A probe and primer combination for detecting respiratory syncytial virus and its application

Abstract

The present invention provides a kind of crRNA probe and primer combination for detecting respiratory syncytial virus (RSV), belong to the field of gene detection technology, it is characterised in that the crRNA probe includes: RSV_probe‑F and RSV_probe‑R, the primer combination includes: RSV_F1 and RSV_R1, wherein, RSV_probe‑F and RSV_F1 carry T7 promoter sequence at 5' end, and the RSV_probe‑R and RSV_probe‑F base sequence are reversely complementary;Cas13a nuclease activates enzyme activity after crRNA recognizes target gene, and visual chromogenic reporter molecules are cut, and detection signal is released. The crRNA and primer pairs of the present invention can detect syncytial virus sensitively and specifically, and the detection sensitivity is reduced to 200copies for the first time, and the mode of isothermal amplification is adopted and combined with lateral flow test strips, and complicated temperature control is not required, and there is simple operation, high sensitivity, strong specificity, and the advantages of fast detection speed.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology gene detection, and particularly relates to a crRNA probe and primer combination for detecting respiratory syncytial virus (RSV) based on isothermal amplification combined with Cas13a gene editing method. Background Art

[0002] Respiratory syncytial virus (RSV) belongs to the genus Pneumovirus of the Paramyxoviridae family and has only one serotype. It mainly causes lower respiratory tract infections such as bronchiolitis and pneumonia in infants under 6 months old, as well as upper respiratory tract infections such as rhinitis and colds in older children and adults.

[0003] The virus is spherical in shape, with a diameter of 120 - 300 nm, has an envelope, and its genome is a non-segmented single-stranded negative-sense RNA, mainly encoding 10 proteins, namely three transmembrane proteins: fusion protein (F), adhesion protein (G), and small hydrophobic protein (SH), two matrix proteins M1 and M2, three proteins (N, P, and L) that combine with viral RNA to form a nucleocapsid, and two non-structural proteins (NS1 and NS2). There are spikes composed of glycoproteins on the viral envelope, without HA, NA, and HL. This virus cannot grow in chicken embryos, but can slowly proliferate in a variety of cultured cells, and cytopathic effects appear in about 2 - 3 weeks. The characteristics of the cytopathic effects are the formation of multinucleated giant cells formed by cell fusion, with eosinophilic inclusion bodies in the cytoplasm.

[0004] Currently, the detection methods for respiratory syncytial virus (RSV) on the market mainly include the detection mode of PCR plus electrophoresis gel, QPCR fluorescence quantitative detection mode, and gene sequencing. These detection methods require reliance on more instruments and are relatively time-consuming.

[0005] The present invention uses isothermal amplification and Cas13 system for detection, reducing the dependence on large-scale instruments, with stable and relatively short detection time and relatively low cost. It can achieve rapid, portable, and accurate detection. As an auxiliary detection method, it has great application space. And after the system of the present invention is improved, primers and coding DNA probes can be designed and prepared for other target genes to also complete the detection of other target genes. Summary of the Invention

[0006] The present invention can detect respiratory syncytial virus (RSV), and its detection process is simple and convenient with low cost. At the same time, the present invention has high detection sensitivity and good detection specificity.

[0007] The present invention provides a crRNA probe and primer combination for detecting respiratory syncytial virus (RSV) based on isothermal amplification combined with a Cas13a gene editing method, characterized in that the crRNA probe comprises: RSV_probe-F and RSV_probe-R, and the primer combination comprises: RSV_F1 and RSV_R1, wherein RSV_probe-F and RSV_F1 have a T7 promoter sequence at the 5' end,

[0008] The RSV_probe-R and RSV_probe-F base sequences are reverse complementary;

[0009] The T7 promoter sequence is: GAAATTAATACGACTCACTATAGGG

[0010] The base sequence of RSV_probe-F is:

[0011] GAAATTAATACGACTCACTATAGGGGATTTAGACTACCCCAAAAACGAAGGGGACTAAAACGCATGTTAGACTACATGCCTTGATTTCA;

[0012] The base sequence of RSV_probe-R is:

[0013] TGAAATCAAGGCATGTAGTCTAACATGCGTTTTAGTCCCCTTCGTTTTTGGGGTAGTCTAAATCCCCTATAGTGAGTCGTATTAATTTC;

[0014] The base sequence of RSV_F1 is:

[0015] GAAATTAATACGACTCACTATAGGGAAGAAGCAAGCTGGCATATGATGTAACCAC;

[0016] The base sequence of RSV_R1 is:

[0017] GTTTTCATAGTGAGATCTTTAACTGTAGTTAACATA.

[0018] The target gene sequences of RSV_F1 and RSV_R1 are:

[0019] GTGCCAATGTGTCCTTGGATGAAAGAAGCAAGCTGGCATATGATGTAACCACACCCTGTGAAATCAAGGCATGTAGTCTAACATGCCTAAAATCAAAAAATATGTTAACTACAGTTAAAGATCTCACTATGAAACACTC.

[0020] The coding DNA sequence of the crRNA probe includes: a nucleic acid sequence for Cas13a nuclease recognition, and a nucleic acid sequence complementary to the target gene;

[0021] The nucleic acid sequence for Cas13a nuclease recognition is:

[0022] GATTTAGACTACCCCAAAAACGAAGGGGACTAAAAC;

[0023] The nucleic acid sequence complementary to the target gene is:

[0024] GCATGTTAGACTACATGCCTTGATTTCA.

[0025] The method for detecting respiratory syncytial virus comprises the following steps:

[0026] Step 1: crRNA preparation: Take 5 μL of RSV_probe-F and RSV_probe-R at a concentration of 10mM-50mM, mix well, and anneal at 95℃ for 5min. Then take the annealed RSV_probe-F and RSV_probe-R and add them to the transcription reaction system (2-10 μL 2×T7 Reaction Buffer, 2-10 μL T7 Polymerase Mix at a concentration of 2-100U / μL, and add nuclease-free water to the system to 20 μL), mix well; place the reaction tube at 37℃ for 4-16h. After the reaction is completed, purify the reaction product with magnetic beads or columns to obtain crRNA.

[0027] Step 2: Isothermal amplification: Take 1-10 μL of the sample to be tested and add it to the isothermal amplification reaction system (5-25 μL of 2× buffer V, 2-200 U / portion of RPA recombinase lyophilized powder, 1-10 μL of 5-50 mM RSV_F1 and RSV_R1, 1-5 μL of 280 mM magnesium acetate, add nuclease-free water to 50 μL), mix well; place the reaction plate at 39°C for 15 minutes. After the reaction is completed, the isothermal amplification reaction product of the sample to be tested is obtained.

[0028] Step 3: Targeted detection: Take 1 μL of isothermal amplification product and add it to the targeted detection system (5-20 μL of 5-100 mM detection buffer, 1-20 μL of 2× T7 Reaction Buffer, 0.1-2 μL of 10-100 U / μL T7 Polymerase Mix, 1-10 μL of 1-80 ng / μL crRNA, 0.1-5 μL of 50-500 nM Cas13a nuclease, 0.1-5 μL of 1-10 nM visual color reporter, 0.1-5 μL of 1-50 mM sodium chloride).

[0029] Step 4: Test strip detection: Take 1-10 μL of the third step targeted detection product and add 20-50 μL of test strip detection chromatography solution (10-100 mM Tris-HCL, 1-100 mM NaCl, 1-50 mM MgCl 2 , pH 6.5-8.5), mix well, place the test strip in the buffer and wait for 1-10 minutes. Observe the results with the naked eye.

[0030] Beneficial Effects

[0031] The crRNA probe designed by the present invention includes: RSV_probe-F and RSV_probe-R, and the primer combination includes: RSV_F1 and RSV_R1, wherein RSV_probe-F and RSV_F1 have a T7 promoter sequence at the 5' end, and the RSV_probe-R is reverse complementary to the RSV_probe-F base sequence; the Cas13a nuclease activates the enzyme activity after the crRNA recognizes the target gene, and cuts the visualized color reporter molecule to release the detection signal.

[0032] The crRNA and primer pairs of the present invention can detect syncytial virus sensitively and specifically, adopt a constant temperature amplification method and combine with a lateral flow test strip, do not require complex temperature control, have the advantages of simple operation, high sensitivity, strong specificity, and fast detection speed, and can be used for rapid detection in different environments.

[0033] For respiratory syncytial virus (RSV), the detection sensitivity currently found is generally between 10^4 and 10^7. The primer pairs designed by the present invention can significantly reduce the sensitivity of respiratory syncytial virus (RSV) and improve the accuracy of detection. The detection method of the present invention performs isothermal amplification on the M2 gene of respiratory syncytial virus (RSV) to achieve the enrichment of low-copy molecules, thereby greatly improving the detection limit, so that low-copy molecules are detected, and the minimum limit can reach 200 copies, improving the amplification efficiency so that the detection rate reaches higher requirements, and meets the detection rate of low-copy templates. And because the detection system utilizes the specificity of gene editing probes, the detection has high specificity.

[0034] The present invention can rapidly detect respiratory syncytial virus (RSV) by adopting a constant temperature amplification method and combining a lateral flow test strip, does not require complicated temperature control, and has many technical advantages such as simple operation, high sensitivity, strong specificity, and fast detection speed. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 It is the detection principle diagram of the present invention.

[0036] Figure 2 This is the test strip result diagram for targeted detection of primer pair F1-R1.

[0037] Figure 3 This is the test strip result diagram of primer pair F2-R2 targeted detection.

[0038] Figure 4 This is the test strip result diagram of primer pair F3-R3 targeted detection.

[0039] Figure 5 This is a picture of the test strip results for specificity testing. DETAILED DESCRIPTION

[0040] The technical solution of the present invention is described in detail below through specific embodiments.

[0041] Example 1

[0042] 1.1 Design multiple pairs of primer sequences for the gene of respiratory syncytial virus (RSV) and complete DNA sequence synthesis, as follows:

[0043] (1) Primer pairs for RSV gene

[0044]

[0045] Design coding DNA probes. The coding DNA sequences of crRNA probes are as follows. Three pairs of primers share one pair of crRNA:

[0046]

[0047] 1.2 Probe preparation

[0048] Transcribe the coding DNA probe into a guide RNA probe (crRNA): Take 5 μL of each pair of coding DNA probes, mix them, and anneal them at 95°C for 5 minutes. Then take the annealed DNA probes and add them to the transcription reaction system and mix them; place the reaction tube at 37°C for 16 hours. After the reaction is completed, purify the reaction product with magnetic beads or columns to obtain crRNA. Distribute them for use after detection.

[0049] The transcription reaction system is:

[0050] Reagents concentration Dosage T7 Reaction Buffer 2× 10μL T7 Polymerase Mix 10U / μL 2μL RSV_probe-F+RSV_probe-R 10mM each 5μL Nuclease-free water —— 3μL

[0051] 1.3 Isothermal amplification

[0052] Take 5 μL of the sample to be tested and nuclease-free water and add them to the isothermal amplification reaction system respectively, and mix them evenly; place the reaction plate at 39° C. for 15 minutes. After the reaction is completed, the isothermal amplification reaction product of the sample to be tested is obtained.

[0053] Reagents concentration Dosage Buffer V and RPA recombinase lyophilized powder 2× 25μL Primer pair (RSV_F1 and RSV_R1) 10mM each 2μL Magnesium acetate 280mM 2.5μL Nuclease-free water —— 15.5μL template —— 5μL

[0054] 1.4 Targeted Detection

[0055] Take 1 μL of isothermal amplification product for detection, wherein the detection reaction system is as follows:

[0056]

[0057]

[0058] Non-specific reporter molecules are as follows:

[0059] name Sequence (5' to 3') Nonspecific reporter molecules / 56-FAM / mArArUrGrGrCmAmArUrGrGrCmA / 3Bio /

[0060] After the reaction is completed, add 20 μL of test strip detection chromatography liquid to the product, mix and centrifuge, then insert the sample loading area of ​​the lateral flow test strip into the detection liquid. After 2-5 minutes, it can be directly observed and interpreted by the naked eye based on the brightness difference of the detection line band.

[0061] 1.5 Sensitivity test

[0062] The prepared template is dissolved and its concentration is measured, and then concentrated or diluted to different concentrations.

[0063] Copy Number(N)=con.(ng / ul)*6.022*10^(23)*10^(-9) / 660*bases number

[0064] Test: The template concentrations (copies / mL) involved in isothermal amplification are as follows:

[0065]

[0066] Take 5 μL of templates of different concentrations to participate in isothermal amplification, and then take 1 μL of isothermal amplification products for targeted detection. The test results of the test strips show that the results of primer pair F1-R1 are as follows: Figure 2 , the F2-R2 result is as follows Figure 3 , the result of F3-R3 is as follows Figure 4 For primers F1-R1, when the template concentration is higher than 100 copies / mL, it can be effectively detected. For primers F2-R2, when the template concentration is higher than 1*10 5 copies / mL, it can be effectively detected. For primer F3-R3, when the template concentration is higher than 1*10 6 When the number of copies / mL was 2.0, it could be effectively detected. The results showed that primer F1-R1 had a better detection effect.

[0067] Example 2

[0068] 2.1 Optimize the reaction systems of primer pairs F1-R1 for the respiratory syncytial virus (RSV) gene as follows.

[0069] (1) Primer pairs for RSV gene

[0070]

[0071] Design coding DNA probe, the coding DNA sequence of crRNA probe is as follows:

[0072]

[0073]

[0074] 2.2 Probe preparation

[0075] Transcribe the coding DNA probe into a guide RNA probe (crRNA): Take 5 μL of each pair of coding DNA probes, mix them, and anneal them at 95°C for 5 minutes. Then take the annealed DNA probes and add them to the transcription reaction system, mix them, and place the reaction tube at 37°C for 4 hours. After the reaction is completed, the crRNA is obtained without magnetic bead purification and is divided for use.

[0076] The transcription reaction system is:

[0077] Reagents concentration Dosage T7 Reaction Buffer 2× 10μL T7 Polymerase Mix 10U / μL 4μL RSV_probe-F+RSV_probe-R 10mM each 3μL Nuclease-free water —— 3μL

[0078] 2.3 Isothermal amplification

[0079] Take 10 μL of the sample to be tested and nuclease-free water and add them to the isothermal amplification reaction system respectively, and mix them evenly; place the reaction plate at 39° C. for 15 minutes. After the reaction is completed, the isothermal amplification reaction product of the sample to be tested is obtained.

[0080] Reagents concentration Dosage Buffer V and RPA recombinase lyophilized powder 2× 25μL Primer pair (RSV_F1 and RSV_R1) 10mM each 2μL Magnesium acetate 280mM 3μL Nuclease-free water —— 10μL template —— 10μL

[0081] 2.4 Targeted Detection

[0082] Take 1 μL of isothermal amplification product for detection, wherein the detection reaction system is as follows:

[0083] Reagents concentration content Assay buffer (Tris pH 7.4) 40mM 12.5μL T7 Reaction Buffer 2× 5μL T7 Polymerase Mix 10U / μL 1μL crRNA 10ng / μL 2μL Cas13a nuclease 82.58nM 1μL Visualization of chromogenic reporter molecules 10nM 1μL Magnesium chloride 2.5mM 1.5μL Isothermal amplification products —— 1μL

[0084] Non-specific reporter molecules are as follows:

[0085] name Sequence (5' to 3') Nonspecific reporter molecules / 56-FAM / mArArUrGrGrCmAmArUrGrGrCmA / 3Bio /

[0086] After the reaction is completed, add 20 μL of test strip detection chromatography liquid to the product, mix and centrifuge, then insert the sample loading area of ​​the lateral flow test strip into the detection liquid. After 2-5 minutes, it can be directly observed and interpreted by the naked eye based on the brightness difference of the detection line band.

[0087] 2.5 Sensitivity test

[0088] The isothermal amplification product is synthesized by gene synthesis and constructed into a plasmid to form a standard. The standard is diluted in a gradient of 1 / 10. Take 10 μL of each gradient standard to participate in isothermal amplification, and then take 1 μL of isothermal amplification product for targeted detection and test with a test strip. The results show that compared with the test results in Implementation Case 1, when 10 μL of the standard is used for detection, when the template is higher than 10 copies / mL, the present invention can be effectively detected.

[0089] Example 3

[0090] 3.1 Primer pair F1-R1 designed for the gene of respiratory syncytial virus (RSV) was used for clinical sample testing.

[0091] Primer pairs for RSV genes

[0092]

[0093] Design coding DNA probe, the coding DNA sequence of crRNA probe is as follows:

[0094]

[0095] 3.2 Probe preparation

[0096] Transcribe the coding DNA probe into a guide RNA probe (crRNA): Take 5 μL of each pair of coding DNA probes, mix them, and anneal them at 95°C for 5 minutes. Then take the annealed DNA probes and add them to the transcription reaction system, mix them, and place the reaction tube at 37°C for 4 hours. After the reaction is completed, the crRNA is obtained without magnetic bead purification and is divided for use.

[0097] The transcription reaction system is:

[0098] Reagents concentration Dosage T7 Reaction Buffer 2× 10μL T7 Polymerase Mix 10U / μL 4μL RSV_probe-F+RSV_probe-R 10mM each 3μL Nuclease-free water —— 3μL

[0099] 3.3 Isothermal amplification

[0100] Take 10 μL of the sample to be tested and nuclease-free water and add them to the isothermal amplification reaction system respectively, and mix them evenly; place the reaction plate at 39° C. for 15 minutes. After the reaction is completed, the isothermal amplification reaction product of the sample to be tested is obtained.

[0101] Reagents concentration Dosage Buffer V and RPA recombinase lyophilized powder 2× 25μL Primer pair (RSV_F1 and RSV_R1) 10mM each 2μL Magnesium acetate 280mM 3μL Nuclease-free water —— 10μL template —— 10μL

[0102] 3.4 Targeted Detection

[0103] Take 1 μL of isothermal amplification product for detection, wherein the detection reaction system is as follows:

[0104] Reagents concentration content Detection buffer (Tris pH 7.4) 40mM 12.5μL T7 Reaction Buffer 2× 5μL T7 Polymerase Mix 10U / μL 1μL crRNA 10ng / μL 2μL Cas13a nuclease 82.58nM 1μL Visualization of chromogenic reporter molecules 10nM 1μL Magnesium chloride 2.5mM 1.5μL Isothermal amplification products —— 1μL

[0105] Non-specific reporter molecules are as follows:

[0106] name Sequence (5' to 3') Nonspecific reporter molecules / 56-FAM / mArArUrGrGrCmAmArUrGrGrCmA / 3Bio /

[0107] After the reaction is completed, add 20 μL of test strip detection chromatography liquid to the product, mix and centrifuge, then insert the sample loading area of ​​the lateral flow test strip into the detection liquid. After 2-5 minutes, it can be directly observed and interpreted by the naked eye based on the brightness difference of the detection line band.

[0108] 3.5 Specificity test

[0109] Ten clinical samples were selected, of which five were positive samples and three were negative samples. The retained records are shown in the table below.

[0110] Blind sample number A B C D E F G H Sample situation Positive Positive Negative Negative Positive Positive Positive Negative

[0111] Test strip results Figure 5 The results showed that syncytial virus could be effectively detected without cross-reaction, which confirmed that the detection method of the present invention had high specificity.

[0112] The above are only the preferred specific embodiments of the present invention, but the protection scope of the present invention is not limited thereto. Any person skilled in the art within the technical scope disclosed by the present invention, according to the technical solution and inventive concept of the present invention, making equivalent substitutions or changes should be covered within the protection scope of the present invention.

Claims

1. A probe and primer for detecting respiratory syncytial virus, It is characterized in that The probes include RSV_probe-F and RSV_probe-R, and the primers include RSV_F1 and RSV_R1, wherein RSV_probe-F and RSV_F1 have T7 promoter sequences at the 5' end. The RSV_probe-R and RSV_probe-F base sequences are reverse complementary; The T7 promoter sequence is: GAAATTAATACGACTCACTATAGGG The base sequence of RSV_probe-F is: GAAATTAATACGACTCACTATAGGGGATTTAGACTACCCCAAAAACGAAGGGGACTA AAACGCATGTTAGACTACATGCCTTGATTTCA; The base sequence of RSV_probe-R is: TGAAATCAAGGCATGTAGTCTAACATGCGTTTTAGTCCCCTTCGTTTTTGGGGTAGT CTAAATCCCCTATAGTGAGTCGTATTAATTTC; The base sequence of RSV_F1 is: GAAATTAATACGACTCACTATAGGGAAGAAGCAAGCTGGCATATGATGTAACCAC; the base sequence of RSV_R1 is: GTTTTCATAGTGAGATCTTTAACTGTAGTTAACATA.

2. A probe and primer for detecting respiratory syncytial virus according to claim 1, It is characterized in that The target gene sequences of RSV_F1 and RSV_R1 are: GTGCCAATGTGTCCTTGGATGAAAGAAGCAAGCTGGCATATGATGTAACCACACCCT GTGAAATCAAGGCATGTAGTCTAACATGCCTAAAATCAAAAAATATGTTAACTACAG TTAAAGATCTCACTATGAAAACACTC.

Images