Application of YH66-RS07020 Mutant Protein and Its Related Biomaterials in the Preparation of Valine

Abstract

The present invention discloses the application of the YH66-RS07020 mutant protein and its related biological materials in the preparation of valine. The YH66-RS07020 mutant protein is obtained by mutating the 84th amino acid residue of the YH66-RS07020 protein from A to other amino acid residues. The present invention discovers the YH66-RS07020 mutant protein, its coding gene and the application. The application of the mutant protein and its related biological materials is specifically the application in the preparation of valine. The present invention has great application value for the industrial production of valine.

Description

[0001] This application is a divisional application of the application with the application number "202110967402.9", the application date of August 23, 2021, and the invention title of "Engineered Bacteria Obtained by Genetic Modification of YH66-RS07020 and Its Application in the Preparation of Valine". Technical Field

[0002] The present invention belongs to the field of biotechnology and relates to the application of YH66-RS07020 mutant protein and its related biological materials in the preparation of valine. Background Art

[0003] Valine is one of the 20 amino acids that make up proteins, and it is one of the 8 essential amino acids and glucogenic amino acids for the human body. It works together with the other two amino acids with high concentrations (isoleucine and leucine) to promote normal body growth, repair tissues, regulate blood sugar, and provide the required energy. When participating in intense physical activities, valine can provide extra energy to muscles to produce glucose to prevent muscle weakness. Valine also helps remove excess nitrogen (potential toxins) from the liver and transports the nitrogen needed by the body to various parts.

[0004] Valine is an essential amino acid, which means that the body itself cannot produce it and must be supplemented through dietary sources. Its natural food sources include grains, dairy products, shiitake mushrooms, mushrooms, peanuts, soy protein, and meat. Although most people can obtain sufficient amounts from their diet, cases of valine deficiency are not uncommon. When valine is insufficient, the function of the central nervous system of the brain will be disordered, and ataxia will occur with limb tremors. By dissecting and slicing brain tissue, red nucleus cell degeneration is found. In patients with advanced liver cirrhosis, due to liver function damage, hyperinsulinemia is easily formed, resulting in a decrease in branched-chain amino acids in the blood. The ratio of branched-chain amino acids to aromatic amino acids drops from 3.0 - 3.5 in normal people to 1.0 - 1.5. Therefore, injections of branched-chain amino acids such as valine are commonly used to treat liver failure and the damage caused by alcoholism and drug addiction to these organs. In addition, valine can also be used as a therapeutic agent to accelerate wound healing. L-valine, also known as 2-amino-3-methylbutyric acid, has a CAS number of 72-18-4, an MDL number of MFCD00064220, and an EINECS number of 200-773-6. Currently, the preparation of L-valine is mainly by chemical synthesis. The limitations of chemical synthesis: high production cost, complex reactions, many steps, and many by-products. Summary of the Invention

[0005] The purpose of the present invention is to provide the application of YH66-RS07020 mutant protein and its related biological materials in the preparation of valine.

[0006] The present invention provides the use of a substance for inhibiting the expression of the YH66-RS07020 gene, or a substance for reducing the abundance of the YH66-RS07020 protein, or a substance for reducing the activity of the YH66-RS07020 protein;

[0007] The said use is as follows (I) or (II) or (III):

[0008] (I) The use in increasing the valine production of bacteria;

[0009] (II) The use in the production of valine;

[0010] (III) The use in increasing the bacterial cell mass.

[0011] The said YH66-RS07020 gene is a gene encoding the YH66-RS07020 protein.

[0012] The said YH66-RS07020 protein is as follows (a1) or (a2) or (a3):

[0013] (a1) The protein shown in Sequence 3 of the Sequence Listing;

[0014] (a2) A protein derived from bacteria, having more than 95% identity with (a1) and related to valine production in bacteria;

[0015] (a3) A protein derived from (a1), obtained by substitution and / or deletion and / or addition of one or several amino acid residues and related to valine production in bacteria.

[0016] As used herein, the term "identity" refers to the sequence similarity with the native amino acid sequence. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0017] The said more than 95% identity can specifically be more than 96% identity, or more than 97% identity, or more than 98% identity, or more than 99% identity.

[0018] Specifically, the said YH66-RS07020 gene is as follows (b1) or (b2) or (b3):

[0019] (b1) A DNA molecule with a coding region as shown in Sequence 4 of the Sequence Listing;

[0020] (b2) A DNA molecule derived from bacteria, having more than 95% identity with (b1) and encoding the said protein;

[0021] (b3) A DNA molecule that hybridizes with (b1) under stringent conditions and encodes said protein.

[0022] As used herein, the term "identity" refers to sequence similarity to a native nucleic acid sequence. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0023] The identity of more than 95% can specifically be identity of more than 96% or identity of more than 97% or identity of more than 98% or identity of more than 99%.

[0024] The stringent conditions can be hybridization and membrane washing in a solution of 0.1×SSPE (or 0.1×SSC) and 0.1% SDS at 65°C.

[0025] The inhibition of the expression of the YH66-RS07020 gene can be knockout of the YH66-RS07020 gene, or can also be mutation of the YH66-RS07020 gene.

[0026] Exemplarily, the substance for inhibiting the expression of the YH66-RS07020 gene can specifically be the DNA molecule shown in Sequence 5 of the Sequence Listing or a recombinant plasmid having the DNA molecule shown in Sequence 5 of the Sequence Listing.

[0027] Exemplarily, the substance for inhibiting the expression of the YH66-RS07020 gene can specifically be the DNA molecule shown in Sequence 8 of the Sequence Listing or a recombinant plasmid having the DNA molecule shown in Sequence 8 of the Sequence Listing.

[0028] Exemplarily, the substance for inhibiting the expression of the YH66-RS07020 gene can specifically be the recombinant plasmid pK18-YH66-RS07020 in the examples C251T or the recombinant plasmid pK18-ΔYH66-RS07020.

[0029] The present invention also provides a recombinant bacterium obtained by inhibiting the expression of the YH66-RS07020 gene in bacteria.

[0030] The inhibition of the expression of the YH66-RS07020 gene in bacteria can be knockout of the YH66-RS07020 gene in bacteria, or can also be mutation of the YH66-RS07020 gene in bacteria.

[0031] The knockout can be knockout of a partial segment of the gene, or can also be knockout of the entire coding frame of the gene.

[0032] Exemplarily, knocking out the YH66-RS07020 gene in bacteria may specifically be: deleting the DNA molecule shown in Sequence 4 of the Sequence Listing from the bacterial genomic DNA.

[0033] For the YH66-RS07020 gene in mutant bacteria, those of ordinary skill in the art can easily adopt known methods, such as site-directed mutagenesis or gene editing, etc.

[0034] Exemplarily, mutating the YH66-RS07020 gene in bacteria may specifically be: mutating the codon encoding the 84th amino acid residue of the YH66-RS07020 protein encoded in the bacterial genomic DNA from the codon encoding A to a codon encoding other amino acid residues. Specifically, the other amino acid residue is V.

[0035] Exemplarily, mutating the YH66-RS07020 gene in bacteria may specifically be: causing the following point mutation in the YH66-RS07020 gene in the bacterial genomic DNA: the 251st nucleotide is mutated from C to other nucleotides (specifically T).

[0036] Exemplarily, the way to achieve the inhibition of the expression of the YH66-RS07020 gene in bacteria may be: introducing a substance for inhibiting the expression of the YH66-RS07020 gene into the bacteria.

[0037] The substance for inhibiting the expression of the YH66-RS07020 gene may specifically be the DNA molecule shown in Sequence 5 of the Sequence Listing or a recombinant plasmid having the DNA molecule shown in Sequence 5 of the Sequence Listing.

[0038] Exemplarily, the substance for inhibiting the expression of the YH66-RS07020 gene may specifically be the DNA molecule shown in Sequence 8 of the Sequence Listing or a recombinant plasmid having the DNA molecule shown in Sequence 8 of the Sequence Listing.

[0039] Exemplarily, the substance for inhibiting the expression of the YH66-RS07020 gene may specifically be the recombinant plasmid pK18-YH66-RS07020 in the examples C251T or the recombinant plasmid pK18-ΔYH66-RS07020.

[0040] The present invention also protects the application of the recombinant bacterium in the preparation of valine.

[0041] The present invention also protects a method for preparing valine, comprising the following steps: fermenting the recombinant bacterium.

[0042] Those skilled in the art can carry out fermentation using fermentation methods in the prior art. The fermentation method can also be optimized and improved through routine tests. Bacterial fermentation can be carried out in a suitable culture medium under fermentation conditions known in the art. The culture medium can include: a carbon source, a nitrogen source, trace elements, and combinations thereof. During the cultivation, the pH of the culture can be adjusted. In addition, during the cultivation, it can include preventing the generation of bubbles, for example, by using an antifoaming agent to prevent the generation of bubbles. In addition, during the cultivation, it can include injecting a gas into the culture. The gas can include any gas capable of maintaining aerobic conditions of the culture. During the cultivation, the temperature of the culture can be 20 to 45 °C.

[0043] The method may further include the following steps: obtaining valine from the culture. Obtaining valine from the culture can be achieved by various means, including but not limited to: treating the culture with sulfuric acid or hydrochloric acid, etc., followed by a combination of methods such as anion exchange chromatography, concentration, crystallization, and isoelectric point precipitation.

[0044] In the fermentation, the formula of an exemplary fermentation medium is shown in Table 3, and the balance is water.

[0045] In the fermentation, an exemplary fermentation control process is shown in Table 4.

[0046] Exemplarily, at the initial moment when inoculation is completed in the fermentation, the OD value of the system can be 0.3 - 0.5.

[0047] Exemplarily, during the fermentation process: ammonia water is used to adjust the pH; when there are foams in the fermentation system, an appropriate amount of antifoam (CB - 442) is added; the sugar content (residual sugar) of the system is controlled by supplementing a 70% glucose aqueous solution.

[0048] The present invention also provides a method for increasing the valine production of bacteria, including the following steps: inhibiting the expression of the YH66 - RS07020 gene in bacteria or reducing the abundance of the YH66 - RS07020 protein in bacteria or reducing the activity of the YH66 - RS07020 protein in bacteria.

[0049] The inhibition of the expression of the YH66 - RS07020 gene in bacteria can be knocking out the YH66 - RS07020 gene in bacteria, or can be mutating the YH66 - RS07020 gene in bacteria.

[0050] The knocking out can be knocking out a partial segment of the gene, or can be knocking out the entire coding frame of the gene.

[0051] Exemplarily, knocking out the YH66 - RS07020 gene in bacteria can specifically be: deleting the DNA molecule shown in Sequence 4 of the sequence listing from the bacterial genomic DNA.

[0052] For the YH66-RS07020 gene in mutant bacteria, those of ordinary skill in the art can easily adopt known methods, such as site-directed mutagenesis or gene editing, etc.

[0053] Exemplarily, the YH66-RS07020 gene in mutant bacteria can specifically be: mutating the codon of the 84th amino acid residue of the YH66-RS07020 protein encoded in the bacterial genomic DNA from the codon encoding A to the codon encoding other amino acid residues. Specifically, the other amino acid residue is V.

[0054] Exemplarily, the YH66-RS07020 gene in mutant bacteria can specifically be: causing the following point mutation in the YH66-RS07020 gene in the bacterial genomic DNA: the 251st nucleotide is mutated from C to other nucleotides (specifically T).

[0055] Exemplarily, the implementation manner of inhibiting the expression of the YH66-RS07020 gene in bacteria can be: introducing a substance for inhibiting the expression of the YH66-RS07020 gene into the bacteria.

[0056] The substance for inhibiting the expression of the YH66-RS07020 gene can specifically be the DNA molecule shown in Sequence 5 of the sequence listing or a recombinant plasmid having the DNA molecule shown in Sequence 5 of the sequence listing.

[0057] Exemplarily, the substance for inhibiting the expression of the YH66-RS07020 gene can specifically be the DNA molecule shown in Sequence 8 of the sequence listing or a recombinant plasmid having the DNA molecule shown in Sequence 8 of the sequence listing.

[0058] Exemplarily, the substance for inhibiting the expression of the YH66-RS07020 gene can specifically be the recombinant plasmid pK18-YH66-RS07020 in the examples C251T or the recombinant plasmid pK18-ΔYH66-RS07020.

[0059] The present invention also protects the application of the YH66-RS07020 protein in regulating the valine production of bacteria.

[0060] The regulation is negative regulation, that is, when the content of the YH66-RS07020 protein increases, the valine production decreases.

[0061] The regulation is negative regulation, that is, when the content of the YH66-RS07020 protein decreases, the valine production increases.

[0062] The present invention also protects the application of the YH66-RS07020 protein in regulating the bacterial cell density.

[0063] The regulation is negative regulation, that is, when the content of YH66-RS07020 protein increases, the bacterial count decreases.

[0064] The regulation is negative regulation, that is, when the content of YH66-RS07020 protein decreases, the bacterial count increases.

[0065] The present invention also protects a mutant protein named YH66-RS07020 C251T protein, which is obtained by mutating the 84th amino acid residue of YH66-RS07020 protein from A to other amino acid residues.

[0066] Specifically, the other amino acid residue is V.

[0067] Exemplarily, the mutant protein is as shown in Sequence 1 of the sequence listing.

[0068] The present invention also protects the coding gene of YH66-RS07020 C251T protein (named YH66-RS07020 C251T gene).

[0069] The present invention also protects an expression cassette having the YH66-RS07020 C251T gene or a recombinant vector having the YH66-RS07020 C251T gene or a recombinant bacterium having the YH66-RS07020 C251T gene.

[0070] Specifically, the YH66-RS07020 C251T gene is as follows (c1) or (c2) or (c3):

[0071] (c1) a DNA molecule whose coding region is as shown in Sequence 2 of the sequence listing;

[0072] (c2) a DNA molecule derived from bacteria and having more than 95% identity with (c1) and encoding the said protein;

[0073] (c3) a DNA molecule that hybridizes with (c1) under stringent conditions and encodes the said protein.

[0074] As used herein, the term "identity" refers to sequence similarity to a native nucleic acid sequence. Identity can be evaluated by the naked eye or by computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to evaluate the identity between related sequences.

[0075] The above-mentioned more than 95% identity can specifically be more than 96% identity or more than 97% identity or more than 98% identity or more than 99% identity.

[0076] The stringent conditions may be hybridization and membrane washing at 65°C in a solution of 0.1×SSPE (or 0.1×SSC) and 0.1% SDS.

[0077] The present invention also protects YH66-RS07020 C251T protein, YH66-RS07020 C251T gene, an expression cassette having YH66-RS07020 C251T gene or a recombinant vector having YH66-RS07020 C251T or a recombinant bacterium having YH66-RS07020 C251T in the preparation of valine.

[0078] The present invention also protects a method for increasing the valine production of bacteria, comprising the following steps: mutating the codon encoding the 84th amino acid residue of the YH66-RS07020 protein encoded in the bacterial genomic DNA from the codon encoding A to a codon encoding another amino acid residue.

[0079] Specifically, the other amino acid residue is V.

[0080] The method specifically comprises the following steps: causing the YH66-RS07020 gene in the bacterial genomic DNA to undergo the following point mutation: the 251st nucleotide is mutated from C to another nucleotide (specifically, it may be T).

[0081] The method specifically comprises the following steps: introducing the DNA molecule shown in SEQ ID NO: 5 in the sequence listing or a recombinant plasmid having the DNA molecule shown in SEQ ID NO: 5 in the sequence listing into bacteria.

[0082] Any of the above-mentioned bacteria includes, but is not limited to, the following: bacteria of the genus Corynebacterium, preferably Corynebacterium acetoacidophilum, Corynebacterium acetoglutamicum, Corynebacterium callunae, Corynebacterium glutamicum, Brevibacterium flavum, Brevibacterium lactofermentum, Corynebacterium ammoniagenes, Corynebacterium pekinense, Brevibacterium saccharolyticum, Brevibacterium roseum, Brevibacterium thiogenitalis.

[0083] Any of the above-mentioned bacteria is a bacterium having the ability to produce valine.

[0084] "A bacterium having the ability to produce valine" means that the bacterium has the following ability: the ability to produce and accumulate valine in a culture medium and / or in the cells of the bacterium. Thus, valine can be collected when the bacterium is cultured in a culture medium.

[0085] The bacterium may be a wild-type bacterium collected naturally or a modified bacterium.

[0086] "A modified bacterium" refers to a transformed bacterium obtained by artificially mutating and / or mutagenizing a wild-type bacterium collected naturally.

[0087] Specifically, the Corynebacterium glutamicum may be Corynebacterium glutamicum CGMCC21260.

[0088] Corynebacterium glutamicum YPFV1 was deposited at the China General Microbiological Culture Collection Center (abbreviated as CGMCC, address: No. 3, Building 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences) on November 30, 2020, and the deposit registration number is CGMCC No. 21260. Corynebacterium glutamicum YPFV1 is also known as Corynebacterium glutamicum CGMCC21260.

[0089] The meaning of valine in any of the above is valine in a broad sense, including free-form valine, salts of valine, or mixtures of both.

[0090] Specifically, the valine is L-valine.

[0091] Any of the above methods or applications can also be used for the preparation of downstream products of valine.

[0092] The YH66-RS07020 protein in Corynebacterium glutamicum is as shown in Sequence 3 of the Sequence Listing, and its encoding gene is as shown in Sequence 4 of the Sequence Listing. In the present invention, by introducing point mutations, the YH66-RS07020 C251T protein shown in Sequence 1 of the Sequence Listing was obtained. The encoding gene of the YH66-RS07020 C251T protein is as shown in Sequence 2 of the Sequence Listing. Compared with the YH66-RS07020 gene, the difference in the YH66-RS07020 C251T gene is that the nucleotide at position 251 is mutated from C to T. Compared with the YH66-RS07020 protein, the difference in the YH66-RS07020 C251T protein is that the amino acid residue at position 84 is mutated from A to V.

[0093] The present invention discovers that the YH66-RS07020 protein has a negative regulation on the valine production of bacteria, that is, when the content of the YH66-RS07020 protein increases, the valine production decreases, and when the content of the YH66-RS07020 protein decreases, the valine production increases. Inhibiting the expression of the YH66-RS07020 gene can increase the valine production, and overexpressing the YH66-RS07020 gene reduces the valine production. Further, the present invention discovers the YH66-RS07020 C251T protein, its encoding gene and applications. The present invention has great application value for the industrial production of valine. Detailed implementation manners

[0094] The present invention will be further described in detail below in combination with specific implementation manners. The examples given are only for clarifying the present invention, rather than limiting the scope of the present invention. The following examples provided can be used as a guide for those of ordinary skill in the art to make further improvements, and do not limit the present invention in any way.

[0095] In the following examples, the experimental methods are conventional methods unless otherwise specified, and are carried out according to the techniques or conditions described in the literature in this field or according to the product instructions. The materials, reagents, etc. used in the following examples can be obtained from commercial sources unless otherwise specified. pK18mobsacB plasmid: Addgene; The pK18mobsacB plasmid has a kanamycin resistance gene as a selection marker. pXMJ19 plasmid: BioVector Plasmid Vector Strain Cell Gene Preservation Center; The pXMJ19 plasmid has a chloramphenicol resistance gene as a selection marker. NEBuilder enzyme: NEB. Unless otherwise specified, the medium in the examples is the medium with the formulation shown in Table 1 (the balance is water, pH 7.0). The medium without kanamycin is the medium shown in Table 1. The medium containing kanamycin is composed of the medium shown in Table 1 and kanamycin, and the content of kanamycin is 50 μg / ml. Unless otherwise specified, the culture in the examples refers to static culture at 32 °C. Single-strand conformational polymorphism polyacrylamide gel electrophoresis (sscp-PAGE) in the examples: The gel concentration used is 8%, and the composition of the electrophoresis gel is shown in Table 2; The electrophoresis conditions are: using 1×TBE buffer, 120 V voltage, and electrophoresis time of 10 h.

[0096] Unless otherwise specified, in the following examples, the quantitative tests are all set up with three repeated experiments, and the results are averaged.

[0097] Table 1

[0098] Components Concentration in the culture medium Sucrose 10 g / L Polypeptone 10 g / L Beef extract 10 g / L Yeast powder 5 g / L Urea 2 g / L Sodium chloride 2.5 g / L Agar powder 20 g / L

[0099] Table 2

[0100] Components Dosage 40% Acrylamide 8 mL <![CDATA[ddH 2 O]]> 26 mL Glycerol 4 mL 10×TBE 2 mL TEMED 40 μL 10% AP 600 μL

[0101] Example 1. Obtaining of Corynebacterium glutamicum CGMCC21260

[0102] Corynebacterium glutamicum ATCC15168: Corynebacterium glutamicum with the number 15168 in ATCC.

[0103] Corynebacterium glutamicum ATCC15168 was mutagenized to obtain Corynebacterium glutamicum YPFV1.

[0104] Corynebacterium glutamicum YPFV1 was deposited at the General Microbiological Center of the China Committee for Culture Collection of Microorganisms (abbreviated as CGMCC, address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences) on November 30, 2020, with the deposit registration number CGMCC No. 21260. Corynebacterium glutamicum YPFV1 is also known as Corynebacterium glutamicum CGMCC21260.

[0105] Example 2: Construction of recombinant strain YPV-013

[0106] P1: 5'- CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG AACGCCCGCATCGAAGACCT-3';

[0107] P2: 5'-GCCGTAGTCCATGAGTACCCAGACGGCGTGCTCG-3';

[0108] P3: 5'-CGAGCACGCCGTCTGGGTACTCATGGACTACGGC-3';

[0109] P4: 5'- CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC ATCCTAGAGGGGCACTTTTC-3'.

[0110] P5: 5'-CGGACTGTTTTCCAACTGGC-3';

[0111] P6: 5'-CCGGGGTTTGTTCCATGAGC-3'.

[0112] I. Construction of recombinant plasmid

[0113] 1. Using Corynebacterium glutamicum ATCC15168 as a template, PCR amplification was carried out with the primer pair consisting of primer P1 and primer P2, and the amplified product (674 bp) was recovered.

[0114] 2. Using Corynebacterium glutamicum ATCC15168 as a template, PCR amplification was carried out with the primer pair consisting of primer P3 and primer P4, and the amplified product (674 bp) was recovered.

[0115] 3. At the same time, the amplified product recovered in step 1 and the amplified product recovered in step 2 were used as templates, and PCR amplification (Overlap PCR) was carried out with the primer pair consisting of primer P1 and primer P4, and the amplified product (1314 bp) was recovered. After sequencing, the amplified product is shown as sequence 5 in the sequence listing.

[0116] 4. Take the pK18mobsacB plasmid and perform single digestion with the restriction enzyme Xba I, and recover the linearized plasmid.

[0117] 5. Co-incubate the amplified product recovered in step 3 with the linearized plasmid recovered in step 4 (using NEBuilder enzyme, incubate at 50 °C for 30 min) to obtain the recombinant plasmid pK18-YH66-RS07020. C251T . After sequencing verification, the recombinant plasmid pK18-YH66-RS07020 C251T contains the DNA molecule shown in Sequence 5 of the Sequence Listing.

[0118] II. Construction of recombinant bacterium YPV-013

[0119] 1. Use the recombinant plasmid pK18-YH66-RS07020 C251T to perform electrotransformation on Corynebacterium glutamicum CGMCC21260, and then culture it.

[0120] 2. Pick the strains in step 1, culture them in a medium containing 15% sucrose, then pick single colonies and culture them in a medium containing kanamycin and a medium without kanamycin respectively, and screen the strains that cannot grow on the medium containing kanamycin and can grow on the medium without kanamycin.

[0121] 3. Take the strains screened in step 2 and perform PCR amplification using the primer pair composed of primer P5 and primer P6, and then recover the amplified product (278 bp).

[0122] 4. Take the amplified product in step 3, first denature it at 95 °C for 10 min and then ice-bath it for 5 min, and then perform sscp-PAGE. During electrophoresis, use the amplified fragment of the recombinant plasmid pK18-YH66-RS07020 C251T (that is, the amplified product obtained by performing PCR amplification using the primer pair composed of primer P5 and primer P6 with the recombinant plasmid pK18-YH66-RS07020 C251T as the template) as the positive control, use the amplified fragment of Corynebacterium glutamicum CGMCC21260 (that is, the amplified product obtained by performing PCR amplification using the primer pair composed of primer P5 and primer P6 with Corynebacterium glutamicum CGMCC21260 as the template) as the negative control, and use water as the blank control. Due to different fragment structures, the electrophoresis positions are different. The strains with electrophoresis positions inconsistent with the negative control and consistent with the positive control are the screened target strains (recombinant strains with successful allelic replacement).

[0123] 5. According to the results of step 4, sequence verification is performed on the amplification products of step 3 of the screened strains to obtain the recombinant strain YPV-013. Compared with Corynebacterium glutamicum CGMCC21260, the difference in the recombinant strain YPV-013 is only that the YH66-RS07020 gene shown in sequence 4 of the sequence listing in the genome of Corynebacterium glutamicum CGMCC21260 is replaced with the YH66-RS07020 shown in sequence 2 of the sequence listing. C251T gene. There is only one nucleotide difference between sequence 2 and sequence 4, which is located at the 251st position. The recombinant strain YPV-013 is an engineered strain obtained by mutating (single-point mutation) the YH66-RS07020 gene in Corynebacterium glutamicum CGMCC21260.

[0124] Example 2. Construction of recombinant strain YPV-015 and recombinant strain YPV-014

[0125] P7: 5'- CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG CATGACGGCTGACTGGACTC-3';

[0126] P8: 5'-TGAAATGTAAGATTCAAAGAAATCGGACTCCTTAAATGGG-3';

[0127] P9: 5'-CCCATTTAAGGAGTCCGATTTCTTTGAATCTTACATTTCA-3';

[0128] P10: 5'-TGGGTGGTAAATTTTTCCATGGAACTCACCGTCCTTACAG-3';

[0129] P11: 5'-CTGTAAGGACGGTGAGTTCCATGGAAAAATTTACCACCCA-3';

[0130] P12: 5'-CTATGTGAGTAGTCGATTTATTAAGCGTTAGTGCGTGGCT-3';

[0131] P13: 5'-AGCCACGCACTAACGCTTAATAAATCGACTACTCACATAG-3';

[0132] P14: 5'- CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC TGCATAAGAAACAACCACTT-3'.

[0133] P15: 5'-GTCCGCTCTGTTGGTGTTCA-3';

[0134] P16: 5'-AGAAGTTCGATGTCGGACTG-3'.

[0135] P17: 5'-CCAACGTGGACACCGACCAG-3';

[0136] P18: 5'-TGGAGGAATATTCGGCCCAG-3'.

[0137] I. Construction of recombinant strain YPV-015

[0138] 1. Using recombinant strain YPV-013 as a template, perform PCR amplification with the primer pair consisting of primer P7 and primer P8, and recover the amplification product (806 bp).

[0139] 2. Using recombinant strain YPV-013 as a template, perform PCR amplification with the primer pair consisting of primer P9 and primer P10, and recover the amplification product (293 bp).

[0140] 3. Using recombinant strain YPV-013 as a template, perform PCR amplification with the primer pair consisting of primer P11 and primer P12, and recover the amplification product (634 bp).

[0141] 4. Using recombinant strain YPV-013 as a template, perform PCR amplification with the primer pair consisting of primer P13 and primer P14, and recover the amplification product (783 bp).

[0142] 5. Take the pK18mobsacB plasmid, perform single digestion with the restriction endonuclease Xba I, and recover the linearized plasmid.

[0143] 6. Co-incubate the amplification product recovered in step 1, the amplification product recovered in step 2, the amplification product recovered in step 3, the amplification product recovered in step 4 with the linearized plasmid recovered in step 5 (using NEBuilder enzyme, incubate at 50 °C for 30 min) to obtain recombinant plasmid 015. After sequencing verification, the recombinant plasmid 015 has the DNA molecule shown in Sequence 6 of the sequence listing.

[0144] 7. Perform electrotransformation of Corynebacterium glutamicum CGMCC21260 with recombinant plasmid 015, then culture, and then perform PCR identification on each single colony respectively (using the primer pair consisting of primer P15 and primer P16). The strain that can amplify a 1454 bp band is a positive strain.

[0145] 8. Pick the positive strain in step 7, culture it in a medium containing 15% sucrose, then pick single colonies, and culture them respectively in a medium containing kanamycin and a medium without kanamycin, and screen the strains that cannot grow on the medium containing kanamycin and can grow on the medium without kanamycin.

[0146] 9. Take the strains screened in step 8 and perform PCR amplification using the primer pair consisting of primer P17 and primer P18. The strain that amplifies a 1335bp band is YH66-RS07020 C251T The positive strain with the gene integrated into the genome of Corynebacterium glutamicum CGMCC21260 was named recombinant strain YPV-015. The recombinant strain YPV-015 is an engineered strain with overexpression of YH66-RS07020 gene in the genome C251T engineered strain

[0147] II. Construction of recombinant strain YPV-014

[0148] Replace the template with "Corynebacterium glutamicum ATCC15168" instead of "recombinant strain YPV-013", and the rest is the same as in step I

[0149] A positive strain with the YH66-RS07020 gene integrated into the genome of Corynebacterium glutamicum CGMCC21260 was obtained and named recombinant strain YPV-014. The recombinant strain YPV-014 is an engineered strain with overexpression of the YH66-RS07020 gene in the genome. Compared with the recombinant strain YPV-015, the difference in the recombinant strain YPV-014 is only that: in the sequence of the exogenous DNA integrated into the genome of Corynebacterium glutamicum CGMCC21260, sequence 4 replaces sequence 2

[0150] Example 3. Construction of recombinant strains YPV-017 and YPV-016

[0151] I. Construction of recombinant strain YPV-017

[0152] 1. Using the recombinant strain YPV-013 as a template, perform PCR amplification using the primer pair consisting of primer P19 and primer P20, and recover the amplification product (917bp). After sequencing, the amplification product is as shown in sequence 7 of the sequence listing

[0153] P19: 5'- GCTTGCATGCCTGCAGGTCGACTCTAGAGGATCCCC TCTTTGAATCTTACATTTCA-3';

[0154] P20: 5'- ATCAGGCTGAAAATCTTCTCTCATCCGCCAAAAC TTAAGCGTTAGTGCGTGGCT-3'.

[0155] 2. Take the pXMJ19 plasmid and perform single enzyme digestion using the restriction enzyme EcoR I, and recover the linearized plasmid

[0156] 3. Co-incubate the amplified product recovered in step 1 with the linearized plasmid recovered in step 2 (using NEBuilder enzyme, incubate at 50 °C for 30 min) to obtain the recombinant plasmid pXMJ19-YH66-RS07020 C251T . After sequencing verification, the recombinant plasmid pXMJ19-YH66-RS07020 C251T contains the DNA molecule shown in Sequence 7 of the Sequence Listing

[0157] 4. Electrotransform the recombinant plasmid pXMJ19-YH66-RS07020 C251T into Corynebacterium glutamicum CGMCC21260 to obtain the recombinant strain YPV-017. The recombinant strain YPV-017 is a genetically engineered strain that overexpresses the pXMJ19-YH66-RS07020 C251T gene through a plasmid

[0158] II. Construction of the recombinant strain YPV-016

[0159] Replace the template "recombinant strain YPV-013" with "Corynebacterium glutamicum ATCC15168", and the other steps are the same as in step one

[0160] Obtain the recombinant strain YPV-016. The recombinant strain YPV-016 is a genetically engineered strain that overexpresses the YH66-RS07020 gene through a plasmid. Compared with the recombinant strain YPV-017, the only difference in the recombinant strain YPV-016 is that: in the sequence of the foreign DNA overexpressed through the plasmid, Sequence 4 replaces Sequence 2

[0161] Example 4. Construction of a genetically engineered strain with the YH66-RS07020 gene deleted from the genome

[0162] P21: 5'- CAGTGCCAAGCTTGCATGCCTGCAGGTCGACTCTAG CGTGCCGGCATGATCGCCCC-3';

[0163] P22: 5'-TTTCGCTATCAGACTGAAACTCTTTTTCTAGCCTTCCTTA-3';

[0164] P23: 5'-TAAGGAAGGCTAGAAAAAGAGTTTCAGTCTGATAGCGAAA-3';

[0165] P24: 5'- CAGCTATGACCATGATTACGAATTCGAGCTCGGTACCC GTTGCCCTTCAAACCCACCG-3'.

[0166] P25: 5'-CGTGCCGGCATGATCGCCCC-3';

[0167] P26: 5'-GTTGCCCTTCAAACCCACCG-3'.

[0168] I. Construction of recombinant plasmid

[0169] 1. Using Corynebacterium glutamicum ATCC15168 as a template, perform PCR amplification with the primer pair consisting of primer P21 and primer P22, and recover the amplification product (upstream homologous arm fragment, 787 bp).

[0170] 2. Using Corynebacterium glutamicum ATCC15168 as a template, perform PCR amplification with the primer pair consisting of primer P23 and primer P24, and recover the amplification product (downstream homologous arm fragment, 773 bp).

[0171] 3. Simultaneously use the amplification product recovered in step 1 and the amplification product recovered in step 2 as templates, and perform PCR amplification (Overlap PCR) with the primer pair consisting of primer P21 and primer P24, and recover the amplification product (1520 bp). After sequencing, the amplification product is as shown in Sequence 8 of the sequence listing.

[0172] 4. Take the pK18mobsacB plasmid, perform single digestion with the restriction endonuclease Xba I, and recover the linearized plasmid.

[0173] 5. Incubate the amplification product recovered in step 3 and the linearized plasmid recovered in step 4 together (using NEBuilder enzyme, incubate at 50 °C for 30 min) to obtain the recombinant plasmid pK18-ΔYH66-RS07020. After sequencing verification, the recombinant plasmid pK18-ΔYH66-RS07020 contains the DNA molecule as shown in Sequence 8 of the sequence listing.

[0174] II. Construction of recombinant strain YPV-018

[0175] 1. Use the recombinant plasmid pK18-ΔYH66-RS07020 to perform electrotransformation on Corynebacterium glutamicum CGMCC21260, then culture, and then perform PCR identification on each single colony (using the primer pair consisting of primer P25 and P26). The strain that can simultaneously amplify 1446 bp and 2040 bp bands is the positive strain. The strain that only amplifies the 2040 bp band is the starting strain with failed transformation, and the 2040 bp fragment is as shown in Sequence 9 of the sequence listing.

[0176] 2. Pick the positive strain in step 1, culture it in a medium containing 15% sucrose, then pick single colonies and culture them in a medium containing kanamycin and a medium without kanamycin respectively, and screen the strains that cannot grow on the medium containing kanamycin and can grow on the medium without kanamycin.

[0177] 3. Take the strains screened in step 2 and perform PCR amplification using the primer pair consisting of primer P25 and primer P26. The strain with only one amplification product and a size of 1446 bp is the positive strain with the YH66-RS07020 gene coding region knocked out.

[0178] 4. Take the strains screened in step 3, perform PCR amplification again using the primer pair consisting of primer P25 and primer P26, and sequence them. The strains with correct sequencing are named recombinant strain YPV-018. Compared with the genomic DNA of Corynebacterium glutamicum CGMCC21260, the only difference in the recombinant strain YPV-018 is the deletion of the DNA molecule shown in Sequence 4 of the Sequence Listing.

[0179] Example 5. Fermentation for the production of L-valine

[0180] The test strains are respectively: Corynebacterium glutamicum CGMCC21260, recombinant strain YPV-013, recombinant strain YPV-014, recombinant strain YPV-015, recombinant strain YPV-016, recombinant strain YPV-017, and recombinant strain YPV-018.

[0181] Fermenter: Fermenter of model BLBIO-5GC-4-H (Shanghai Bailun Biotechnology Co., Ltd.).

[0182] The formula of the fermentation medium is shown in Table 3, and the balance is water.

[0183] Table 3 Formula of the fermentation medium

[0184]

[0185]

[0186] The fermentation control process is shown in Table 4. At the initial moment when inoculation is completed, the OD value of the system is 0.3 - 0.5.

[0187] During fermentation: Ammonia water is used to adjust the pH; when there are foams in the fermentation system, an appropriate amount of antifoam (CB-442) is added; the sugar content (residual sugar) of the system is controlled by supplementing 70% glucose aqueous solution.

[0188] Table 4 Fermentation control process

[0189]

[0190] After fermentation is completed, collect the supernatant and detect the L-valine yield in the supernatant by HPLC.

[0191] The results are shown in Table 5. The L-valine yields of the recombinant strains YPV-013 and YPV-018 were significantly higher than that of Corynebacterium glutamicum CGMCC21260. The results indicated that inhibiting the expression of the YH66-RS07020 gene could increase the L-valine yield, while overexpressing the YH66-RS07020 gene decreased the L-valine yield.

[0192] Table 5 Results of L-valine fermentation experiments

[0193] Strains <![CDATA[OD 610 > L-Valine production (g / L) Corynebacterium glutamicum CGMCC21260 98.1 82.4 Recombinant strain YPV-013 98.7 85.9 Recombinant strain YPV-014 97.9 80.9 Recombinant strain YPV-015 97.4 80.6 Recombinant strain YPV-016 97.3 79.7 Recombinant strain YPV-017 97.2 80.8 Recombinant strain YPV-018 99.7 85.3

[0194] The present invention has been described in detail above. For those skilled in the art, without departing from the gist and scope of the present invention and without unnecessary experiments, the present invention can be implemented within a relatively wide range under equivalent parameters, concentrations, and conditions. Although specific embodiments of the present invention are given, it should be understood that the present invention can be further improved. In short, according to the principle of the present invention, this application intends to cover any modifications, uses, or improvements to the present invention, including those that depart from the scope disclosed in this application but are made with conventional techniques known in the art. The application of some basic features can be carried out within the scope of the following appended claims.

Claims

1. A mutant protein, which is obtained by mutating the 84th amino acid residue of the YH66-RS07020 protein from A to V; the YH66-RS07020 protein is the protein shown in Sequence 3 of the Sequence Listing.

2. The coding gene of the mutant protein according to Claim 1.

3. An expression cassette having the coding gene of the mutant protein according to Claim 1.

4. A recombinant vector having the coding gene of the mutant protein according to Claim 1.

5. A recombinant bacterium having the coding gene of the mutant protein according to Claim 1.

6. Use of the mutant protein according to Claim 1, the coding gene according to Claim 2, the expression cassette according to Claim 3, the recombinant vector according to Claim 4 or the recombinant bacterium according to Claim 5 in the preparation of valine.

Images