D-amino acid oxidase mutant, encoding gene, vector, engineered bacteria and application thereof
By mutating D-amino acid oxidase at specific sites, a highly efficient D-amino acid oxidase mutant and engineered bacteria were constructed, solving the problems of insufficient enzyme activity and stability, and realizing the efficient conversion of L-glufosinate precursor, which is suitable for industrial production.
Patent Information
- Application Number
- CN202310034199.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-01-10
- Publication Date
- 2026-05-15
- Estimated Expiration
- 2043-01-10
AI Technical Summary
The existing D-amino acid oxidases have low enzyme activity and poor enzyme thermostability, resulting in low conversion efficiency of D-glufosinate, which limits the preparation efficiency and atom economy of L-glufosinate.
By performing single-point or multi-point mutations on specific amino acid sites of the D-amino acid oxidase in Rasamsonia emersonii, highly efficient D-amino acid oxidase mutants were obtained, and corresponding recombinant expression vectors and genetically engineered bacteria were constructed for the catalytic preparation of the L-glufosinate precursor 2-carbonyl-4-[hydroxy(methyl)phosphono]butyric acid.
It significantly improved the enzyme activity and thermal stability of D-amino acid oxidase, enhanced the conversion rate of L-glufosinate precursor, made it suitable for industrial production, and reduced production costs and environmental impact.
Smart Images

Figure CN117187204B_ABST
Abstract
Description
(I) Technical Field
[0001] This invention relates to a D-amino acid oxidase (DAAO) mutant, its encoding gene, a vector containing the encoding gene, a genetically engineered bacterium, and its application in the microbial catalytic preparation of L-glufosinate. (II) Background Technology
[0002] Phosphinothricin (PPT), chemically known as 2-amino-4-[hydroxy(methyl)phosphono]butyric acid, is the world's second most widely used herbicide for genetically modified crops. It has excellent herbicidal performance and relatively few phytotoxic side effects, and has huge market potential in the future.
[0003] Glufosinate has two optical isomers: L-glufosinate and D-glufosinate; however, only the L-form possesses herbicidal activity. Commercially available glufosinate is generally a racemic mixture. If glufosinate products could be used in the pure L-configuration optical isomer, the amount of glufosinate used could be significantly reduced. This would be of great importance for improving atom economy, reducing usage costs, and alleviating environmental pressure.
[0004] Currently, the most widely used method for removing D-glufosinate is to use D,L-glufosinate as a raw material, catalyzing D-glufosinate with D-amino acid oxidase to obtain the L-glufosinate precursor 2-carbonyl-4-[hydroxy(methyl)phosphono]butyric acid, which is then catalyzed by amino acid dehydrogenase or transaminase to obtain L-glufosinate. Due to the high selectivity of D-amino acid oxidase, this method not only effectively removes D-glufosinate, but its key intermediate 2-carbonyl-4-[hydroxy(methyl)phosphono]butyric acid can also be further converted to L-glufosinate, effectively improving atom utilization. Therefore, screening for high-yield 2-carbonyl-4-[hydroxy(methyl)phosphono]butyric acid mutants is particularly important. (III) Summary of the Invention
[0005] The purpose of this invention is to overcome the shortcomings of existing technologies, such as low enzyme activity and poor enzyme thermal stability of DAAO, and to provide a D-AAO mutant with significantly improved catalytic performance, the encoding gene, a vector containing the encoding gene, genetically engineered bacteria, and its application in the microbial catalytic preparation of L-PPT.
[0006] The technical solution adopted in this invention is:
[0007] A D-amino acid oxidase mutant was obtained by single-point mutation or multi-point combined mutation at positions 53, 57 and 94 of the amino acid sequence shown in SEQ ID NO.1.
[0008] SEQ ID NO.1 is the amino acid sequence of Rasamsonia emersonii labeled as D-amino acid oxidase (DAAO), whose encoding gene nucleotide sequence is shown in SEQ ID NO.6.
[0009] Preferably, the amino acid sequence of the mutant is shown in one of SEQ ID NO.2 to 5.
[0010] SEQ ID NO.2 is the amino acid sequence of DAAO mutant I (N53V).
[0011] SEQ ID NO.3 is the amino acid sequence of DAAO mutant II (N53V / V57Q).
[0012] SEQ ID NO.4 is the amino acid sequence of DAAO mutant III (N53V / V57Q / V94R).
[0013] SEQ ID NO.5 is the amino acid sequence of DAAO mutant IV (V94R).
[0014] The present invention also relates to the gene encoding the DAAO mutant and the recombinant vector.
[0015] The recombinant expression vector is constructed by linking the nucleic acid encoding the DAAO mutant gene of the present invention to various suitable vectors using conventional methods in the art. The vector can be any conventional vector in the art, such as commercially available plasmids, granules, bacteriophages, or viral vectors, as long as the recombinant expression vector can replicate normally in the corresponding expression host and express the DAAO. The preferred vector is a plasmid, more preferably plasmid pET28a.
[0016] The present invention also relates to genetically engineered bacteria containing a gene encoding the DAAO mutant described above.
[0017] Recombinant expression transformants can be prepared by transforming a pre-constructed recombinant expression vector into host cells. The host cells can be any conventional host cell in the art, as long as the recombinant expression vector can stably replicate spontaneously and effectively express the target protein after induction with an inducer. This invention preferentially uses *Escherichia coli* as the host cell, and more preferably *E. coli* BL21(DE3) for efficient expression of the DAAO mutant described in this invention.
[0018] This invention also relates to the application of the DAAO mutant in the microbial catalytic preparation of L-PPT. Specifically, the mutant is used for the biocatalytic preparation of L-glufosinate precursor 2-carbonyl-4-[hydroxy(methyl)phosphono]butyric acid (PPO) from racemic PPT.
[0019] The reaction formulas involved are as follows:
[0020]
[0021] The beneficial effects of this invention are mainly reflected in the following aspects: This invention provides a DAAO mutant with significantly improved enzyme activity and enzyme thermostability, which can be used for microbial catalysis to prepare L-PPT, which is conducive to industrial production and has good application prospects. (iv) Description of the attached drawings
[0022] Figure 1 This is a comparison of the relative enzyme activities between the mutant and the WT.
[0023] Figure 2 Comparison of PPO conversion rates during the reaction of mutant III and WT. (V) Detailed Implementation
[0024] The present invention will be further described in detail below with reference to specific embodiments, but the present invention is not limited to the following embodiments:
[0025] The plasmid extraction kit and DNA purification and recovery kit used in the examples were purchased from Hangzhou Qingke Zixi Biotechnology Co., Ltd.; the one-step cloning kit was purchased from Novizan Biotechnology Co., Ltd.; E. coli BL21(DE3), plasmid PCDF-Duet, and whole gene synthesis were performed by Sangon Biotech (Shanghai) Co., Ltd.; DNA labeling, low molecular weight standard protein, and protein precast gel were purchased from Beijing GenStar Co., Ltd.; the ClonExpress II OneStep Cloning Kit was purchased from Nanjing Novizan Biotechnology Co., Ltd.; pfu DNA polymerase and DpnI endonuclease were purchased from Thermo Fisher Scientific (China) Co., Ltd.; primer synthesis and sequence sequencing were performed by Hangzhou Qingke Zixi Biotechnology Co., Ltd. Refer to the product instructions for the usage of the above reagents.
[0026] The reagents used in the downstream catalytic process, D,L-glufosinate, were purchased from Sigma-Aldrich; 2,4-dinitrophenylhydrazine (DNPH) was purchased from Aladdin Reagents (Shanghai, China); and commercially available micrococcal catalase was purchased from Sigma-Aldrich (Shanghai, China). Other commonly used reagents were purchased from Sinopharm Chemical Reagent Co., Ltd.
[0027] The following examples demonstrate the detection and analysis of the products from the reaction using high-performance liquid chromatography (HPLC).
[0028] The HPLC analytical method is as follows: chromatographic column Column temperature: 30℃; Flow rate: 1 mL / min; Detection wavelength: 232 nm; Mobile phase: 50 mM (NH2)HPO4, with 1% of 10% tetrabutylammonium bromide aqueous solution added, pH adjusted to 3.8 with phosphoric acid, and 12% acetonitrile added.
[0029] Example 1: Preparation of genetically engineered bacteria
[0030] The wild-type D-amino acid oxidase (wtDAAO) from Rasamsonia emersonii, with the amino acid sequence shown in SEQ ID NO.1 and the nucleotide sequence shown in SEQ ID NO.6, was synthesized and inserted into the expression plasmid PCDF-Duet to obtain PCDF-Duet-DAAO. After sequencing verification, PCDF-Duet-DAAO was transformed into the expression host E. coli BL21(DE3) for subsequent recombinase expression.
[0031] LB liquid culture medium composition: 10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, dissolved in water and brought to a final volume, sterilized at 121℃ for 20 min, ready for use.
[0032] After activation by streak plating, the engineered bacteria with confirmed sequencing results were inoculated into 10 ml of LB liquid medium containing 50 μg / ml streptomycin sulfate. The culture was incubated at 37°C with shaking for 10–12 h. Then, a 2% inoculum was transferred to 100 ml of fresh LB liquid medium containing 50 μg / ml kanamycin. The medium was incubated at 37°C with shaking until the OD600 reached approximately 0.8. The temperature was then lowered to 28°C, and IPTG was added to a final concentration of 0.5 mM. Induction culture was continued for 16 h. After incubation, the culture was centrifuged at 8000 rpm for 10 min, the supernatant was discarded, and the bacterial cells were collected and stored at -20°C for later use. The collected bacterial cells were washed twice with 50 mM pH 8.0 phosphate buffer, then resuspended in 50 mL pH 8.0 phosphate buffer, homogenized, and the lysate was centrifuged to remove the precipitate, yielding a crude enzyme solution containing recombinant wtDAAO enzyme.
[0033] Example 2: Construction of D-amino acid oxidase mutants (positions 53, 57, and 94)
[0034] Based on the wild-type DAAO sequence described in Example 1, positions 53, 57, and 94 were mutated. Primer sequences for PCR were designed for the mutant D-amino acid oxidase sequence, targeting positions 53, 57, and 94, and are shown in Table 1 according to the mutation sequence at the mutation sites.
[0035] Table 1: Primer sequences
[0036] Serial Number Primer name Primer sequence 1 53V F AGGTGCAGTATATCTGCCGGTTGGT 2 53V R CGGCAGATATACTGCACCTGCCCACGGA 3 57Q F TATCTGCCGCAAGGTGCGGAAAATAGCC 4 57Q R TTCCGCACCTTGCGGCAGATAATTTGCAC 5 94R F GATACCGTTAGATATAATCGTACCAAAG 6 94R R ACGATTATATCTAACGGTATCCTGAAAATG
[0037] When performing the superposition of positions 53 and 57, because these two positions are close to each other, the mutation at position 57 is superimposed on position 53. The primer design for position 57 is shown in Table 2.
[0038] Table 2: Primer sequences
[0039] Serial Number Primer name Primer sequence 1 57Q F TATCTGCCGCAAGGTGCGGAAAATAGCC 2 57Q R TTCCGCACCTTCCGGCAGATATACTGCAC
[0040] The PCR (25 μL) amplification system is as follows:
[0041] 12.5 μL of 2×PCR buffer, 0.5 μL each of forward and reverse primers, 0.5 μL of template plasmid, 0.5 μL of dNTPs, 0.5 μL of high-fidelity enzyme, and ddH2O to bring the total to 25 μL.
[0042] The PCR amplification procedure is as follows:
[0043] (1) Pre-denaturation at 95℃ for 5 min, (2) Denaturation at 95℃ for 30 seconds, (3) Annealing at 60℃ for 30 seconds, (4) Extension at 72℃ for 5 min, 30 cycles, (5) Extension at 72℃ for 10 min, (6) Storage at 4℃.
[0044] After PCR, 5 μL of the amplified product was analyzed by nucleic acid gel electrophoresis. 0.5 μL of Dpn I restriction enzyme was added to the PCR product with a clear target band, and the sample was digested at 37°C for 1 hour. After the reaction, the sample was transformed into BL21 competent cells, plated on LB medium containing 50 μg / mL kanamycin, and incubated overnight at 37°C. Transformants containing mutants were harvested, and bacterial cells were obtained according to the method in Example 1.
[0045] Example 3: Comparison of enzyme activities of D-amino acid oxidase mutants
[0046] Enzyme activity was measured in the positive clones IV (V94R), II (N53V / V57Q), and III (N53V / V57Q / V94R) obtained in Example 2. The 1.4 ml reaction system included: 50 mM racemic glufosinate-ammonium salt, 50 mM pH 8.0 phosphate buffer, 8000 U / L catalase, 30 g / L D-amino acid oxidase or its mutant frozen stem cells. After 4 hours of reaction, the reaction solution sample was processed, and the concentration of PPO was determined by HPLC. The relative enzyme activity between the mutant and the WT was calculated based on the PPO concentration in the sample. Figure 1 As shown.
[0047] Depend on Figure 1It can be seen that the relative enzyme activity of the mutants is increased to a certain extent compared with that of the wild type. Among them, the relative enzyme activity of mutants N53V / V57Q / V94R is the highest, which is 20 times higher than that of the wild type.
[0048] Example 4:
[0049] wt DAAO and D-amino acid oxidase mutant III (N53V / V57Q / V94R) were cultured according to the culture protocol in Example 1. The reaction was carried out in a magnetically stirred water bath at a temperature of 45°C and a rotation speed of 600 rpm.
[0050] The 20ml reaction system included: 50mM racemic glufosinate-ammonium salt, 50mM pH 8.0 phosphate buffer, 8000U / L catalase, and 50g / L D-amino acid oxidase or its mutant frozen stem cells. Reaction solution samples were collected at 1h, 2h, 4h, and 6h for processing. The PPO concentration was determined by HPLC. The PPO conversion rate during the reaction of the mutant and WT cells was calculated based on the PPO concentration in the samples. The results are shown below. Figure 2 As shown. At the initial stage of the reaction (0 h), the conversion rate of PPO in the wt DAAO and D-amino acid oxidase mutant III (N53V / V57Q / V94R) reaction systems was 0. As the reaction progressed, at 6 h, the conversion rate of PPO in the wt DAAO reaction system was 1.9%, while the conversion rate of PPO in the D-amino acid oxidase mutant III (N53V / V57Q / V94R) reaction system was 40%, representing an increase of nearly 20-fold in PPO conversion.
[0051] Obviously, the above embodiments are merely illustrative examples for clear explanation and are not intended to limit the implementation. Those skilled in the art can make other variations or modifications based on the above description, which still fall within the protection scope of this invention.
Claims
1. A D-amino acid oxidase mutant, obtained by single-point mutation or multi-point combined mutation at positions 53, 57 and 94 of the amino acid sequence shown in SEQ ID NO.1, wherein the amino acid sequence of the mutant is shown in one of SEQ ID NO.3 to 5.
2. The gene encoding the D-amino acid oxidase mutant of claim 1.
3. A recombinant vector containing the gene of claim 2.
4. Genetically engineered bacteria containing the gene described in claim 2.
5. The application of the D-amino acid oxidase mutant of claim 1 in the microbial catalytic preparation of L-glufosinate.
6. The application as described in claim 5, characterized in that... The mutant was used to prepare L-glufosinate precursor 2-carbonyl-4-[hydroxy(methyl)phosphono]butyric acid (PPO) from racemic glufosinate (PPT) via biocatalysis.