Application of rice blast fungus gene trs85 or protein encoded thereby in inhibiting pathogenicity of rice blast fungus

Abstract

This invention relates to the field of genetic engineering, specifically to the application of the rice blast fungus gene trs85 or its encoded protein in inhibiting the pathogenicity of rice blast fungus. Addressing the current lack of effective targets for rice blast fungus, this invention uses a high-throughput knockout system to study the effect of gene trs85 on the pathogenicity of rice blast fungus. It was found that knocking out gene trs85 inhibited autophagy in the mutant, reducing pathogenicity, thus demonstrating that protein trs85 is a potential target for rice blast control. Based on protein modeling of trs85, this invention performs virtual screening to obtain a drug that can inhibit rice blast fungus. This drug has a significant control effect on rice blast fungus, especially at a concentration of 50 μM where the control effect is optimal.

Description

Technical Field

[0001] This invention relates to the field of genetic engineering, specifically to the application of the rice blast fungus gene trs85 or its encoded protein in inhibiting the pathogenicity of rice blast fungus. Background Technology

[0002] Rice, as one of the most important food crops on Earth and a major source of carbohydrates for humans, is a crucial food crop requiring priority protection. Among fungal diseases, rice blast, caused by the rice blast fungus *Magnaporthe oryzae* (syn. *Pyricularia oryzae*), is extremely destructive to rice production. This fungus has a wide host range; different strains can infect at least 50 species of grasses, including major food crops such as rice, wheat, barley, and oats. In severe cases, crop yield losses can reach 100%. Due to the wide host range, strong environmental adaptability, rapid mutation, and ease of developing drug resistance, the control and management of rice blast fungus are extremely challenging.

[0003] Autophagy is a ubiquitous process in eukaryotes, playing a crucial role in normal life activities. Its main function is to participate in the degradation of damaged proteins or organelles, such as damaged mitochondria, peroxisomes, excess ribosomes, endoplasmic reticulum, lipid droplets, intracellular pathogens, and misfolded proteins. However, autophagy is not simply the elimination of substances, but a dynamic cyclical system that provides new building blocks and energy for cellular renewal and homeostasis. Autophagy also occurs in pathogenic fungi, mediating the entry of cytoplasmic substances and organelles into vacuoles for degradation, thereby reclaiming nutrients. Research in recent decades has shown that autophagy homeostasis is essential for the growth and infection processes of plant pathogenic fungi. In rice blast fungus, the knockout of known autophagy-related genes (such as MoATG1–MoATG18) leads to the loss of fungal pathogenicity, and the autophagy process is inhibited or blocked in knockout mutants. Studies have shown that the Golgi apparatus in vesicle transport may be involved in the expansion of the autophagosome membrane. In the yeast Golgi apparatus, Gea1, Gea2, and Sec7, as guanylate exchange factors (GEFs), can activate their corresponding small G proteins Arf2 and Arf1, respectively, and regulate autophagy homeostasis. Furthermore, experimental evidence suggests that the Golgi-related complex COG not only regulates vesicle transport within and from the Golgi apparatus to the Golgi, but also participates in autophagosome formation and is located at the PAS site, regulating the autophagy process. This evidence supports the possibility that vesicle transport and the Golgi apparatus play a crucial role in autophagosome membrane expansion. Vesicle transport has a rigorous and complex molecular mechanism, enabling the transport of cargo from donor to recipient regions via vesicles. The process includes four steps: budding, transport, tethering, and fusion. The TRAPP complex (Transport protein particle complex) has been primarily reported to participate in vesicle transport. In yeast cells, three types of the TRAPP complex are considered to exist: TRAPPI, TRAPPII, and TRAPPIII. The TRAPPIII complex contains an additional non-essential subunit, Trs85, compared to the TRAPPI complex. Studies have shown that TRAPPIII can act as a GEF to activate the small G protein Ypt1, thereby affecting autophagy. Furthermore, there is evidence that TRAPPIII is also involved in vesicle transport from the endoplasmic reticulum to the Golgi apparatus. However, the functions of Ypt1 and the TRAPPIII subunit Trs85 in *Bacillus oryzae* remain unclear and require further analysis.

[0004] Currently, there are still few effective targets for the control of rice blast, the discovery and identification of drug targets for rice fungal diseases are still in the preliminary stage, and there is still little research on screening new compounds based on the pathogenic proteins of rice blast fungus. Summary of the Invention

[0005] To address the shortcomings of existing technologies, this invention provides the application of the rice blast fungus gene trs85 or its encoded protein in inhibiting the pathogenicity of rice blast fungus. The applicant obtained the Δtrs85 mutant by knocking out the rice blast fungus trs85 gene using high-throughput gene knockout techniques. The mutant was found to have defects in colony growth, sporulation, spore and appressorium morphology, and macroautophagy was found to be inhibited, resulting in loss of pathogenicity.

[0006] The technical solution of the present invention is as follows:

[0007] This invention provides the application of the rice blast fungus gene trs85 or the protein encoded by it in inhibiting the pathogenicity of rice blast fungus.

[0008] The present invention also provides the application of the rice blast fungus gene trs85 or its encoded protein in screening drugs to inhibit rice blast, using the expression of the rice blast fungus gene trs85, or the expression and modification of the protein encoded by the rice blast fungus gene trs85, as a target.

[0009] The nucleotide sequence of the coding region of the rice blast fungus gene trs85 is shown in SEQ ID No. 1, and the amino acid sequence of the protein encoded by the rice blast fungus gene trs85 is shown in SEQ ID No. 2. The cDNA of the rice blast fungus gene trs85 and its preceding and following 2000 bp are shown in SEQ ID No. 3.

[0010] The present invention also provides a method for inhibiting the pathogenicity of rice blast fungus by knocking out or silencing the trs85 gene in rice blast fungus; or by causing the protein encoded by the trs85 gene in rice blast fungus to lose its function.

[0011] The nucleotide sequence of the coding region of the rice blast fungus gene trs85 is shown in SEQ ID No. 1, and the amino acid sequence of the protein encoded by the rice blast fungus gene trs85 is shown in SEQ ID No. 2. The cDNA of the rice blast fungus gene trs85 and its preceding and following 2000 bp are shown in SEQ ID No. 3.

[0012] The present invention also provides a drug for inhibiting rice blast, the chemical formula of which is as follows:

[0013]

[0014] The present invention also provides the application of the aforementioned rice blast inhibitor in the control of rice blast fungus.

[0015] The present invention also provides a method for preventing and controlling rice blast fungus, wherein the rice blast inhibitor is sprayed onto plant leaves.

[0016] Preferably, the concentration of the agent inhibiting rice blast is 25–100 μM.

[0017] More preferably, the concentration of the agent inhibiting rice blast is 50 μM.

[0018] The 25 μM concentration of SP-141, an inhibitor of rice blast, also showed significant control effects, and the 50 μM concentration of SP-141 could completely control rice blast.

[0019] Compared with the prior art, the present invention has the following advantages and effects:

[0020] (1) In view of the current situation that there are few effective targets for targeting rice blast fungus, this invention studies the effect of gene trs85 on the pathogenicity of rice blast fungus based on high-throughput knockout system. It was found that after knocking out gene trs85, the cell autophagy of mutants was blocked and the pathogenicity was weakened, proving that protein trs85 is a potential target for the prevention and control of rice blast.

[0021] (2) Based on the protein modeling structure of TRS85, the present invention performs virtual screening and obtains a drug that can inhibit rice blast fungus. The drug has a significant control effect on rice blast fungus, especially at a concentration of 50 μM. Attached Figure Description

[0022] Figure 1 This is a schematic diagram of the evolutionary relationship between Trs85 and its homologous proteins and the knockout strategy of the trs85 gene; where A is the evolutionary relationship diagram between Trs85 and its homologous proteins; B is the schematic diagram of the knockout strategy of the trs85 gene; C is the schematic diagram of the Southern blot results of the Δtrs85 mutant, where lanes 1 and 3 represent Δtrs85 and lane 2 represents KJ201.

[0023] Figure 2 This section presents the colony phenotypes, spore morphology, and pathogenicity of wild-type KJ201, mutant Δtrs85, and complemented strain Δtrs85-C. A shows the phenotypes of each colony; B shows the statistical results of each colony diameter; C shows the spore quantity; D shows the conidial morphology (W and L represent width and length, respectively); E shows the appressorium morphology; F shows the statistical results of appressorium diameter for the tested strains; **** represents p < 0.0001.

[0024] Figure 3 This is the detection of autophagic flow in Δtrs85.

[0025] Figure 4This section describes the identification of an α-helix structure in TRS85. A shows sequence alignment diagrams from different species; B shows the construction process of the 3E three-point mutant strain; C shows the colony phenotypes of the truncated knockout mutant, point mutation, and Δtrs85 mutant; D shows the statistical results of colony diameters of the truncated knockout mutant, point mutation, and Δtrs85 mutant; and E shows the pathogenicity comparison test.

[0026] Figure 5 This is a protein model conformation diagram.

[0027] Figure 6 The results are for the root mean square deviation (RMSD) and root mean square fluctuation (RMSF) of the TRS85-SP-141 complex.

[0028] Figure 7 The compound screening was based on the TRS85 protein model; where A represents the chemical formulas of 10 compounds and B represents the antibacterial effects of 10 compounds.

[0029] Figure 8 This is a force diagram of the interaction between SP-141 and TRS85.

[0030] Figure 9 The graphs show the effects of compound SP-141 on rice blast control. A represents the chemical formula of compound SP-141; B represents the effects of 10, 25, and 50 μM concentrations of compound SP-141 on barley blast control; C represents the effects of 25, 50, and 100 μM concentrations of compound SP-141 on rice blast control; D represents the quantitative statistical graph of the effects of 25, 50, and 100 μM concentrations of compound SP-141 on rice blast control, with **** representing p < 0.0001; E represents the effects of applying 50 μM SP-141 at different time points on rice blast control; F represents the quantitative statistical graph of applying 50 μM SP-141 at different time points on rice blast control, with * representing p < 0.05 and **** representing p < 0.0001. Detailed Implementation

[0031] The technical solution of the present invention will be further described in detail below through specific embodiments.

[0032] In this invention, unless otherwise specified, all raw materials and equipment used are commercially available or commonly used in the field. The methods described in the following embodiments are conventional methods in the field, unless otherwise specified.

[0033] Example 1: Obtaining the Δtrs85 mutant

[0034] The gene knockout is preferably achieved through the following steps:

[0035] (1) The PKO3A vector plasmid was double-digested with restriction endonucleases (Thermo FastDigest, USA) XbaI and HindIII, and the linearized vector product was obtained after recovery.

[0036] (2) For M. oryzae (Trs85, MGG_15852), Gaeumannomyces tritici (GtTrs85, XP_009219028.1), Neurospora crassa (NcTrs85, XP_962212.2), Aspergillus nidulans(AnTrs85, thaliana (AtTrs85, NP_197132.2) and Homo The sapiens (HsTrs85, NP_055754.2) sequences were analyzed. A phylogenetic tree was constructed using MEGA 7.0.26. Figure 1 The neighbor-joining method was used for tree construction. The 1000-fold repeat value was labeled on the branches. The trs85 gene sequence number in *Blastoma oryzae* is MGG_15852, its CDS region sequence is shown in SEQ ID No. 1, and the amino acid sequence of the encoded protein is shown in SEQ ID No. 2. Based on its cDNA and the preceding and following 2000 bp sequences (SEQ ID No. 3), upstream and downstream primers were designed using Primer Premier 6 software. *Blastoma oryzae* DNA was used as a template to amplify the *Blastoma oryzae* gene trs85 using trs85u1, trs85u2, trs85d1, and trs85d2. The upstream and downstream primer sequences are shown in Table 1.

[0037] Table 1

[0038] trs85u1 AGGCTAACTGACACTCTAGATCTGGGACAACAAACTACCCGG trs85u2 TGTTGACCTCCACTAATGGGTGAAATGTAAGCTGGG trs85d1 GGAATAGAGTAGATGGAACAGACGTGATGCCGATAG trs85d2 CGACGGCCAGTGCCAAGCTTCATTTCCTTCTGCGTGTACAC NP-trs85-F ATTCACAATCACTAGTGAATTCAGTGAGAAATCTTTAATGCC NP-trs85-R CGCCCTTGCTCACCATCCCGGGACTTGCATGGTCGGTGCTATC

[0039] (3) Homologous recombination is a commonly used genetic engineering method used to connect a target gene to a vector to construct a recombinant plasmid. This process is based on complementary pairing between homologous DNA fragments and the catalytic action of DNA recombinases. Vector construction using homologous recombination methods includes... Figure 1 As shown in B, 2×Basic Assemble Mix (Quanshijin, China) was used to connect the fragments to the carrier;

[0040] (4) Agrobacterium-mediated transformation (ATMT) is a commonly used fungal gene transformation technology widely applied in agricultural and plant science research. ATMT utilizes the natural transformation mechanism of the soil plant pathogen Agrobacterium tumefaciens to introduce the target gene into fungal cells, thereby achieving gene transformation. In this study, a recombinant vector was introduced into rice blast fungus KJ201 via ATMT, and the trs85 gene was knocked out using homologous recombination to obtain the mutant Δtrs85. Southern blot analysis was used to detect and verify the knockout mutant Δtrs85. Figure 1 C);

[0041] (5) The trs85 gene with its own promoter was amplified using primers NP-trs85-F and NP-trs85-R (sequences shown in Table 1). The amplified fragment was then ligated to the pKD5-GFP vector (construction method see CN102559678A) via homologous recombination to obtain a recombinant plasmid. The recombinant plasmid was then transformed into Δtrs85 using ATMT to obtain the complement strain Δtrs85-C.

[0042] Example 2: Determination of colony phenotype, spore morphology and pathogenicity of Δtrs85

[0043] Wild-type rice blast fungus strain KJ201 and mutant Δtrs85, preserved in our laboratory, were inoculated onto CM medium and cultured for 6–8 days. Mycelial cakes were then collected from the edge of each colony using a 6 mm diameter punch and placed in the center of a fresh test medium. Each treatment was repeated at least three times. The plates were incubated at 25°C until the colonies exceeded two-thirds of the plate's size. The colony diameter was measured and recorded using the cross-hatching method, and then photographed. Wild-type rice blast fungus strains and mutants were inoculated into CM medium and cultured for 6–8 days. Mycelial cakes were then collected from the edges of colonies using a 6 mm diameter punch and placed in the center of the CM medium. The culture was maintained at 25°C for 10 days. 5 mL of sterile water was added to the plate, and rice blast fungus mycelia were gently scraped into the sterile water using a sterile spreader. The water was then filtered through three layers of filter paper into 50 mL centrifuge tubes. After centrifugation at 7000 rpm for 20 min, the supernatant was discarded, and the spores in the tubes were completely collected with 30 mL of sterile water and mixed thoroughly. Finally, the number of spores was observed using a hemocytometer, and the spore concentration was calculated. Each sample was repeated 6 times, and the results were recorded.

[0044] Rice seedlings were grown in pots until they reached the three-leaf-one-heart stage. Five pots of rice were prepared for each treatment, with 20 rice seedlings in each pot. The spores of the test strains were washed off, centrifuged at 7000 rpm for 20 min, rinsed three times with sterile water, and the spores were collected. An appropriate amount of sterile water was added to dilute the spore suspension to 1×10⁻⁶. 5 cfu / mL; dilute the spore suspension with 0.25% gelatin solution to 5×10⁻⁶. 4 cfu / mL; use a sprayer to evenly spray rice blast fungus spores onto the surface of rice leaves, spraying 2 mL per pot of rice; first treat in the dark at 25℃ for 24 h with humidity, then transfer to a 16h / 8h light-dark alternating incubator and incubate at 25℃ for 4-6 days, observe the disease incidence of rice, record the data, and take photos.

[0045] The basic phenotype of Δtrs85 was analyzed. In terms of colony phenotype, compared to wild-type KJ201 and the complement strain, the Δtrs85 mutant had smaller colonies and fewer spores. Figure 2 (A~C). Furthermore, the length and width of the conidia of Δtrs85 are shorter than those of the wild type and the reinjected strain; the length-to-width ratio also indicates that the conidia of the Δtrs85 mutant are more elongated. Figure 2 D). Furthermore, the appressorium size of Δtrs85 was significantly smaller than that of the wild-type and the complement strain Δtrs85-C. Figure 2 E and F) may indicate abnormalities in appressorium development. In summary, this suggests that the protein TRS85 is not only essential for the mycelial growth and sporulation of rice blast fungus, but also plays a crucial role in the development and morphogenesis of conidia and appressorium.

[0046] Example 3: Detection of Δtrs85 autophagic flow

[0047] Scrape the mycelium from the CM solid plate and place it in a 1.5 mL sterile centrifuge tube. Add steel balls and 1 mL of liquid CM medium to the tube, and shake the mycelium with a shaker. Transfer 1 mL of mycelium to an appropriate amount of liquid CM medium and incubate on a shaker at 28℃ and 138 rpm for 2–3 days. Filter the mycelium from the liquid medium onto three layers of filter paper and rinse off excess medium with sterile water. Press dry with absorbent paper. Store at -80℃ or grind the dried mycelium directly in liquid nitrogen until it is fully ground into powder. Weigh 0.25 g of protein powder into a centrifuge tube containing 500 μL of protein extract and place on ice for 10 minutes. To ensure complete protein lysis and release, centrifuge at 12,000 rpm for 15 min at 4°C using a low-temperature centrifuge. The supernatant obtained after centrifugation is the total mycelial protein, which can be used directly or stored at -80°C. Wild-type KJ201 and Δtrs85 expressing GFP-Atg8 were cultured in liquid CM for 2 days, then replaced with fresh liquid CM and cultured overnight. Subsequently, the mycelium was transferred to liquid CM-N (10 g D-type glucose, 1.52 g potassium dihydrogen phosphate, 0.52 g potassium chloride, 0.52 g magnesium sulfate heptahydrate, 1 mL vitamin solution, 1 mL trace elements) for starvation induction, and cultured in a shaker for 0 h, 3 h, 6 h, and 12 h. Western blotting was performed using a GFP antibody.

[0048] Western blot results showed that the autophagic flux of Δtrs85 was slower than that of wild-type ( Figure 3 In summary, the absence of TRS85 indicates that the autophagy process of rice blast fungus is severely affected.

[0049] Example 4: Identification of an α-helical structure in TRS85

[0050] Sequence alignment was performed on sequences from three representative species (Saccharomyces cerevisiae, Saccharomyces pombe, and Homo sapiens). It was found that amino acid sequences 461-472aa in the *Trus85* strain of *Oryza sativa* (amino acid sequence shown in SEQ ID No. 2) tend to form an amphiphilic α-helix structure. Figure 4A). To test whether this hypothetical amphiphilic α-helix plays a key biological function, an attempt was made to knock out this region in the wild type; additionally, point mutations were constructed to reverse the charge distribution on the hydrophilic surface of the helical structure. In wild-type KJ201, the knockout region was 445-500 aa, and this mutant was labeled Δtrs85-KO1. To further support the evidence, Trs85 in KJ201 was directionally knocked out, with the knockout region being 462-477 aa, and this mutant was labeled Δtrs85-KO2. Furthermore, three point mutant strains R464E, K470E, and R470E were constructed, labeled 3E, where R464E indicates that the 464th amino acid was changed from arginine to glutamic acid. A schematic diagram of the construction is shown below. Figure 4 As shown in B.

[0051] The experimental results showed that these truncated knockout mutants and point mutations did not differ significantly in colony phenotype from the Δtrs85 (full-length gene knockout) mutant, but were significantly different from the wild-type and complement strains. Figure 4 C and D). Pathogenicity tests on barley also showed that both truncated gene knockout mutants and point mutants lost their pathogenicity. Figure 4 E). In summary, these results confirm that the amphiphilic α-helical structure within *Trus85*, the blast fungus, is essential for its pathogenicity.

[0052] Example 5: Prediction using the TRS85 protein model

[0053] Protein structures were predicted using I-TASSER (https: / / zhanggroup.org / / I-TASSER / ). Molecular dynamics (MD) simulations were used to optimize the protein model to minimum energy and a stable state. This was achieved using the Desmond 2020 module (…). LLC, New York, NY, conducted molecular geometry (MD) studies on protein-compound complexes, obtaining relatively reliable protein model conformations after 200 ns of testing. Figure 5 The predicted TRS85 and optimized TRS85-MD models were evaluated in SAVES v6.0 (https: / / servicesn.mbi.ucla.edu / SAVES / ). The TRS85-MD model was evaluated using PROCHECK, generating a Ramachandran plot. The Ramachandran plot showed that the probabilities of residues falling into the core regions of the templates TRS85 and TRS85-MD were 56.8% and 76.8%, respectively, and the probabilities of falling into reasonable regions were 99.3% and 99.4%, respectively, indicating good model quality. Figure 6As shown, RMSD reflects the stability of protein structure; the higher the RMSD value, the less stable the protein. The average RMSD value of the Trs85 protein... It reaches equilibrium at approximately 30 ns. RMSD reflects the conformational changes of each residue in the protein model. It can be seen that a few residues in the TRS85 protein model exhibit large conformational fluctuations, which may be a significant reason for the relatively high RMSD value of the protein. Figure 6 ).

[0054] Example 6: Compound screening based on the TRS85 protein model

[0055] A database of 3961 compounds was used, provided by Apexbio and MCE. 1971, 1170, and 820 compounds were selected for testing from FDA-approved drug libraries, natural product libraries, and autophagy compound libraries, respectively. All compounds were analyzed using the LigPrep module (…). The protonation and energy minimization processes were performed at LLC, New York, NY. The protonation state was predicted at pH 7.0 ± 2.0, and the force field was OPLS3e. All calculation parameters followed default settings throughout the process.

[0056] I-TASSER protein structure prediction: The TRS85 protein structure was predicted using the online server I-TASSER (https: / / zhanggroup.org / / I-TASSER / ). The protein structure was then analyzed using the Protein Preparation Wizard module on the Maestro 11.9 platform. Preprocessing was performed at LLC (New York, NY) with default parameters. The process included water and ion removal, protonation, addition of missing atoms, completion of missing groups, protein energy minimization, and energy optimization. Maestro software Virtual screening was performed at LLC, New York, NY. The pretreated TRS85 receptor protein was imported into the Glide module for molecular docking, and a suitably sized box (ensuring complete receptor encapsulation) was created centered on the receptor for subsequent molecular docking. The dataset was first screened using the SP docking method (SP is faster and suitable for screening large batches of compounds), and then the Top compounds from the previous step were re-docked using the XP docking method.

[0057] Through virtual screening, the top 100 compounds scored by the software were obtained, and 10 compounds were ultimately selected. Figure 7 A). Subsequently, a barley pathogenicity test was used to test whether these compounds had a direct antibacterial effect. Figure 7B). The experimental results showed that compound SP-141 performed best in this experiment. Therefore, we re-connected SP-141 to the theoretical active site of TRS85 via molecular docking for repeated verification. The molecular docking results showed that there is a strong interaction between SP-141 and TRS85. Figure 8 The chemical formula of compound SP-141 is as follows: Figure 9 As shown in Figure A.

[0058] Example 7: Testing of SP-141 effective concentration

[0059] In vitro barley spore suspension test: Wild-type rice blast fungus strain was inoculated onto CM medium and cultured for 10 days to obtain spores; barley was planted until one week old, and healthy barley leaves were harvested; a compound was prepared and mixed with the spore suspension (final concentration after dilution was 1×10⁻⁶). 5 Dilute the compound to the target final concentration (cfu / mL), with the control group being DMSO of the same concentration; use a pipette to take 20 μL of spore suspension and drop it onto barley leaves, 3 drops per leaf, treat with moisture and light, and place in a light-incubated environment at 25℃ for 3 days, observe the disease condition of the leaves, and take photos for recording.

[0060] Rice spraying experiment: Rice plants were grown in pots and cultivated to the three-leaf stage. Five pots of rice were prepared for each treatment, with 20 rice seedlings in each pot. Spores of the test strains were washed off, centrifuged at 7000 rpm for 20 min, rinsed three times with sterile water, and the spores were collected. An appropriate amount of sterile water was added to dilute the spore suspension to 1×10⁻⁶. 5 cfu / mL; dilute the spore suspension with 0.25% gelatin solution to 5×10⁻⁶. 4 cfu / mL; use a sprayer to evenly spray rice blast fungus spores onto the surface of rice leaves, spraying 2 mL per pot of rice; first treat in the dark at 25℃ for 24 h with humidity, then transfer to a 16h / 8h light-dark alternating incubator and incubate at 25℃ for 4-6 days, observe the disease incidence of rice, record the data, and take photos.

[0061] To determine the effective concentration of this compound against rice blast fungus, we conducted a barley pathogenicity assay using different concentrations of the drug. The results showed that SP-141 at a concentration of 50 μM significantly inhibited rice blast fungus infection. Figure 9 B). To test the control efficacy of different concentrations of SP-141 against rice blast, we conducted a rice spraying experiment. The results showed that 50 μM SP-141 could completely control rice blast, and even 25 μM SP-141 had significant control efficacy. Figure 9C and D). To explore the optimal application time of SP-141, we conducted experiments with four different programs: (1) -72h: SP-141 (50 μM) was applied 72h before spore inoculation; (2) -24h: SP-141 (50 μM) was applied 24h before spore inoculation; (3) 0h: spores and SP-141 (50 μM) were applied simultaneously; (4) +24h: SP-141 (50 μM) was applied 24h after spore suspension inoculation. The experiments showed that, except for the +24h treatment group which showed symptoms of rice blast, no rice blast occurred under the other programs. Figure 9 (E and F). Meanwhile, in pot trials, SP-141 did not show any significant negative effects on rice, suggesting it may be safe for rice. In conclusion, SP-141 can effectively prevent rice blast in rice pot trials.

[0062] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the present invention in any way. Other variations and modifications are possible without departing from the technical solutions described in the claims.

Claims

1. A Magnaporthe oryzae gene or an encoded protein thereof for use in inhibiting pathogenicity of Magnaporthe oryzae, wherein, in use, the Magnaporthe oryzae gene is knocked out or silenced; or the function of the encoded protein in Magnaporthe oryzae is deleted; the nucleotide sequence of the coding region of the Magnaporthe oryzae gene is shown as SEQ ID No. 1, and the amino acid sequence of the encoded protein of the Magnaporthe oryzae gene is shown as SEQ ID No.

2. trs85 trs85 trs85 trs85 trs85 ​​​​​ 2. Rice blast fungus gene trs85 The application of its encoded proteins in screening drugs to inhibit rice blast, based on the rice blast fungus gene. trs85 The expression of, or the gene of rice blast fungus. trs85 The expression and modification of encoded proteins are used as targets; when applying this method, genes from *Magnapordia oryzae* are targeted. trs85 Knockout or silence; or, make the gene in rice blast fungus disappear. trs85 The encoded protein is functionally lost; the rice blast fungus gene trs85 The nucleotide sequence of the coding region is shown in SEQ ID No. 1, representing the rice blast fungus gene. trs85 The amino acid sequence of the encoded protein is shown in SEQ ID No.

2.

3. A method for inhibiting the pathogenicity of rice blast fungus, characterized in that, Genes from rice blast fungus trs85 Knockout or silence; or, make the gene in rice blast fungus disappear. trs85 The encoded protein is functionally lost; the rice blast fungus gene trs85 The nucleotide sequence of the coding region is shown in SEQ ID No. 1, representing the rice blast fungus gene. trs85 The amino acid sequence of the encoded protein is shown in SEQ ID No.

2.

4. The application of a blast inhibitor in the control of rice blast fungus, wherein the chemical formula of the blast inhibitor is as follows: Formula I.

5. A method for controlling rice blast fungus, characterized in that, The agent for inhibiting rice blast is sprayed onto the plant leaves. The chemical formula of the agent for inhibiting rice blast is as follows: Formula I.

6. The method for controlling rice blast fungus as described in claim 5, characterized in that, The concentration of the drug used to inhibit rice blast is 25-100 μM.

Images