperature for 6 h to bind, and optimize the Cas9RNP complex formulation using a polyacrylamide gel electrophoresis assay. The results are shown in [Figure number missing]. Figure 1 .

[0040] like Figure 1 As shown, isolated free sgRNA can pass through the gel pores. At mass ratios of 2:1 and 3:1, the sgRNA is in excess and cannot be bound by the Cas9 protein, existing in a large amount in a free state. When the mass ratio is 1:1, the two can bind well.

[0041] Example 2

[0042] The sgRNA obtained from external transcription in Example 1 was mixed with the expressed Cas9 protein at a mass ratio of 1:1 to form the Cas9 / sgPD-L1 RNP complex (Cas9 RNP). 4 mg of ursolic acid (UA) powder was dissolved in 1 mL of methanol and added to water under vortex oscillation. After mixing, the methanol was evaporated under nitrogen to obtain a nanomedicine solution formed by ursolic acid self-assembly. Then, the Cas9RNP complex and cell-penetrating peptide were slowly added, and the mixture was stirred and sonicated to obtain nanomedicine particles (URC).

[0043] The addition ratio of Cas9 RNP complex and cell-penetrating peptide was optimized, and the results are shown in Table 1.

[0044] Table 1 shows the different mass ratios used to optimize the preparation of URC.

[0045]

[0046] As shown in Table 1, based on the successful preparation of ursolic acid self-assembled nanomedicines (UA NPs), further adsorption of Cas9 RNP complex and cell-penetrating peptides on its surface with a mass ratio of 60:1:3 (UANPs: cell-penetrating peptides: Cas9 RNP complex) can form URC nanosolution with uniform particle size and uniform dispersion.

[0047] Collected HepG2 cells were dispersed in hypotonic PBS containing 1% PMSF and incubated at 4 °C. After 30 min, the cells were centrifuged (500 g, 10 min) to remove impurities, and the supernatant was centrifuged again (14000 g, 30 min) to obtain cell membranes, which were then freeze-dried and stored at -80 °C. 1 mL of the cell membrane suspension (1 mg / mL) was mixed with 10 mL of URC nanosolution under sonication for 15 min, and then extruded through a 200 nm polycarbonate film to prepare membrane-coated nanomedicines (URC@M NPs).

[0048] Figure 2 The figure shows the particle size distribution of the obtained nanoparticles. As can be seen from the figure, the URC nanoparticles have a particle size of approximately 150 nm, while the URC@M NPs nanoparticles have a particle size of 165 nm.

[0049] The interaction forces between the components in the nanoparticles were predicted and analyzed using software such as DS 4.5, Pymol, and AutoDock. The results are shown in [Figure number missing]. Figure 3 .

[0050] like Figure 3 As shown, Cas9 RNP and the membrane-penetrating peptide CPP can bind through positive and negative charges, and form a co-assembled nanocomposite with UA NPs through hydrogen bonds, van der Waals forces and hydrophobic interactions.

[0051] Example 3

[0052] This embodiment provides a method for monitoring the uptake of nanomedicines by HepG2 liver cancer cells using confocal microscopy. The method is as follows:

[0053] The Cas9 RNP complex was labeled with fluorescent dyes such as Cy5 or ICG, and then co-assembled with FITC-conjugated ursolic acid nanomedicines (UA NPs) and cell-penetrating peptides to form nanoparticles (URCs). These nanoparticles were then encapsulated in the cell membranes of HepG2 liver cancer cells with high PD-L1 expression. Laser confocal microscopy was used to examine the active targeting and recognition of tumor cells by the nanoparticles before and after encapsulation with the homologous cell membrane, as well as the drug's internalization within the cells. The results are as follows: Figure 4 As shown.

[0054] Depend on Figure 4 It is evident that URC@M NPs encapsulating tumor cell membranes exhibit more red fluorescence around the cell nucleus, indicating that the nanoparticles encapsulated in tumor cell membranes possess good tumor targeting capabilities.

[0055] Example 4

[0056] This embodiment provides the gene editing efficiency of the biomimetic nanosystem obtained by confocal monitoring on HepG2 liver cancer cells. The method includes the following steps:

[0057] A stable EGFP-transfected 293T cell line (293T-EGFP) was constructed as a control cell line. Different groups were established, including Lipo:plasmid, URC, and URC@M. The percentage reduction in green fluorescence in 293T-EGFP cells by the biomimetic nanosystem was examined using fluorescence microscopy / flow cytometry. The gene editing efficiency of the biomimetic nanosystem was also calculated. The results are as follows: Figure 5 As shown.

[0058] Depend on Figure 5 It is evident that the expression of EGFP green fluorescence in tumor cells treated with URC@M NPs was significantly reduced, indicating that the biomimetic nanosystem has a good target gene knockout effect, with a gene knockout rate as high as 80%.

[0059] Example 5

[0060] This embodiment uses an MTT assay to monitor the inhibitory effect of a biomimetic nanosystem on the proliferation of HepG2 liver cancer cells. The method includes the following steps:

[0061] Log-grown HepG2 cells were digested with trypsin containing EDTA, and the cell pellet was collected and resuspended in culture medium at a concentration of 1×10⁻⁶. 4One unit was added to a 96-well plate and cultured at 37°C and 5% CO2 for 24 h until the cells adhered and grew. Then, different concentrations of UA, UA NPs, Cas9 RNP, URC, and URC@M diluted with culture medium were added. After 24 h of drug treatment, MTT was added and incubated for 4 h. The MTT was discarded, and 100 μL of DMSO was added. The mixture was incubated on a shaker for 10 min to fully dissolve the formazan. The absorbance was then measured at 490 nm using a microplate reader. The results are as follows: Figure 6 As shown.

[0062] Depend on Figure 6 It is evident that all drug-treated groups exhibited a certain degree of killing effect on tumor cells in a concentration-dependent manner, and compared with other drug-treated groups, URC@M NPs showed significant cytotoxicity.

[0063] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made within the scope of the claims of the present invention should be included in the scope of the present invention.

Claims

1. A CRISPR / Cas9-drug co-assembly biomimetic nanosystem, characterized in that, The biomimetic nanosystem is composed of a natural active small molecule drug as a nanocore, a CRISPR / Cas9 gene editing system and an auxiliary component co-assembled into a nanomedicine particle, and then further wrapped with a biomimetic membrane on the surface; the CRISPR / Cas9 gene editing system is a complex containing a nuclear localization sequence; The natural active small molecule drug is ursolic acid; The CRISPR / Cas9 gene editing system is a ribonucleoprotein complex Cas9 RNP containing a nuclear localization sequence Cas9 protein and an anticancer gene target sgRNA, wherein the mass ratio of Cas9 protein to sgRNA is 1:1, SgRNA-1 is GTCCAGATGACTTCGGCCTT, and SgRNA-2 is TACCGCTGCATGATCAGCTA; The auxiliary component is a cell-penetrating peptide; The biomimetic membrane is a tumor cell membrane, specifically a human tumor hepatocarcinoma HepG2 cell membrane.

2. A process for the preparation of CRISPR / Cas9-drug co-assembly biomimetic nanosystem as claimed in claim 1, wherein, The method comprises the following steps: 1) After the natural active small molecule drug is dissolved, it is self-assembled into a nanomedicine in water by solvent exchange method, and then the CRISPR / Cas9 gene editing system and the auxiliary component are adsorbed on the surface to form a nanomedicine particle; 2) The obtained nanomedicine particle is surface-wrapped with a biomimetic membrane by filter membrane filtration to obtain the biomimetic nanosystem.

3. The method for preparing the CRISPR / Cas9-drug co-assembled biomimetic nanosystem according to claim 2, characterized in that: The mass ratio of the natural active small molecule drug, the auxiliary component and the CRISPR / Cas9 gene editing system used in step 1) is 60:1:

3.

4. The method for preparing the CRISPR / Cas9-drug co-assembled biomimetic nanosystem according to claim 2, characterized in that: The particle size of the nanomedicine particle obtained in step 1) is 150 nm.

5. Use of the CRISPR / Cas9-drug co-assembled biomimetic nanosystem of claim 1 in the preparation of an anti-liver cancer drug.

Images