SNP loci tightly linked to anthocyanin content in cowpea, KASP markers and their applications

Abstract

The present invention discloses a SNP marker tightly linked to the anthocyanin content of cowpea, wherein the SNP marker tightly linked to the anthocyanin content of cowpea is located at the 2,361,292 bp position of chromosome 5 of the cowpea genome v1.2, and a base A to G substitution occurs, and the wild-type nucleotide sequence thereof is shown in SEQ ID NO.1. The present invention also discloses KASP molecular marker primers based on the SNP marker tightly linked to the anthocyanin content of cowpea and applications thereof. The SNP and KASP marker tightly linked to the anthocyanin content of cowpea provided by the present invention can be used for molecular marker-assisted selection breeding of anthocyanin traits of cowpea, which has important theoretical and practical guiding significance for accelerating the genetic improvement process and improving the efficiency of breeding selection.

Description

Technical Field

[0001] The present invention belongs to the field of molecular genetic breeding, and specifically relates to a SNP site closely linked to anthocyanin content of cowpea, a KASP marker and an application thereof. Background Art

[0002] Cowpea is an annual herb with high economic value. Its bean sprouts, seedlings and tender pods can be eaten as vegetables. It is one of the important summer legume vegetables in my country. Cowpea is rich in nutrients and is loved by consumers, especially purple cowpea, which has a relatively high content of anthocyanins. It is not only an excellent health vegetable but also a source of anthocyanins (Gao Huajie et al., 2010). Anthocyanins have strong antioxidant capacity and can help the human body resist certain cancers, cardiovascular diseases and some diseases related to body aging (Yoshimoto M, et al. 1999; Wang CJ, et al. 2000; Kong JM, et al. 2003). During the development of plant fruits, the content of anthocyanins changes, and there are differences between different varieties (Alcalde-Eon C, et al. 2014). For people in most countries and regions, vegetables account for a higher proportion in their daily diet than fruits and health products, so some vegetables rich in anthocyanins are selected and cultivated so that people can generally enjoy the benefits of anthocyanins to human health. Therefore, studying fast and effective molecular breeding technology for cowpea anthocyanin traits is of great significance for molecular-assisted genetic improvement of cowpea anthocyanin traits.

[0003] Traditional high anthocyanin cowpea breeding is based on the selection of individual plants according to the anthocyanin content of the breeding offspring. This method is not only time-consuming and labor-intensive, but also susceptible to environmental interference and has low accuracy. Using the base differences in the target gene to develop specific molecular markers for auxiliary selection is the best way to improve the selection efficiency of high anthocyanin cowpea. Molecular markers have the advantages of early selection, no environmental influence, accuracy, rapidity and efficiency in crop breeding, and have become an accurate and efficient tool. Although the competitive allele-specific PCR (Kompetitive Allele-Specific PCR, KASP) molecular marker is a new SNP typing method based on allele-specific amplification (Amplification Refractory Mutation System, ARMS) and highly sensitive fluorescence detection. Its principle is to design two forward primers and a universal reverse primer for the allele SNP site, each forward primer has a specific sequence that can be combined with different fluorescent markers. When forward primers with different fluorescent binding sequences and universal reverse primers are used to amplify the DNA of the sample by PCR, its allelic variation can be reflected by different fluorescent signals (He CL, et al. 2014).

[0004] Studies have shown that the content of plant anthocyanins is regulated by multiple genes and is easily affected by the environment, making it a complex quantitative trait (Cavagnaro PF, et al. 2014; Choi Y, et al. 2020). Single nucleotide polymorphism (SNP) mainly refers to DNA sequence polymorphism caused by the variation of a single nucleotide at the genome level. As an effective gene positioning tool, genome-wide association study (GWAS) can quickly and accurately mine SNPs that are closely linked to cowpea anthocyanins.

[0005] Therefore, based on the identified SNPs that are closely linked to cowpea anthocyanins, the development of KASP markers that are closely linked to cowpea anthocyanin content for early breeding (low generation) selection has a significant effect on reducing the workload of breeding and accelerating the progress of breeding, while also having obvious economic benefits. Based on the mining of SNPs that are closely linked to cowpea anthocyanins, it is particularly important to develop KASP molecular markers for assisted breeding and achieve early molecular assisted selection of target traits to improve breeding efficiency. Summary of the invention

[0006] Purpose of the invention: The purpose of the present invention is to identify SNP sites that are closely linked to the anthocyanin content of cowpea, and to develop KASP molecular markers and primer pairs based on the SNP site information, so as to provide molecular assisted selection technology support for the early identification and screening of this trait.

[0007] In order to solve the above technical problems, the technical solution adopted by the present invention is as follows: The present invention provides a SNP marker closely linked to the anthocyanin content of cowpea, and the SNP marker closely linked to the anthocyanin content of cowpea is located in the cowpea genome v1.2 ( https: / / phytozome.jgi.doe.gov ) had a base substitution from A to G at position 2,361,292bp on chromosome 5. The nucleotide sequence of the wild-type gene of cowpea anthocyanin is shown in SEQ ID NO.1, and the 479th position of the gene sequence of SEQ ID NO: 1 was mutated from A to G.

[0008] The present invention also includes a KASP molecular marker based on the SNP marker closely linked to the anthocyanin content of cowpea, which respectively comprises two specific primers designed for base differences at key sites, namely, upstream primer F1 (SEQ ID NO.2) and upstream primer F2 (SEQ ID NO.3), and a universal primer, namely, downstream primer R (SEQ ID NO.4). The 3' ends of the two specific primers are allelic variant bases, and the 5' ends are connected to the FAM and HEX fluorescent linker sequences specific to the KASP reaction reagent of the British LGC (Laboratory of the Government Chemist) company.

[0009] The KASP upstream primer F1 sequence is 5'- gaaggtgaccaagttcatgct ctgaatattttcaaggaatttca-3';

[0010] The KASP upstream primer F2 sequence is 5'- gaaggtcggagtcaacggatt ctgaatattttcaaggaatttcg-3';

[0011] KASP-labeled downstream primer R5'-tgggttgcgtgagctcattt-3'.

[0012] When synthesizing the KASP molecular marker primers, the 5' end of the forward primer F1 is added with a fluorescent signal label of carboxyfluorescein FAM (underlined portion of the primer); the 5' end of the forward primer F2 is added with a fluorescent signal label of hexachlorofluorescein phosphoramidate HEX (underlined portion of the primer).

[0013] The present invention also includes the application of the SNP marker or the KASP molecular marker in molecular marker-assisted selection breeding of cowpea anthocyanin traits.

[0014] Specifically, the present invention applies KASP molecular markers at SNP sites closely linked to the anthocyanin content of cowpea to an identification or auxiliary screening method, which is to detect whether the genotype of the deoxyribonucleotide at the 2,361,292bp position of cowpea chromosome 5 is AA or GG. The low-generation breeding materials of cowpea with GG genotype are selected to provide technical support for molecular marker-assisted breeding of cowpea anthocyanin content traits.

[0015] In the above method, the KASP primer set consists of upstream primer F1, upstream primer F2 and downstream primer R. PCR amplification is performed in an ABI7500 real-time fluorescence quantitative PCR instrument, and the instrument can perform genotyping based on the fluorescence signal after the PCR is completed. After the reaction is completed, the ABI7500 real-time fluorescence quantitative PCR instrument will directly read the fluorescence data of the PCR reaction product, and the results of the fluorescence scan will be automatically converted into a graph; if the typing is not sufficient, continue amplification, and check the typing every 3 cycles until the typing is complete.

[0016] The present invention also includes a kit for detecting the SNP marker, comprising the primer pair.

[0017] The present invention also includes the use of the SNP marker, the primer pair or the kit in screening cowpeas with high anthocyanin content.

[0018] The present invention also includes a method for detecting the anthocyanin content of cowpea, by detecting the SNP markers on the cowpea to be tested, and predicting the anthocyanin content of the cowpea, which specifically includes the following steps:

[0019] (1) extracting cowpea genomic DNA to be tested;

[0020] (2) using the genomic DNA as a template and using the primer pair to perform a PCR amplification reaction in a fluorescent quantitative PCR instrument;

[0021] (3) Genotyping is performed based on the fluorescence signal. When the genotype is AA, it is a cowpea with a low anthocyanin content, and when the genotype is GG, it is a cowpea with a high anthocyanin content.

[0022] Wherein, the PCR amplification system in step (2) comprises: cowpea sample DNA template, 2×KASP Master mix, KASP Assay Mix, the primer pair and water.

[0023] The reaction conditions of step (2) include pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 sec, annealing at 61-55°C for 60 sec, decreasing the temperature by 0.6°C in each cycle, for 10 cycles; denaturation at 94°C for 20 sec, annealing at 55°C for 60 sec, for 26 cycles.

[0024] The present invention also includes a method for screening cowpeas with different anthocyanin contents, comprising the following steps:

[0025] (S1) extracting cowpea plant genomic DNA;

[0026] (S2) using the genome as a template, performing a PCR amplification reaction using the primer pair and detecting the SNP genotype AA or genotype GG;

[0027] (S3) Selecting cowpea plants or strains with different anthocyanin contents from different families according to their genotypes.

[0028] Wherein, in step (S1), the genome is extracted using the hexadecyltrimethylammonium bromide method;

[0029] Wherein, in step (S2), the molecular marker primers are first added to the same PCR reaction system, and two blank controls are set with ultrapure water instead of sample template DNA, and the DNA of the cowpea RIL population is amplified on a fluorescent quantitative PCR instrument; the specific amplification system is: 10μl reaction system: 25ng / μl cowpea sample DNA template 25ng / μl, 2μl; 2×KASPMaster mix 5μl; KASP Assay Mix is, F1:F2:R=2:2:5, 0.14μl; water 2.9μl; reaction conditions include 94℃ pre-denaturation for 15min; 94℃ denaturation for 20sec, 61-55℃ annealing for 60sec, reducing 0.6℃ for each cycle, 10 cycles; 94℃ denaturation for 20sec, 55℃ annealing for 60sec, 26 cycles; after the reaction is completed, the fluorescence data of the PCR reaction product is directly read by ABI7500 real-time fluorescence quantitative PCR instrument, and the results of fluorescence scanning are automatically converted into graphics. The molecular marker primers can clearly separate the two genotypes, among which the dots close to the Y-axis are the A allele variation sites, and the genotype is AA; the dots close to the X-axis are the G allele variation sites, and the genotype is GG.

[0030] Beneficial effects: Compared with the existing technology, it has the following advantages:

[0031] 1) The present invention firstly obtains the cowpea anthocyanin tightly linked SNP05_2361292 phenotypic variation explanation rate of 31.66%-38.59%, which is located at the 2,361,292bp position of chromosome 5 in the cowpea genome v1.2. The GG or AA genotype is selected from low-generation breeding materials to provide technical support for molecular marker-assisted breeding of cowpea traits with different anthocyanin contents.

[0032] 2) The KASP molecular marker developed by the present invention can directly distinguish and detect the A or G base of the SNP mutation site specifically. The KASP molecular marker has good application value and can realize the pre-selection of the cowpea anthocyanin content trait and molecular assisted breeding.

[0033] 3) KASP molecular marker primers were used to amplify and genotype 20 cowpea family materials on a real-time fluorescence quantitative PCR instrument. The results showed that the molecular marker primers can clearly separate the two genotypes. The dots close to the Y-axis are the G allele variant sites, with a genotype of GG, and there are 6 families with average anthocyanin contents of 144.13 μg / g FW (June 2020) and 126.84 μg / g FW (September 2020), respectively. The dots close to the X-axis are the A allele variant sites, with a genotype of AA, and there are 14 families with average anthocyanin contents of 10.17 μg / g FW (June 2020) and 11.03 μg / g FW (September 2020), respectively. The points close to the origin of the XY axis are the blank controls. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] Figure 1 .QTL results of cowpea anthocyanin. QTL positioning results of cowpea anthocyanin content in June 2020 (ANT2020-06) and September 2020 (ANT2020-06).

[0035] Figure 2 .KASP markers were used to genotype different cowpea families; (the black dots near the origin represent the blank control without template DNA; the green dots near the Y-axis and the red dots near the X-axis represent the cowpea families carrying the G allele mutation site and the cowpea families carrying the A allele mutation site, respectively). DETAILED DESCRIPTION

[0036] Example 1 Obtaining SNP loci closely linked to the major QTL for anthocyanin content in cowpea

[0037] The cowpea anthocyanin tightly linked SNP, S05_2361292, of the present invention is obtained by the following steps:

[0038] (1) With high anthocyanin content 'Su Zi 41' as the female parent (114.99 μg / g FW) and 'Su Jiang 1419' as the male parent (10.78 μg / g FW) (Jiangsu Agricultural Germplasm Resources Protection and Utilization Platform), hybrid F1 was obtained. F2 was obtained by self-pollination of F1 generation single plants. Single seed propagation was used in F2 until F7 generation, and recombinant inbred lines containing 211 families were obtained to form a genetic mapping population. The anthocyanin phenotype of the recombinant inbred line population was identified, and the parents 'Su Zi 41' and 'Su Jiang 1419' were resequenced with a sequencing depth of 32.6× and a sequencing depth of 5.44× for the recombinant inbred line population. After elimination and filtering, a high-density SNP molecular marker map covering the entire genome was obtained.

[0039] This includes DNA extraction and high-throughput sequencing: the CTAB method was used to extract genomic DNA from young leaves of two parents and 211 families of the RIL cowpea population, and whole genome resequencing was performed.

[0040] (2) Determination of anthocyanin content in cowpea pods under two environments (spring 2020 and autumn 2020) by UV spectrophotometry:

[0041] Take the cowpea pods of the parents and families of the RIL population, mix each sample of fresh cowpea pods (2 parents and 211 families) thoroughly, crush them, and let all the seeds pass through a 0.25 mm pore size sieve and put them into a sample bottle for later use. Weigh 0.5 g of fresh cowpea pods to an accuracy of 0.0001 g, place them in 10 mL of hydrochloric acid and ethanol (1:1), and then determine anthocyanins according to ultraviolet spectrophotometry.

[0042] (3) QTL localization analysis: The mixed linear model (MLM) in the GAPIT algorithm package in the R language software was used to perform QTL localization analysis on the cowpea anthocyanin content data. In both environments, in June 2020 (sowing in April in spring 2020, pods were harvested in June, and anthocyanin content was measured) and September 2020 (sowing in August in autumn 2020, pods were harvested in September, and anthocyanin content was measured), a SNP site S05_2361292 closely linked to the main QTL site related to the anthocyanin content of cowpea was detected. The phenotypic variation explanation rate reached 31.66%-38.59%. It was located at the 2,361,292 bp position on chromosome 5 of the cowpea genome v1.2. Three SNP sites closely linked to the anthocyanin content of cowpea were detected, and all of them were located on chromosome 5 (Table 1, Figure 1 ).

[0043] Table 1 QTL mapping results for anthocyanin content in cowpea RIL population

[0044]

[0045] Example 2: Development of KASP marker-specific primers

[0046] Using the Primer-BLAST function of NCBI (https: / / www.ncbi.nlm.nih.gov / ), three primers were designed based on the SEQ ID NO.1 sequence, upstream primer F1 (SEQ ID NO.2), upstream primer F2 (SEQ ID NO.3) and downstream primer R (SEQ ID NO.4), where F1 and F2 contain FAM and HEX fluorescent linker sequences (underlined), respectively, and the sequences are as follows:

[0047] SEQ ID NO.1:

[0048]

[0049]

[0050] F1 sequence: 5'- GAAGGTGACCAAGTTCATGCT CTGAATATTTTCAAGGAATTTCA-3'

[0051] F2 sequence: 5'- GAAGGTCGGAGTCAACGGATT CTGAATATTTTCAAGGAATTTCG-3'

[0052] R sequence: 5'-TGGGTTGCGTGAGCTCATTT-3'

[0053] Example 3: Detection of genotypes of SNP sites in cowpeas of different families and their applications

[0054] The genomic DNA of 194 families in the RIL population was extracted respectively, and the genomic DNA was used as a template, and the KASP marker special primers of Example 2 were used for PCR amplification to obtain PCR amplification products. PCR amplification was carried out in an ABI7500 real-time fluorescence quantitative PCR instrument. After the PCR was completed, the instrument could perform genotyping according to the fluorescence signal. The amplification system was a 10μl reaction system: cowpea sample DNA template, 25ng / μl, 2μl; 2×KASP Master mix 5μl; KASP Assay Mix, F1:F2:R=2:2:5, 0.14μl; water 2.9μl. The reaction conditions included 94℃ pre-denaturation for 15min; 94℃ denaturation for 20sec, 61-55℃ annealing for 60sec, reducing 0.6℃ for each cycle, 10 cycles; 94℃ denaturation for 20sec, 55℃ annealing for 60sec, 26 cycles.

[0055] After the reaction is completed, the ABI7500 real-time fluorescence quantitative PCR instrument directly reads the fluorescence data of the PCR reaction product. The results are as follows Figure 2 KASP molecular marker primers were used to amplify and genotype 20 families of cowpea RIL population on a real-time fluorescence quantitative PCR instrument. The results showed that the molecular marker primers could clearly separate the two genotypes. The dots close to the Y axis were the G allele variant sites with genotype GG, of which there were 6 (family numbers SS-11, SS-13, SS-17, SS-22, SS-155, SS-196), and their average anthocyanin contents were 144.13 μg / gFW (2020). The average anthocyanin contents of the pedigrees were 10.17 μg / g FW (June 2020) and 11.03 μg / g FW (September 2020), respectively. The points close to the origin of the XY axis are blank controls (Table 2, Table 2). Figure 2 ). In addition, it was found that in the RIL population containing 194 cowpea families (3 families had missing genotypes at the SNP site S05_2361292), the average anthocyanin content of 94 cowpea families with genotype GG was 128.75 μg / g FW (June 2020) and 127.87 μg / g FW (September 2020), respectively; the average anthocyanin content of 97 cowpea families with genotype AA was 9.81 μg / g FW (June 2020) and 10.66 μg / g FW (September 2020) (Table 2). From the above results, it can be seen that we can determine the anthocyanin content of the cowpea by determining the genotype AA or GG, thereby screening cowpeas with different anthocyanin contents.

[0056] Table 2 Anthocyanin content and genotyping of 194 families in the cowpea RIL population

[0057]

[0058]

[0059]

[0060]

[0061] Sequence Listing <110> Jiangsu Academy of Agricultural Sciences <120> SNP loci tightly linked to anthocyanin content in cowpea, KASP markers and their applications <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> 2248 <212> DNA <213> Cowpea anthocyanins (V.unguiculata) <400> 1 atggatcaaa agcttgtctc aagctggttc catcttcatt cctcagtgcc cttatcctac 60 gtgcaaccac cggaaagcca acctggcatg gtttttcctt ccggcaagaa aatcccggtg 120 gtagatctcg gactgcacga tcgccatgaa atcttgaagc acattttgaa agcctccgag 180 gactatggat ttttccaggt tctttttccc atcaattttc tttccctttg ttgtagttat 240 aatttcacag catatacgcg ctttctgcac tagagataca ataaacaaaa tcaatttcgt 300 cgtaattttt ataagcactg gaatgttatt agtttttgat atcatgaaag tgtcggtgtt 360 taaacttagc tgtttacaat gattttagtt tatgcatgaa aaactgtggt gtaggttatc 420 aaccatggag tatcgaaaga gttaatggat gagacactga atattttcaa ggaatttcat 480 gccatgcctg ctgaagaaaa gataagggaa agttccagag atccaaatgg aggttgcagg 540 ctctacacaa gccgtgagat taacagcaaa gataccgttc agttctggag ggacacatta 600 agacacttgt gtccatcttc tgaagattcc atgcaatttt tgcctcaaaa gcctgcaaaa 660 tatcggtaaa agatcgtctt catttgatgt aatttttctg taaataacat tcaatatgag 720 gtatcgtttc ctgtgcaact tatttaaatg agctcacgca acccaattta agtggcttca 780 tcagcgtttt aataaactat aaaccttctt gacaatggta gatatgtact attaatttca 840 gtttgtgtca gatgttttga ctgtggacgt tgatgtgttc tggttgacaa tgatgtctta 900 aaaaatgaca agtcactatc aaaatttttt attccataat tccgtttcat tcttttgaag 960 cataattgac tagtcctatg aatattcttt tagattttct tctaatttt tttaaatgat 1020 tgataatgag attttaacca ttaaacttgg tttaatctga acctttatga gtcatcattg 1080 attgttctga aaggtgagta gacattattc ataccacatg ggcaactaaa ggtgtaatta 1140 actaagacct cttttttctt taccattaag ttttccttca ctgggttgga aaccactacc 1200 actacctaat gttactactt ttgcatctgg tcttaattat cacaaagtca caattaacag 1260 cacacgttta acataagtac cacactgtca tgtcatcatc ataactatag ccgccacttc 1320 acaacgaaca aaaatccagc tcaatacaca ggttagcaca atacaattat taagcataca 1380 cgattgtat taattcatta attaacaat taaagtttta ttatcttctt cgaaactcat 1440 cttattctga ctaatgaaag attctgttga ctatgatgat tcctctcctt gcagtgaaat 1500 cgttgcaaaa tacacgcaag aaatgagaag aatgggacta aaaattttgg agctgctatg 1560 tgaaggttta ggacttgacc caaaatactg ttgtggtgga cttagtgaga gtcctttact 1620 gctagctcat cactaccctc catgcccaga accaagttta accttgggag ctcctaagca 1680 cagagatcct aaccttgtta ctattctgct tcaagaaaaa gatataaatg cacttcaagt 1740 cttcaaagat ggagaatgga tagtggttga acctattcct tatgcttttg tggtcaacat 1800 tgggcttatg ttgcaggtaa tatatatatg tttctccata tataataaa ctgtttgata 1860 ttgatatata tttgtaagt agtatcaatt agcataat ttgtacactt ttttctgat 1920 acatcaactc attacggaaa acatttggtt cctgattctg ggtcatgatg atatggtttt 1980 gcatgatgaa attctgtgac tgatgaatgt gcaggtgatt agtaatggaa ggttaatcgg 2040 tgctgaacac cgtgtggtga caaattcaga atttgcaagg accacagttg catatttcat 2100 ccgtccaaat agcaaacaga ttatagaacc tgcaaagtgt ttgataagtt ctggtgctca 2160 acctatctac agatccattg catttgaaga gttcttgaaa aatttcatga tcaagggtac 2220 tgatattgaa cgagaattgc tcttgtaa 2248 <210> 2 <211> 44 <212> DNA <213> Artificial Sequence <400> 2 gaaggtgacc aagttcatgc tctgaatatt ttcaaggaat ttca 44 <210> 3 <211> 44 <212> DNA <213> Artificial Sequence <400> 3 gaaggtcgga gtcaacggat tctgaatatt ttcaaggaat ttcg 44 <210> 4 <211> 20 <212> DNA <213> Artificial Sequence <400> 4 tgggttgcgt gagctcattt 20

Claims

1. KASP molecular marker primers based on SNP markers closely linked to the anthocyanin content of cowpea, characterized in that: The KASP molecular marker primer sequence is as follows: The upstream primer F1 sequence is 5'- gaaggtgaccaagttcatgct ctgaatattttcaaggaatttca -3'; The upstream primer F2 sequence is 5'- gaaggtcggagtcaacggatt ctgaatattttcaaggaatttcg-3'; The downstream primer R 5'-tgggttgcgtgagctcattt-3', the SNP marker closely linked to the anthocyanin content of cowpea is located at the 2,361,292 bp position of chromosome 5 of the cowpea reference genome V1.2, and a substitution from base A to G occurs.

2. Use of the KASP molecular marker primers according to claim 1 in molecular marker-assisted selection breeding of cowpea anthocyanin content traits.

3. A kit for detecting SNP markers closely linked to the anthocyanin content of cowpea, characterized in that: Comprising the KASP molecular marker primer according to claim 1.

4. Use of the KASP molecular marker primers according to claim 1 or the kit according to claim 3 in screening cowpeas with high anthocyanin content.

5. A method for detecting the anthocyanin content of cowpea, characterized in that: The anthocyanin content of the cowpea is predicted by detecting a SNP marker that is closely linked to the anthocyanin content of the cowpea, which specifically includes the following steps: (1) Extracting cowpea genomic DNA to be tested; (2) Using genomic DNA as a template, and using the molecular marker primers described in claim 1, a PCR amplification reaction is performed in a fluorescent quantitative PCR instrument; (3) Genotyping is performed based on the fluorescence signal. When the genotype is AA, it is a cowpea with low anthocyanin content, and when the genotype is GG, it is a cowpea with high anthocyanin content; The SNP marker closely linked to the anthocyanin content of cowpea is located at the 2,361,292 bp position of chromosome 5 of the cowpea reference genome V1.2, and a substitution from base A to G occurs.

6. The method for detecting the anthocyanin content of cowpea according to claim 5, characterized in that: The PCR amplification system in step (2) comprises: cowpea sample DNA template, 2×KASP Master mix, KASP Assay Mix, the molecular marker primers described in claim 1 and water.

7. The method for detecting the anthocyanin content of cowpea according to claim 5, characterized in that: The reaction conditions of step (2) include pre-denaturation at 94°C for 15 min; denaturation at 94°C for 20 sec, annealing at 61-55°C for 60 sec, decreasing the temperature by 0.6°C in each cycle, for 10 cycles; denaturation at 94°C for 20 sec, annealing at 55°C for 60 sec, for 26 cycles.

8. A method for screening cowpea with high anthocyanin content, characterized in that: The following steps are involved: (S1) Extraction of cowpea plant genomic DNA; (S2) using the genome as a template, using the KASP molecular marker primers described in claim 1 to perform a PCR amplification reaction and detecting the SNP genotype AA or genotype GG that is closely linked to the anthocyanin content of cowpea; (S3) selecting cowpea plants or lines with high anthocyanin content in different families according to genotypes; when the genotype is GG, it is a cowpea with high anthocyanin content; The SNP marker closely linked to the anthocyanin content of cowpea is located at the 2,361,292 bp position of chromosome 5 of the cowpea reference genome V1.2, and a substitution from base A to G occurs.

9. The method for screening cowpea with high anthocyanin content according to claim 8, characterized in that: In the step (S2), the fluorescence data of the PCR reaction product is directly read by the ABI7500 real-time fluorescence quantitative PCR instrument, and the result of the fluorescence scanning is automatically converted into a graph to separate the two genotypes to obtain the genotype AA or the genotype GG.

Images