DNA nanoflowers, their preparation methods, and their applications in the preparation of drugs targeting liver tumor cells.

Abstract

This invention provides a DNA nanoflower, its preparation method, and its application in targeted therapy of liver tumor cells, belonging to the field of biomedical technology. The DNA nanoflower material provided by this invention is prepared by the following method: using a complementary phosphorylated template sequence containing a GPC3 aptamer targeting sequence as a DNA template strand, in a Fenton-like reagent with copper ions (Cu)... 2+ Under the guidance of Cu, rolling circle amplification (RCA) was performed, and glucose oxidase GOx was encapsulated within it to obtain a product containing Cu. 2+ DNA nanoflowers containing glucose oxidase GOx; The above-mentioned Cu 2+ DNA nanoflowers containing glucose oxidase (GOx) were co-incubated with doxorubicin (DOX) to obtain co-loaded DNA nanoflower material Apt-GOxCu@DOX-NFs. The DNA nanoflowers provided by this invention exhibit high biosafety, good structural stability, and nanoscale size, enabling precise targeting of liver cancer cells and promotion of tumor cell apoptosis.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, and in particular relates to a DNA nanoflower, its preparation method, and its use in targeted therapy of liver tumor cells. Background Technology

[0002] Treatment methods for liver cancer mainly include chemotherapy, radiotherapy, and surgery. Chemotherapy involves systemic administration of drugs, which, while killing tumor cells, can also damage normal tissue cells and even cause serious toxic side effects. Radiotherapy is similar. Generally, chemotherapy and radiotherapy can be used as adjuvant therapy for tumor surgery. This treatment approach is highly versatile and is currently one of the most effective cancer treatments.

[0003] Many multifunctional nanomaterials have been used for the early diagnosis and effective treatment of cancer, such as composite nanomaterials, nucleic acid nanostructures, lipid nanomaterials, and polymer nanostructures. DNA nanostructure technology, proposed in the 1980s, addresses the challenge of DNA, the molecule that stores and transmits genetic information in biological systems. DNA nanostructure technology isolates this molecule from its biological context, utilizes its sequence information to assemble nanostructures, and then links them together. DNA can be rapidly synthesized and modified using automated methods, and its structure can be further adjusted and modified using various DNA-acting enzymes. Therefore, DNA structures are the most ideal nanostructure materials.

[0004] Nucleic acid aptamers are a class of single-stranded oligonucleotides selected through "exponential enrichment of ligand system evolution" technology. They can form specific structures, such as stem-loop structures and quadruplex structures, through intramolecular hybridization, and then specifically bind to proteins, small molecule compounds, and tumor cells.

[0005] Glypican-3 (GPC3) is a heparan sulfate proteoglycan belonging to the glycosylphosphatidylinositol (GPI)-anchored cell surface Glypican protein family. Genetic analysis of hepatocellular carcinoma (HCC) shows that most cases are associated with GPC3 upregulation, and positive GPC3 staining predicts poor clinical prognosis in HCC patients. Furthermore, GPC3 is almost not expressed in normal liver tissue, making it an important target for the precise diagnosis and treatment of HCC. However, there are currently no reports of using DNA nanostructures targeting Glypican-3 for targeted therapy of HCC tumor cells. Summary of the Invention

[0006] This invention provides a DNA nanoflower, its preparation method, and its use in targeted therapy for liver cancer. The provided DNA nanoflower has high biosafety, good structural stability, and a nanoscale size, and can precisely target liver cancer tumor cells and promote tumor cell apoptosis.

[0007] To achieve the above objectives, the present invention provides a DNA nanoflower material, which is prepared by the following method:

[0008] Using a complementary phosphorylated template sequence containing the GPC3 aptamer target sequence as the DNA template strand, in a Fenton-like reagent with copper ions Cu 2+ Under the guidance of Cu, rolling circle amplification (RCA) was performed, and glucose oxidase GOx was encapsulated within it to obtain a product containing Cu. 2+ DNA nanoflowers with glucose oxidase GOx;

[0009] The above containing Cu 2+ DNA nanoflowers containing glucose oxidase (GOx) were co-incubated with doxorubicin (DOX) to obtain co-loaded DNA nanoflower material Apt-GOxCu@DOX-NFs.

[0010] In the above scheme, a novel DNA nanoflower material was synthesized using rolling circle amplification (RCA) technology, which utilizes a Fenton-like reagent, copper ions (Cu), to synthesize the nanoflower material. 2+ Rolling circle amplification (RCA) is performed under the guidance of [the medium / organization], and then pyrophosphate ions (PPi) are generated during the RCA process. 4- ) and Mg 2+ Magnesium pyrophosphate precipitate (Mg2PPi) is formed, which further nucleates and grows under the drive of long-chain DNA, eventually forming a three-dimensional flower-like structure; simultaneously, glucose oxidase GOx is encapsulated within it, realizing the combination of glucose oxidase (GOx) and Fenton-like copper ions (Cu). 2+ The Apt-GOxCu@DOX-NFs, co-loaded with the chemotherapy drug doxorubicin (DOX), can specifically recognize GPC3-positive tumor cells, and then enter the cell through endocytosis into lysosomes and escape lysis to release the drug.

[0011] like Figure 1 The multimodal pathway for DNA nanoflowers to enter and kill tumor cells is shown. In the acidic pH environment of lysosomes, DNA nanoflowers begin to cleave, releasing the loaded drug. The glucose oxidase GOx in the nanoflowers oxidizes intracellular glucose to produce gluconic acid and hydrogen peroxide, thereby consuming oxygen and glucose in the tumor microenvironment. This reduces the nutrients needed for tumor cell growth, achieving a starvation therapy effect. The gluconic acid produced in this step further lowers the pH of the environment, promoting drug release. Simultaneously, the Cu in the material... 2+Reduced to Fenton-like reagent Cu by high intracellular concentrations of glutathione (GSH). + Cu + The nanoflowers react with hydrogen peroxide, a byproduct of starvation therapy, to generate reactive oxygen species (ROS) – hydroxyl radicals. The production of ROS has a chemokinetic therapeutic effect on tumor cells. After complete lysis of the nanoflowers, the encapsulated DOX is also released and exerts a chemotherapeutic effect, ultimately achieving a synergistic three-modal treatment of GPC3-positive liver tumors: starvation therapy, chemokinetic therapy, and chemotherapy.

[0012] Preferably, the sequence of the DNA template strand is shown in SEQ ID NO:1.

[0013] Preferably, the DNA template strand includes the complementary sequence of the AP631-1 aptamer and the complementary sequence of the DOX drug delivery system.

[0014] Preferably, the complementary sequence of the aptamer of AP631-1 is shown in SEQ ID NO:2, and the complementary sequence of the DOX drug-loaded sequence is shown in SEQ ID NO:3.

[0015] As a preferred option, a product containing Cu is obtained. 2+ The DNA nanoflowers with glucose oxidase GOx are specifically:

[0016] The DNA template strand and primers were mixed in PBS or aqueous solution at a volume ratio of 1:2 to obtain a mixture;

[0017] The resulting mixture was heated at 95°C for 5 minutes in a final volume of 20 μL of T4 DNA ligase buffer, and then gradually cooled to room temperature over 3 hours using a PCR thermal reactor to complete the annealing process.

[0018] Add T4 DNA ligase to the reaction solution of the annealed DNA template strand and incubate overnight at 16-20°C;

[0019] The reaction solution was heated to 65°C and maintained for 10 minutes to form a closed DNA circular template.

[0020] 3 μL of the obtained closed DNA loop template was mixed with 2 μL of Phi29 DNA polymerase, 5 μL of Phi29 DNA polymerase buffer, 5 μL of dNTPs, and 2.5 μL of glucose oxidase GOx in a buffer solution and reacted at 30 °C for 1 h. The pyrophosphate ions (PPi) in the DNA were then removed. 4- ) and Mg in the reaction system 2+Magnesium pyrophosphate precipitate (Mg2PPi) is formed, which in turn forms DNA nanoflowers; the polymerase buffer includes: 500mM Tris-HCl (pH 7.5, 25°C), 100mM MgCl2, 100mM (NH4)2SO4, and 40mM DTT;

[0021] The product obtained above is combined with Cu 2+ Mix and incubate at 25-30℃ for 12 hours. After polymerization, inactivate the polymerase by reacting at 65℃ for 10 minutes. The resulting product contains Cu. 2+ DNA nanoflowers with glucose oxidase GOx.

[0022] Preferably, the sequence of the primer is shown in SEQ ID NO:4.

[0023] Preferably, the temperature for co-incubation with doxorubicin (DOX) is 16-20℃, the volume ratio of DOX to nanoflowers is 2:1, and the time is 16-24h.

[0024] The present invention also provides the application of the DNA nanoflower material Apt-GOxCu@DOX-NFs according to any of the above technical solutions in the preparation of a drug that specifically recognizes GPC3-positive liver tumor cells.

[0025] The present invention also provides the application of the DNA nanoflower material Apt-GOxCu@DOX-NFs according to any of the above technical solutions in the preparation of drugs for targeted treatment of liver tumors.

[0026] This invention also provides a model for the synergistic treatment of liver tumors using a three-modal approach of starvation therapy, chemokinetic therapy, and chemotherapy. By applying the DNA nanoflower material Apt-GOxCu@DOX-NFs described in any of the above technical solutions to the treatment of liver tumors, it allows the material to precisely bind to and undergo endocytosis with liver tumor cells that highly express GPC3, thereby achieving targeted and precise drug release.

[0027] Compared with the prior art, the advantages and positive effects of the present invention are as follows:

[0028] 1. The DNA nanoflower provided by this invention solves the problem of target site selection and targeting. It selects the GPC3 target protein that is specifically expressed only in liver tumor cells, and introduces a functional nucleic acid molecule - nucleic acid aptamer. Through its target pre-experiment, it is determined that the target tumor cells are achieved by amplifying the nucleic acid aptamer.

[0029] 2. This invention utilizes the principles of DNA nanomedicine synthesis to achieve stable amplification and functionalization of effective sequences, thus solving the problem of low efficiency. Specifically, the pyrophosphate ions (PPi) generated during the RCA process... 4- ) and Mg 2+ Magnesium pyrophosphate precipitate (Mg2PPi) is formed, which further nucleates and grows under the drive of long-chain DNA, eventually forming a three-dimensional flower-like structure. Unlike DNA nanomaterials constructed based on base complementarity, DNA nanoflowers constructed based on RCA mainly rely on the liquid crystallization and close packing of long-chain DNA, without the need for complex design of DNA sequences, thus making them simple to operate and inexpensive.

[0030] 3. This invention also introduces Cu during the synthesis of nanoflowers. 2+ Along with the biomolecule glucose oxidase, divalent metal ions are essential for the formation of three-dimensional petal-like folds in DNA, in addition to the Mg in the buffer solution itself. 2+ Cu added 2+ All of these factors contribute to a more compact and stable nanoflower structure, resolving the issue of unstable drug structures. Furthermore, the added biomolecule glucose oxidase not only consumes glucose to achieve starvation therapy but also cascades Cu... 2+ By achieving the goal of chemokinetic therapy and combining it with the chemotherapy effect of DOX, a multimodal combined therapy model for tumors can be formed, which solves the problem of poor efficacy of single therapy and further enhances the efficiency of tumor cell killing on the basis of targeted therapy.

[0031] 4. The DNA nanoflowers provided by this invention solve the problem of drug damage to normal cells, enabling controlled drug release. Experiments have shown that the drug has high stability in PBS and blood. Upon reaching the tumor microenvironment, the nanoflowers are first internalized by tumor cells into lysosomes. Under acidic conditions, the nanoflowers begin to cleave. pH 5.5 is the optimal pH for DNA nanoflower cleavage, thus completing the cleavage and release of the drug inside the tumor cells and promoting tumor cell apoptosis. Attached Figure Description

[0032] Figure 1 A multimodal pathway for the basic synthesis of DNA nanoflowers for targeted therapy and their entry into tumor cells to exert a killing effect;

[0033] Figure 2 SEM images of the prepared Apt-GCD-NFs illustrate the synthesis and size of the nanoflower structures (scale bar: 5 μm).

[0034] Figure 3 Mapping image of the prepared Apt-GCD-NFs (scale bar: 500nm);

[0035] Figure 4X-ray photoelectron spectroscopy analysis revealed that Apt-GCD-NFs contain C, H, O, N, P, and Cu.

[0036] Figure 5 SEM images of Apt-GCD-NFs reacted in PBS solution containing GSH at pH 5.5 for different times;

[0037] Figure 6 Cu after reacting Apt-GCD-NFs in PBS solutions at different pH values ​​for different time periods 2+ Release amount;

[0038] Figure 7 The amount of DOX released after Apt-GCD-NFs reacted in PBS solutions (containing GSH) at different pH values ​​and at different times.

[0039] Figure 8 The use of 3,3',5,5'-tetramethylbenzidine (TMB) to detect hydroxyl radicals generated at different concentrations of nanoflowers over different time periods demonstrates that the efficiency of the nanoflower reaction is concentration-dependent and that it can generate reactive oxygen species that kill tumor cells.

[0040] Figure 9 To determine the cell viability of normal human hepatocytes (L02) and tumor cells (Huh7) after 24 h of treatment with different concentrations of nanoflowers using the MTT assay, the tumor cell viability was significantly reduced, indicating that the nanoflowers exerted a highly efficient targeted killing effect on liver cancer cells;

[0041] Figure 10 After incubating Huh-7 and L02 cells with Apt-GCD-NFs for 6 hours, the uptake of the drug by the cells was observed by confocal microscopy, which proved the targeting effect of DNA nanoflowers on Huh-7 cells with high GPC3 expression.

[0042] Figure 11 To detect reactive oxygen species (ROS) generated after DNA nanoflowers exert their therapeutic effects, the oxidative stress sensing probe 2',7'-dichlorofluorescein diacetate (DCFH-DA) was used. Cells that generate ROS exhibit green fluorescence.

[0043] Figure 12 After incubating Huh-7 cells with Apt-GCD-NFs, cells in both the control and treatment groups were fluorescently labeled. Calcein-AM staining produced green fluorescence in live cells, while propidium iodide (PI) could not penetrate the cell membrane of live cells, only the membrane of dead cells, producing red fluorescence. Both can be excited at 490 nm, thus allowing simultaneous observation of live and dead cells using a fluorescence microscope, demonstrating that apoptosis of tumor cells occurred in the nanoflower treatment group.

[0044] Figure 13 A subcutaneous tumor model was constructed in BALB / c nude mice. Apt-GCD-NFs were labeled with Cy5 and injected into the tumor-bearing mice via the tail vein. In vivo fluorescence imaging was performed on the mice at different time points to observe the biodistribution of the drug. The drug began to converge at the tumor site 2 hours after injection into the tail vein, which proved the targeting effect of the nanoflower.

[0045] Figure 14 For tumors larger than 50 mm 3 One week after administering the drug via the tail vein, the size of the tumor was observed and photographed. The photos of the tumor size at different times demonstrated the therapeutic effect of the drug on the tumor.

[0046] Figure 15 Images of tumor tissue from tumor-bearing mice 14 days after tail vein injection of PBS and Apt-GCD-NFs;

[0047] Figure 16 HE staining images of the heart, liver, spleen, lungs, and kidneys of tumor-bearing mice. Detailed Implementation

[0048] The technical solutions in the embodiments of the present invention will be clearly and completely described below. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0049] Example 1: Preparation method of DNA nanoflowers with targeting function (Apt-GCD-NFs)

[0050] The preparation method is as follows:

[0051] DNA annealing: A complementary phosphorylated template (100 μM, 5 μL) containing the GPC3 aptamer targeting sequence and the DOX drug-loading sequence (template strand sequence 5'-3' (SEQ ID NO: 1): phosphate-GATATGCATTGCGACTGGAATCGACGTACCGAAATGTACAAGGTGGATACGCGTATCGGGCATATCGTAC) and primers (100 μM, 10 μL) (primer sequence 5'-3' (SEQ ID NO: 4): CCAGTCGCAATGCATATCGTACGATATG) were mixed in PBS or aqueous solution at a ratio of 1:2 to obtain a mixture.

[0052] The template chain sequence includes the complementary sequence of the aptamer of AP631-1 and the complementary sequence of the DOX drug delivery system. The complementary sequence of the aptamer of AP631-1 is shown in SEQ ID NO: 2, specifically: GATACGCGTATCGGGCATATCGTACGATATGC.

[0053] The complementary sequence for the DOX drug delivery is shown in SEQ ID NO: 3, and is specifically as follows:

[0054] ATTGCGACTGGAATCGACGTACCGAAATGTACAAGGTG);

[0055] The mixture obtained above was heated at 95°C for 5 minutes in a final volume of 20 μL of T4 DNA ligase buffer, and then gradually cooled to room temperature over 3 hours to complete the annealing process using a PCR thermal reactor.

[0056] DNA nanoflowers were prepared using the product obtained above and cooled to room temperature. Add T4 DNA ligase (120 U / L, 5 μL) to the reaction solution and incubate overnight at 16-20°C. Heat the reaction solution to 65°C and maintain for 10 minutes to form a closed DNA circular template.

[0057] The closed DNA loop obtained above was mixed with Phi29 DNA polymerase (10 U / L, 2 μL), Phi29 DNA polymerase buffer, dNTPs and glucose oxidase in a reaction buffer solution and reacted at 30°C for 1 h to complete the reaction.

[0058] The above-obtained product and Cu 2+ The mixture was then incubated at 25°C for 12 hours to polymerize. After polymerization, the polymerase was inactivated by reacting at 65°C for 10 minutes. The resulting product contained Cu. 2+ DNA nanoflowers containing glucose oxidase (Apt-GOxCu-NFs). Apt-GOxCu-NFs were collected, washed three times with double-distilled water, and stored at 4°C for later use.

[0059] 20 μL of the above-obtained Cu-containing... 2+DNA nanoflowers containing glucose oxidase were mixed with doxorubicin (DOX) (16mM, 40μL) at a volume ratio of 2:1 on a shaker at 16-20℃ for 16h. The supernatant was collected by centrifugation, and the fluorescence value of DOX at 552nm was measured by fluorescence spectroscopy to quantify the DOX loading efficiency of the DNA nanoflowers. DOX loading efficiency = 100% × (total DOX - unloaded DOX) / total DOX, and loading capacity = (total DOX - unloaded DOX) / total Apt-GCD-NFs. The final DOX loading efficiency of the nanoflowers was 85.25%, and the loading capacity was 2.96 (μg / μg). The precipitate collected after centrifugation was washed three times with double-distilled water to obtain Apt-GCD-NFs, which were stored at 4℃ for later use. Figure 2 The SEM images of the prepared Apt-GCD-NFs show that the nanoflower structure size is 600-700 nm. Figure 3 The mapping image of Apt-GCD-NFs was prepared by... Figure 3 It is known that Apt-GCD-NFs contain O, S, C, Mg and Cu, thus proving that the loading of Gox and Cu is complete. Figure 4 X-ray photoelectron spectroscopy analysis revealed that Apt-GCD-NFs contained C, H, O, N, P, and Cu, further confirming the Cu loading.

[0060] Example 2: Study on the tumor microenvironment-responsive drug release performance of Apt-GCD-NFs

[0061] Apt-GCD-NFs were dispersed in PBS buffer at pH 5.5, and 10 mM GSH was added. The mixture was then incubated at 37°C with a constant shaking rate (100 rpm). At predetermined time points, 10 μL of the mixture was collected for scanning electron microscopy observation. Figure 5 As shown, in the presence of GSH and in a tumor microenvironment at pH 5.5, the DNA nanoflowers began to lyse after 3 hours of co-incubation, and the petal wrinkles of the nanoflowers began to disappear.

[0062] A 0.5 mL suspension of 2 mg / mL Apt-GCD-NFs was placed in a dialysis bag (molecular weight cutoff = 3600). Then, 9.5 mL of PBS buffer at different pH values ​​(7.4, 6.5, and 5.5) was added around the dialysis bag to investigate the effect of pH on Apt-GCD-NFs degradation. At given time intervals, 2 mL of PBS was removed for analysis, and then replaced with the same volume of fresh PBS. The Cu content was determined by ICP-MS. Figure 6 The results showed that Apt-GCD-NFs nanoflowers remained stable in PBS buffer at pH 7.4, and only 10.3% of Cu ions were released from Apt-GCD-NFs after 24 h.

[0063] When DNA nanoflowers are placed in an acidic solution (pH 5.5) containing a certain concentration of GSH, Apt-GCD-NFs are cleaved under acidic conditions. First, glucose oxidase is released, which reacts with glucose to produce hydrogen peroxide and gluconic acid, followed by Cu. 2+ The cascade reaction of ions, GSH makes Cu 2+ Reduced to Cu + The nanoflowers reacted with hydrogen peroxide to generate hydroxyl radicals. This cascade reaction led to further cleavage of the nanoflowers, and DOX was subsequently released from the Apt-GCD-NFs. The amount of DOX released was determined by detecting the fluorescence value at 552 nm using a fluorescence spectrophotometer. Figure 7 As shown, approximately 94.5% of the DOX (doxorubicin) in the nanoflower can be released within 3 hours, demonstrating the advantages of DNA nanoflower in efficient drug loading and release.

[0064] The generation of hydroxyl radicals (˙OH) from the cascade reaction was determined by the increase in the absorbance of TMB at 652 nm. GSH (10 mM) was mixed with different concentrations of Apt-GC-NFs and different concentrations of NFs with C2H3NaO2˙3H2O (100 mM) buffer in 96-well plates, with a total volume of 100 μL. The mixture was incubated at 37°C and shaken in the dark for 30 minutes. Afterward, GSH (10 μL, 10 mM) and glucose (10 μL, 10 mM) were added, and the readings were recorded for 1 h using a microplate reader. The amount of oxidized TMB was used to demonstrate the generation of •OH and the occurrence of the cascade reaction. Figure 8 As shown, with the increase of nanoflower concentration and time, the amount of •OH produced gradually increases, proving the efficient cascade catalytic effect of nanoflowers.

[0065] Example 3: In vitro antitumor effects of Apt-GCD-NFs

[0066] To investigate the in vitro anticancer efficacy and biosafety of Apt-GCD-NFs, the survival rates of normal and tumor cells treated with Apt-GCD-NFs were assessed using the MTT assay. Figure 9 As shown, Apt-GCD-NFs exhibited only mild cytotoxicity against normal human hepatocytes (L02) with increasing concentration. However, at the same incubation time (24 h), when the Apt-GCD-NFs concentration was 8 µg / mL, the survival rate of tumor cells (Huh-7) decreased to below 80%, which is attributed to the enhanced targeting effect of aptamer on tumor cells. The survival rate of tumor cells treated with different concentrations of nanoflowers gradually decreased with increasing concentration, possibly due to glucose consumption (…). )and It can form a cascade reaction ( Apt-GCD-NFs can promote the Fenton reaction induced by Apt-GCD-NFs, generating reactive oxygen species (ROS) and hydroxyl radicals. After incubating normal and tumor cells with Apt-GCD-NFs, the uptake of nanoflowers by cells was investigated using DOX fluorescence. After co-incubating cells and nanoflowers for 6 hours, confocal microscopy imaging was performed on the cells. Figure 10 As shown, only tumor cells exhibited DOX fluorescence uptake, further demonstrating the targeting effect of DNA nanoflowers on Huh-7, which is highly expressed by GPC3.

[0067] To confirm that internalized Apt-GCD-NFs can increase intracellular ROS through the Fenton response, intracellular reactive oxygen species (ROS) levels were investigated using the oxidative stress sensing probe 2',7'-dichlorofluorescein diacetate (DCFH-DA). Apt-GCD-NFs were co-cultured with tumor cells (Huh-7) for 12 hours. After discarding the supernatant, the cells were washed three times with PBS, then stained with 2',7'-dichlorofluorescein diacetate (DCFH-DA) and incubated in the dark for 1 hour. ROS signaling was observed using CLSM. Figure 11 As shown, the fluorescence signal in the Apt-GCD-NFs-treated group was brighter than that in the control group, confirming the generation of ·OH. The results indicate that internalized Apt-GCD-NFs can catalyze the conversion of intracellular glucose, GSH, and H2O2 into hydroxyl radicals, thereby degrading nanoflowers and promoting drug release. This will enable multimodal synergistic therapy to achieve better tumor cell killing effects.

[0068] Furthermore, Huh-7 cells (commonly used liver cancer cells) were treated with Apt-GCD-NFs for 12 hours, and then the distribution of live and dead cells was observed by staining with Calcein-AM and Propidium iodide (PI). Control and treated cells were fluorescently labeled. Calcein-AM emitted green fluorescence (Ex=490nm, Em=515nm), easily penetrating the cell membrane. Once inside the cell, Calcein-AM (which itself does not fluoresce) is cleaved by intracellular esterases to form the membrane-impermeable polar molecule Calcein, thus remaining inside the cell and emitting strong green fluorescence. Propidium iodide (PI) cannot penetrate the cell membrane of live cells; it can only pass through the disordered region of the dead cell membrane to reach the nucleus and embed itself into the cell's DNA double helix, producing red fluorescence (Ex=535nm, Em=617nm). Therefore, PI only stains dead cells. However, both Calcein and PI-DNA can be excited at 490 nm, so live and dead cells can be observed simultaneously using a fluorescence microscope.

[0069] Live cells and dead cells were stained with green and red fluorescent dyes, respectively, as shown below. Figure 12 As shown, cells treated with PBS grew well, while nearly 80% of cells treated with Apt-GCD-NFs died. This was induced by synergistic cancer therapies such as glucose consumption, ·OH generation, and GSH depletion, and was attributed to the combined effects of starvation therapy, CDT, and chemotherapy, demonstrating that apoptosis of tumor cells occurred in the nanoflower treatment group.

[0070] Example 4: In vivo biodistribution and antitumor activity of Apt-GCD-NFs

[0071] First, a subcutaneous tumorigenesis model was established. Each male BALB / c mouse was subcutaneously injected with 3 × 10⁻⁶ mol / L spores into the right abdomen. 6 Tumor cells were suspended in 100 μL of PBS. When the tumor volume reached approximately 50 mm... 3 Approximately 7 days after inoculation, mice were injected with the drug to observe its therapeutic effect on a subcutaneous tumor-bearing mouse model. First, the distribution of Apt-GCD-NFs within the mouse body was investigated. Cy5-labeled Apt-GCD-NFs were injected via the tail vein. After labeling the nanoflowers, they emitted fluorescence in a mouse in vivo imaging system. Fluorescence images were acquired at selected time points (0.5h, 1h, 2h, 4h, 6h, and 12h) after injection. Fluorescence images were acquired using an IVIS in vivo imaging system with an acquisition time of 0.1 seconds, an excitation wavelength of 640 nm, and an emission wavelength of 680 nm. Figure 13 As shown in the figure, according to the color scale on the right, the more concentrated the fluorescence is in the red area, the higher the concentration of the Cy5-labeled nanoflower in the corresponding part of the mouse. This is used to observe the biodistribution of DNA nanoflowers in tumor-bearing mice at different times. It can also be found that the nanoflowers reach the tumor site at 4 hours, exerting the targeted therapeutic effect of Apt-GCD-NFs.

[0072] Mice were randomly divided into two groups, receiving PBS and Apt-GCD-NFs treatment, respectively. Apt-GCD-NFs (2.5 mg / kg) were administered intravenously every three days, followed by tail vein injection for 7 days. Mice were observed for 7 days after the initial treatment, noting tumor size and the mice's vital signs. Photographs of the tumors after dissection and of the final dissected tumor tissue further confirmed the tumor-killing effect of the targeted Apt-GCD-NFs nanoflowers. Figure 14 As shown, the tumor size in the Control group mice did not decrease over time. However, the tumors in the DNA nanoflower treatment group significantly decreased after 8 days. After 14 days of treatment and observation, the tumors were removed by dissection, as shown... Figure 15 As shown, the largest tumor size in the control group in the first row reached 526.5 mm. 3In the Apt-GCD-NFs treatment group, tumors shrank, with the largest tumor size being 62.5 mm. 3 .

[0073] After dissecting tumor-bearing mice, their hearts, livers, spleens, lungs, and kidneys were removed and prepared into paraffin blocks. After sectioning, HE staining was performed to observe the morphology of normal organ cells, such as... Figure 16 As shown, the cells of each mouse organ have normal morphology, demonstrating the good biocompatibility of Apt-GCD-NFs.

Claims

1. A DNA nanoflower material, characterized in that, It is prepared by the following method: Using a complementary phosphorylated template sequence containing the GPC3 nucleic acid aptamer targeting sequence as a DNA template strand, the DNA template strand and primers are mixed in PBS or an aqueous solution to obtain a mixture; In Fenton-like reagents, copper ions Cu 2+ Under the guidance of Cu, a rolling circle amplification reaction was performed, and glucose oxidase GOx was encapsulated within it to obtain a product containing Cu. 2+ DNA nanoflowers Apt-GOxCu-NFs containing glucose oxidase GOx; The Apt-GOxCu-NFs obtained above were co-incubated with doxorubicin DOX to obtain the co-loaded DNA nanoflower material Apt-GOxCu@DOX-NFs; The sequence of the DNA template strand is shown in SEQ ID NO:1, specifically: phosphate-GATATGCATTGCGACTGGAATCGACGTACCGAAATGTACAAGGTGGATACGCGTATCGGGCATATCGTAC. The primer sequence of the DNA template strand is shown in SEQ ID NO: 4, specifically: CCAGTCGCAATGCATATCGTACGATATG; The DNA template strand includes the complementary sequence of the AP631-1 aptamer and the complementary sequence of the DOX drug delivery system; The complementary sequence of the aptamer of AP631-1 is shown in SEQ ID NO:2, specifically: GATACGCGTATCGGGCATATCGTACGATATGC; The complementary sequence of the DOX drug delivery system is shown in SEQ ID NO:3, specifically: ATTGCGACTGGAATCGACGTACCGAAATGTACAAGGTG.

2. The DNA nanoflower material according to claim 1, characterized in that, Obtain Cu 2+ The DNA nanoflowers with glucose oxidase GOx are specifically: The DNA template strand and primers were mixed in PBS or aqueous solution at a volume ratio of 1:2 to obtain a mixture; The resulting mixture was heated at 95°C for 5 minutes in a final volume of 20 μL of T4 DNA ligase buffer, and then gradually cooled to room temperature over 3 hours using a PCR thermal reactor to complete the annealing process. Add T4 DNA ligase to the reaction solution of the annealed DNA template strand and incubate overnight at 16-20°C; The reaction solution was heated to 65°C and maintained for 10 minutes to form a closed DNA circular template. 3 μL of the obtained closed DNA loop template was mixed with 2 μL of Phi29 DNA polymerase, 5 μL of Phi29 DNA polymerase buffer, 5 μL of dNTPs and 2.5 μL of glucose oxidase GOx in a buffer solution and reacted at 30 °C for 1 h to form DNA nanoflowers. The product obtained above is combined with Cu 2+ Mix and incubate at 25-30℃ for 12 hours. After polymerization, inactivate the polymerase by reacting at 65℃ for 10 minutes. The resulting product contains Cu. 2+ DNA nanoflowers with glucose oxidase GOx.

3. The DNA nanoflower material according to claim 1, characterized in that, The temperature for co-incubation with doxorubicin (DOX) was 16-20℃, the volume ratio of DOX to nanoflowers was 2:1, and the incubation time was 16-24 hours.

4. The use of the DNA nanoflower material according to claim 1 or 2 in the preparation of a medicament for targeted treatment of GPC3-positive liver tumors.

Images