Use of miR-143-3p in preparation of a medicine for treating temporomandibular joint osteoarthritis

Abstract

The application provides a new use of a biological agent miR-143-3p in preparation of a temporomandibular joint osteoarthritis treatment drug, and belongs to the field of biological medicine. The application studies that miR-143-3p can effectively relieve the surface wear and hyperemia degree of the TMJOA disc; meanwhile, miR-143-3p can well relieve the degradation and damage of condylar cartilage tissue in temporomandibular joint osteoarthritis by inhibiting the ferroptosis process of chondrocytes; and miR-143-3p can significantly inhibit the subchondral bone change in temporomandibular joint osteoarthritis, reduce the osteoclastic activity in the subchondral bone, and then relieve the joint area pain and relieve osteoarthritis, thereby providing a new selection for temporomandibular joint osteoarthritis treatment drugs. Therefore, miR-143-3p has high application value as a potential intervention means for temporomandibular joint osteoarthritis.

Description

Technical Field

[0001] This invention belongs to the field of biomedicine, specifically relating to the novel use of miR-143-3p in the preparation of medicaments for the treatment of temporomandibular joint osteoarthritis. Background Technology

[0002] MicroRNAs (miRNAs) are a class of small non-coding RNAs that do not directly encode proteins but regulate other RNAs. They silence target gene expression by binding to the 3' untranslated region (3'UTR) or open reading frame (ORF) of mRNA. The role of miRNAs in life activities is receiving increasing attention. Studies have confirmed that miRNAs participate in various physiological and pathological activities, influencing cell proliferation, differentiation, migration, and the initiation and progression of various diseases. miRNA-based disease treatment strategies have shown great potential in the treatment of various diseases.

[0003] Temporomandibular joint osteoarthritis (TMJOA) is a common degenerative joint disease. As the disease progresses, TMJOA patients experience limited mandibular movement and severe pain, significantly impacting their physical and mental health. The main histopathological features of TMJOA include progressive degeneration and destruction of the condylar cartilage, abnormal subchondral bone remodeling, and significant synovitis. Articular cartilage is a major component of the joint that bears biological stress; its damage or degradation leads to loss of normal joint structure and function, causing joint pain and movement disorders.

[0004] However, the avascular nature of cartilage tissue hinders the transmission of signaling molecules, cell migration, and the transport of nutrients or oxygen, resulting in very limited self-healing ability of cartilage and difficulty in effectively regenerating damaged cartilage tissue.

[0005] The pathogenesis of TMJOA remains unclear, and clinical treatments are mostly symptomatic, failing to effectively reverse the structural and functional damage to the joints caused by the disease. Therefore, finding a new treatment intervention for TMJOA is an important direction in the field of clinical research on osteoarthritis.

[0006] miR-143-3p is a miRNA that has been reported to be associated with the evaluation of efficacy in the treatment of schizophrenia. The dissertation by Liu Lang of the Department of Surgery (Orthopedics) at Nanchang University, entitled "A Study on the Mechanism of Long Non-coding RNA SNHG1 in Alleviating IL-1β-Induced Chondrocyte Inflammatory Damage by Targeting the miR-143-3p / KLF2 Axis" (Medical and Health Science and Technology Special Issue, Master's Electronic Journal (Issue 08, 2020)), discloses that SNHG1 can alleviate IL-1β-induced chondrocyte inflammatory damage, while miR-143-3p can inhibit the expression of SNHG1, leading to enhanced inflammation.

[0007] There are currently no reports of direct research on the relationship between miR-143-3p and arthritis. Summary of the Invention

[0008] Based on the discovery that miR-143-3p can reduce temporomandibular joint osteoarthritis, this invention provides a new drug for treating temporomandibular joint osteoarthritis.

[0009] This invention provides the use of a substance that increases the expression level of miR-143-3p in the preparation of a drug for treating temporomandibular joint osteoarthritis.

[0010] The substances that enhance expression levels are miR-143-3p, miR-143-3p mimics, or miR-143-3pagomir.

[0011] The nucleotide sequence of miR-143-3p is shown in SEQ ID NO.1; the nucleotide sequence of miR-143-3p mimics is shown in SEQ ID NO.2; miR-143-3p agomir includes a forward sequence and a reverse sequence, and the nucleotide sequences are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

[0012] The drug in question is for the treatment of temporomandibular joint osteoarthritis.

[0013] The drug is used to relieve surface wear and congestion of the articular disc; the drug is used to significantly increase the content of type II collagen in cartilage.

[0014] The drug is capable of alleviating the degeneration and degradation of cartilage tissue in temporomandibular joint osteoarthritis.

[0015] The drug is a drug that enhances the activity of chondrocytes; the drug is a drug that reduces the osteoclast activity of subchondral bone in patients with temporomandibular joint osteoarthritis.

[0016] The drug is a drug that increases the expression level of GPX4 in chondrocytes and / or enhances the activity of GPX4 enzyme; the drug is a drug that reduces the level of malondialdehyde in chondrocytes; the drug is a drug that reduces the level of lipid reactive oxygen species in chondrocytes; the drug is a drug that reduces the expression level of Mfsd8 in chondrocytes.

[0017] The drug is a medication that increases subchondral bone density in patients with temporomandibular joint osteoarthritis.

[0018] The medication in question is for relieving pain in the temporomandibular joint osteoarthritis area.

[0019] Experimental results show that by administering AgomiR-143-3p or miR-143-3p mimics, this invention enhances the expression level of miR-143-3p, effectively alleviates surface wear and congestion of the TMJOA articular disc, significantly increases the content of type II collagen in cartilage, alleviates the degeneration of cartilage tissue in temporomandibular joint osteoarthritis, reduces joint pain, increases cartilage bone density, and treats temporomandibular joint osteoarthritis.

[0020] This invention found that miR-143-3p can reduce temporomandibular joint osteoarthritis, contrary to the suggestion of increased inflammation reported in the aforementioned dissertation on surgery (orthopedics) by Liu Lang of Nanchang University.

[0021] Obviously, based on the above description of the present invention, and according to common technical knowledge and conventional methods in the field, various other modifications, substitutions or alterations can be made without departing from the basic technical concept of the present invention.

[0022] The following detailed embodiments further illustrate the above-described content of the present invention. However, this should not be construed as limiting the scope of the present invention to the following examples. All technologies implemented based on the above-described content of the present invention fall within the scope of the present invention. Attached Figure Description

[0023] Figure 1 To investigate the therapeutic effects of miR-143-3p on articular disc morphology and cartilage repair in temporomandibular joint osteoarthritis. (A) Gross image of the articular disc; (B) Safranin O and Fast Green staining, OARSI score, and immunofluorescence staining for COL2A1, a molecule related to chondrocyte matrix synthesis.

[0024] Figure 2To investigate the inhibitory effect of miR-143-3p on ferroptosis in chondrocytes during arthritis. (A) Immunofluorescence staining of ferroptosis-associated protein GPX4; (B) Changes in chondrocyte activity; (C) Changes in malondialdehyde (MDA) levels, a ferroptosis-associated marker in chondrocytes; (D) Changes in reactive oxygen species (ROS) in chondrocytes.

[0025] Figure 3 To investigate the effect of miR-143-3p on its downstream target gene Mfsd8 to inhibit ferroptosis in chondrocytes. (A) Immunofluorescence staining of Mfsd8 in chondrocytes; (B) Changes in the transcriptional level of Mfsd8 in chondrocytes; (C) Changes in the transcriptional level of Mfsd8 in chondrocytes; (D) Changes in the protein level of Mfsd8 in chondrocytes; (E) Changes in the protein level of Mfsd8 in chondrocytes; (F) Prediction of the action site of Mfsd8 by miR-143-3p; (G) (H) Dual-luciferase reporter gene validation that Mfsd8 is a target gene of miR-143-3p; (I) Changes in chondrocyte activity; (J) Changes in the level of MDA, a ferroptosis-related indicator in chondrocytes; (K) Changes in reactive oxygen species (ROS) in chondrocytes.

[0026] Figure 4 To investigate the pain-relieving effect of miR-143-3p on temporomandibular joint osteoarthritis and its effect on promoting subchondral bone mineral density in arthritis. (A) Vonfrey pain threshold in the joint area; (B) Micro-CT scan reconstruction; (C) Micro-CT scan bone analysis.

[0027] Figure 5 This study investigates the inhibitory effects of a biological agent, miR-143-3p, on subchondral bone osteoclast activity and CGRP expression in arthritis. (A) TRAP staining; (B) CGRP immunofluorescence staining. Detailed Implementation

[0028] The raw materials and equipment used in this invention are all known products, obtained by purchasing commercially available products.

[0029] The Mfsd8 gene, a major facilitator superfamily domain containing 8, can activate transmembrane transporter activity and is predicted to participate in transmembrane transport. It plays a role in the regulation of the following life processes, including the TORC1 signaling pathway, autophagosome maturation, and cellular catabolism. It is located in lysosomes and membranes, and the human homolog of this gene is associated with neuronal lipofuscin disease.

[0030] Malondialdehyde (MDA) is a compound formed from the breakdown of lipid peroxides. Therefore, MDA is one of the most common indicators for detecting lipid peroxides in cells and tissues.

[0031] TRAP staining, also known as tartrate-resistant acid phosphatase staining, is used to detect osteoclasts in bone and osteocytes. It makes osteoclasts appear red and the nuclei appear light blue, thus showing the distribution and number of osteoclasts.

[0032] CGRP: Calcitonin gene-related peptide, an effective vasodilator-related molecule that can induce pain sensitization and can serve as an indicator of nociceptive sensory nerve innervation.

[0033] The sequence of miR-143-3p (SEQ ID NO.1): ugagaugaagcacuguagcuca AgomiR is equivalent to miR-143-3p agomir, sequence: Sense (SEQ ID NO.3): 5'-ugagaugaagcacuguagcuca-3' Anti-sense (SEQ ID NO.4): 5'-agcuacagugcuucaucucauu-3' miR-143-3p mimics sequence (SEQ ID NO.2): 5'-ugagaugaagcacuguagcuca-3' miR-143-3p inhibitors sequence: 5'-ugagcuacagugcuucaucuca-3' MUT-Mfsd8 plasmid vector FR02, sequence: cactaacttatgtttctaatagcaagtggattcttaaaattactatttttcaagttctttaaactctagtgcaaactctgacctttgaatgccccttgtcagtaatgacagagaagaatagcagtttgcaacctacctgtagacccagtcacagcagcagagctgaagttggaccatgattgctctcgggcagtctcatctcatcaggtgagacttgaagcagaatggccaaaggtgactactgatcaaactagtttctacctctgtgtgaatggaacactggtatgtgtacgggaatctgtaaaacatgcagaagtgctttcctgtcttgttatcatggtttcaaatctgagtgtgaacataatattctccacctcatactctggtctgctgaagctattagcaccacgtgatggcagcattttgcttcagtttgttttgtcatgccctggacgtcctcttgtcctcttacctgctgttc WT-Mfsd8 plasmid vector FR02, sequence: cactaacttatgtttctaatagcaagtggattcttaaaattactatttttcaagttctttaaactctagtgcaaactctgacctttgaatgccccttgtca gtaatgacagagaagaatagcagtttgcaacctacctgtagacccagtcacagcagcagagctgaagttggaccatgattgctctcggtcaggtgagacttgaagcagaatggccaaaggtg actactgatcaaactagtttctacctctgtgtgaatggaacactggtatgtgtacgggaatctgtaaaaacatgcagaagtgctttcctgtcttgttatcatggtttcaaatctgagtgtgaa cataatattctccacctcatactctggtctgctgaagctattagcaccacgtgatggcagcattttgcttcagtttgttttgtcatgccctggacgtcctcttgtcctcttacctgctgttc Example 1: miR-143-3p can alleviate the degeneration of cartilage tissue in temporomandibular joint osteoarthritis and inhibit ferroptosis in chondrocytes.

[0034] I. Experimental Methods in Animal Experiments (a) Laboratory animals Eight-week-old female C57BL / 6J mice were used in the experiment. All animals were housed at the West China Animal Experiment Center of Sichuan University and were raised according to SPF standards.

[0035] (II) Experimental Methods 1. Surgical modeling At 9 weeks of age, a unilateral anterior crossbite (UAC) model was constructed in mice under general anesthesia to induce TMJOA formation and build an experimental TMJOA model mouse.

[0036] 2. Experimental grouping and intervention methods Mice were randomly divided into three groups: 1) Negative control group (NC group): An equal volume of AgomiR-NC was injected into the temporomandibular joint (TMJ) cavity at a dose of 20 μM; 2) TMJOA group: TMJOA model mice were injected intra-articularly with an equal volume of AgomiR-NC, 20 μM. 3) TMJOA+Agomir group: TMJOA model mice were treated with intra-articular injection of AgomiR-143-3p at a dose of 20 μM.

[0037] (III) Results Evaluation Methods 1. Histological assessment of cartilage destruction in osteoarthritis Tissue processing method 1: Three weeks after modeling induction, each experimental group began intra-articular injection of different interventions TMJ every three days. The mice were sacrificed at 6 weeks, and the temporomandibular joint tissues were collected, fixed with 4% paraformaldehyde for 48 hours, decalcified with 10% EDTA for one month, dewaxed and embedded, sectioned, and 4 μm thick.

[0038] The sections were stained with Safranin O and Fast Green, observed under a microscope, and photographed for analysis. The severity of cartilage damage in osteoarthritis was evaluated according to the Osteoarthritis Research International (OARSI) scoring system.

[0039] The scoring details are as follows: 0 points: Normal cartilage; 0.5 points: Slightly reduced Safranin O staining, no change in cartilage tissue; 1 point: A small portion of the cartilage surface is fibrotic, but there is no cartilage defect; 2 points: Longitudinal cracks appear on the surface of the cartilage tissue; 3-6 points: Cracks or defects in cartilage tissue extend to the calcified cartilage layer, and the defect area accounts for <25% (3 points), 25-50% (4 points), 50-75% (5 points), and >75% (6 points) of the cartilage surface area.

[0040] 2. Immunofluorescence staining was used to assess changes in cartilage-related proteins in each group. The tissues were processed in the same way as in tissue processing method 1 above. The sections of each experimental group were stained with type II collagen α1 (COL2A1), glutathione peroxidase 4 (GPX4), and Mfsd8 immunofluorescence staining and statistical analysis were performed.

[0041] II. Experimental Methods for Cell Experiments (a) Cell grouping and treatment This invention uses primary cartilage cells from the temporomandibular joint. The primary cartilage cells are obtained from the temporomandibular joint of 7-day-old newborn experimental animals and are digested and cultured in low-glucose DMEM medium containing 10% fetal bovine serum and double antibiotics (penicillin 50U / mg, streptomycin 50U / ml). The culture is then placed in a CO2 incubator (37℃, 5% CO2, 21% O2, 95% humidity).

[0042] 1. To investigate the regulatory effect of miR-143-3p on ferroptosis in chondrocytes during osteoarthritis, cultured chondrocytes were randomly divided into three groups for intervention: 1) miR-NC group: intervention with mimics NC, mimics NC, dosage 20nM; 2) miR-NC+IL-1β group: IL-1β was added for intervention, IL-1β dosage 10ng / ml; mimics NC dosage 20nM; 3) IL-1β + miR-143-3p mimics group: Simultaneous addition of IL-1β and miR-143-3p mimics Interventions were administered with IL-1β at a dose of 10 ng / ml and miR-143-3p mimics at a dose of 20 nM.

[0043] 2. To investigate the effects of miR-143-3p on the mRNA and protein levels of its downstream target gene Mfsd8, cultured chondrocytes were randomly divided into the following intervention groups: Intervention 1: 1) miR-NC group: intervention with mimics NC, mimics NC, dosage 20nM; 2) miR-NC+IL-1β group: IL-1β was added for intervention, with an IL-1β dosage of 10 ng / ml; mimics NC was used at a dosage of 20 nM; 3) IL-1β + miR-143-3p mimics group: Simultaneous addition of IL-1β and miR-143-3p mimics Interventions were administered with IL-1β at a dose of 10 ng / ml and miR-143-3p mimics at a dose of 20 nM.

[0044] Intervention 2: 1) miR-NC group: intervention with inhibitors NC, 20 nM; 2) miR-NC+IL-1β group: IL-1β was added for intervention, IL-1β dosage 10ng / ml; inhibitors NC dosage 20nM; 3) IL-1β + miR-143-3p inhibitors group: IL-1β and miR-143-3p inhibitors were added simultaneously for intervention. IL-1β was used at a dose of 10 ng / ml; miR-143-3p inhibitors were used at a dose of 20 nM.

[0045] 3. To verify that miR-143-3p has a binding site for the target gene Mfsd8, the HEK293 cell line was randomly divided into the following intervention groups: Intervention 1: 1) miR-NC+WT-Mfsd8 group: intervention was performed by adding mimics NC and WT-Mfsd8 plasmids. mimics NC was used at a dosage of 20 nM; WT-Mfsd8 plasmid was used at a dosage of 50 nM. 2) miR-143-3p mimics + WT-Mfsd8 group: intervention was performed by adding miR-143-3p mimics and WT-Mfsd8 plasmid. The amount of miR-143-3p mimics was 20 nM; the amount of WT-Mfsd8 plasmid was 50 nM. 3) miR-NC+MUT-Mfsd8 group: intervention was performed by adding mimics NC and MUT-Mfsd8 plasmid. mimics NC was used at a concentration of 20 nM; MUT-Mfsd8 plasmid was used at a concentration of 50 nM. 4) miR-143-3p mimics + MUT-Mfsd8 group: intervention was performed by adding miR-143-3p mimics and MUT-Mfsd8 plasmid. The amount of miR-143-3p mimics was 20 nM; the amount of MUT-Mfsd8 plasmid was 50 nM. Intervention 2: 1) miR-NC+WT-Mfsd8 group: intervention was performed by adding inhibitors NC and WT-Mfsd8 plasmid. Inhibitors NC was used at a concentration of 20 nM; WT-Mfsd8 plasmid was used at a concentration of 50 nM. 2) miR-143-3p inhibitors + WT-Mfsd8 group: miR-143-3p inhibitors and WT-Mfsd8 plasmid were added for intervention. miR-143-3p inhibitors were used at a dose of 20 nM; WT-Mfsd8 plasmid was used at a dose of 50 nM. 3) miR-NC+MUT-Mfsd8 group: Inhibitors NC and MUT-Mfsd8 plasmid were added for intervention. Inhibitors NC was used at a concentration of 20 nM; MUT-Mfsd8 plasmid was used at a concentration of 50 nM. 4) miR-143-3p inhibitors + MUT-Mfsd8 group: miR-143-3p inhibitors and MUT-Mfsd8 plasmid were added for intervention. miR-143-3p inhibitors were used at a dose of 20 nM; MUT-Mfsd8 plasmid was used at a dose of 50 nM. 4. To investigate the effect of miR-143-3p on ferroptosis of chondrocytes in osteoarthritis by regulating Mfsd8 expression, cultured chondrocytes were randomly divided into the following groups: 1) NC group: intervention with inhibitors NC and Si-NC, with NC inhibitors at a dosage of 20 nM and Si-NC at a dosage of 20 nM; 2) NC+IL-1β group: Intervention was performed by adding IL-1β, inhibitors NC, and Si-NC. IL-1β was used at a dose of 10 ng / ml; inhibitors NC was used at a dose of 20 nM; and Si-NC was used at a dose of 20 nM. 3) IL-1β + miR-143-3p inhibitors group: IL-1β, miR-143-3p inhibitors and Si-NC were added simultaneously for intervention. IL-1β was 10 ng / ml; miR-143-3p inhibitors were 20 nM; and Si-NC was 20 nM.

[0046] 4) IL-1β + miR-143-3p inhibitors + Si group: IL-1β, miR-143-3p inhibitors and Si-Mfsd8 were added simultaneously for intervention. IL-1β was 10 ng / ml; miR-143-3p inhibitors were 20 nM; and Si-Mfsd8 was 20 nM.

[0047] (II) Results Evaluation Methods 1. To detect changes in ferroptosis in chondrocytes during osteoarthritis and the regulatory effect of miR-143-3p, chondrocytes were treated with intervention for 48 hours before cell viability assays (CCK8), lipid reactive oxygen species (lipid ROS), and MDA were performed.

[0048] 2. To investigate the effect of miR-143-3p on Msfd8 expression during osteoarthritis, mRNA and protein were extracted from chondrocytes after 48 hours of intervention treatment, and the expression changes of Msfd8 were detected by qPCR and Western blot, respectively.

[0049] 3. To verify that Mfsd8 is the target gene of miR-143-3p in inhibiting ferroptosis in chondrocytes during osteoarthritis, the effect of miR-143-3p on Mfsd8 was confirmed using a dual-luciferase reporter gene assay. CCK8, lipid ROS, and MDA were measured 48 hours after intervention in chondrocytes.

[0050] II. Experimental Results (a) Histological assessment of cartilage destruction in osteoarthritis 1. For example Figure 1 As shown in Figure A, the results under a stereomicroscope of the articular discs showed that the articular discs in the NC group were intact and had no congestion or perforation on the surface; the articular discs in the TMJOA group showed obvious congestion and rough surface; the wear and congestion on the surface of the articular discs in the TMJOA+Agomir group were relatively alleviated compared with the TMJOA group.

[0051] 2. For example Figure 1 As shown in Figure B, Safranin O and Fast Green staining results showed that the cartilage surface in the NC group was smooth and intact, with no obvious wear or cracks; in the TMJOA group, the cartilage layer was significantly thinned, with partial cartilage peeling and cracks penetrating the entire cartilage layer; the TMJOA+Agomir group showed fewer cracks and peeling in the cartilage than the TMJOA group, with a smaller range and milder degree. OARSI score statistics showed that there was a statistically significant difference between the TMJOA group and the TMJOA+Agomir group (p < 0.05). AgomiR-143-3p can effectively alleviate the surface wear and congestion of the TMJOA articular disc.

[0052] (II) Immunofluorescence staining to assess changes in cartilage-related proteins in each group like Figure 1 As shown in Figure B, COL2A immunofluorescence staining revealed a higher COL2A positivity rate in chondrocytes in the NC group, a significantly decreased COL2A positivity rate in the TMJOA group, and a significantly higher COL2A positivity rate in the TMJOA+Agomir group compared to the TMJOA group (p < 0.05). These results indicate that miR-143-3p can significantly increase the content of type II collagen in cartilage and alleviate the degeneration of condylar cartilage in temporomandibular joint osteoarthritis.

[0053] (III) The regulatory role of miR-143-3p on ferroptosis in condylar chondrocytes during osteoarthritis 1. For example Figure 2 As shown in Figure A, GPX4 immunofluorescence staining revealed a higher GPX4 positivity rate in chondrocytes in the NC group, a significantly lower GPX4 positivity rate in the TMJOA group, and a significantly higher GPX4 positivity rate in the TMJOA+Agomir group compared to the TMJOA group (p < 0.05). This indicates that miR-143-3p plays a regulatory role in condylar chondrocyte ferroptosis.

[0054] 2. CCK8 assay was used to assess the cell viability of each group of chondrocytes after intervention. For example... Figure 2 As shown in B, IL-1β significantly reduced the cell activity of chondrocytes, while miR-143-3p could reverse the effect of IL-1β, and the difference was statistically significant (p < 0.05).

[0055] 3. The changes in ferroptosis-related indicators in each group after chondrocyte intervention were detected using an MDA assay kit. For example... Figure 2 As shown in C, IL-1β induces ferroptosis and upregulates MDA concentration in chondrocytes, while miR-143-3p can reverse the effect of IL-1β and significantly reduce MDA concentration, with statistically significant differences (p < 0.05).

[0056] 4. The changes in ROS levels in each group after chondrocyte intervention were detected using a ROS detection kit. For example... Figure 2 As shown in Figure D, IL-1β significantly upregulated ROS levels in chondrocytes, while miR-143-3p could reverse the effects of IL-1β and significantly reduce ROS levels, with statistically significant differences (p < 0.05).

[0057] (iv) The effect of miR-143-3p on chondrocyte ferroptosis in osteoarthritis by regulating the target gene Mfsd8 1. For example Figure 3 As shown in Figure A, Mfsd8 immunofluorescence staining revealed that the Mfsd8 positivity rate of chondrocytes was low in the NC group, significantly increased in the TMJOA group, and decreased in the TMJOA+Agomir group compared to the TMJOA group. The differences were statistically significant (p < 0.05). The higher the Mfsd8 positivity rate, the more severe the TMJOA.

[0058] 2. Changes in Mfsd8 transcription levels in chondrocytes of different groups after intervention were detected using qPCR. For example... Figure 3 As shown in B and C, IL-1β can increase the transcriptional expression of Mfsd8, while miR-143-3p mimics can reverse the effect of IL-1β and significantly reduce Mfsd8 expression. Furthermore, miR-143-3p inhibitors can further promote the IL-1β-induced increase in Mfsd8 expression, with statistically significant differences (p < 0.05).

[0059] 3. Western blot analysis was used to detect changes in Mfsd8 protein levels in chondrocytes after intervention. For example... Figure 3 As shown in D and E, IL-1β can increase the expression level of Mfsd8 protein, and miR-143-3p mimics can reverse the effect of IL-1β and significantly reduce Mfsd8 expression. Furthermore, miR-143-3p inhibitors can further promote the increase in IL-1β-induced Mfsd8 expression, and the difference is statistically significant (p < 0.05).

[0060] 4. For example Figure 3As shown in Figure F, miR-143-3p and Mfsd8 have a potential binding site. The effect of miR-143-3p on Mfsd8 was verified using a dual-luciferase reporter gene assay. Figure 3 As shown in G and H, miR-143-3p mimics significantly reduced Mfsd8 expression, but this effect disappeared when the binding site on Mfsd8 was mutated; miR-143-3p inhibitors significantly increased Mfsd8 expression, but this effect disappeared when the binding site on Mfsd8 was mutated, and the difference was statistically significant (p < 0.05).

[0061] 5. CCK8 assay was used to assess the cell activity of each group of chondrocytes after intervention. For example... Figure 3 As shown in Figure I, both IL-1β and miR-143-3p inhibitors significantly reduced chondrocyte cell activity; after knockdown of Mfsd8, the effect of miR-143-3p inhibitors in reducing chondrocyte activity was reversed, and the difference was statistically significant (p < 0.05).

[0062] 6. The changes in ferroptosis-related indicators in each group after chondrocyte intervention were detected using an MDA assay kit. For example... Figure 3 As shown in Figure J, IL-1β induces ferroptosis, and miR-143-3p inhibitors can further promote the increase of IL-1β-induced MDA concentration in chondrocytes; after knockdown of Mfsd8, the effect of miR-143-3p inhibitors in inducing ferroptosis in chondrocytes was reversed, and the MDA concentration was significantly reduced, with statistical significance (p < 0.05).

[0063] 7. The changes in ROS levels in each group after chondrocyte intervention were detected using a ROS detection kit. For example... Figure 3 As shown in K, IL-1β significantly upregulated ROS levels in chondrocytes, and miR-143-3p inhibitors could further promote the upregulation of IL-1β-induced ROS levels in chondrocytes; after knockdown of Mfsd8, the upregulation of ROS levels induced by miR-143-3p inhibitors was reversed, and ROS levels were significantly reduced, with statistically significant differences (p < 0.05).

[0064] The above results indicate that in TMJOA model mouse animal experiments, increasing the expression level of miR-143-3p in the body by administering AgomiR-143-3p can effectively alleviate the surface wear and congestion of the TMJOA articular disc, significantly increase the content of type II collagen in cartilage, alleviate the degeneration of cartilage tissue in temporomandibular joint osteoarthritis, and treat temporomandibular joint osteoarthritis. Cell experiments further verified that miR-143-3p can effectively improve chondrocyte activity and reduce chondrocyte ferroptosis.

[0065] Example 2: Verification that miR-143-3p can inhibit subchondral bone resorption and alleviate joint pain in the temporomandibular joint osteoarthritis area. I. Experiments and Methods (a) Laboratory animals Eight-week-old female C57BL / 6J mice were used in the experiment. All animals were housed at the West China Animal Experiment Center of Sichuan University and were raised according to SPF standards.

[0066] (II) Experimental Methods 1. Surgical modeling At 9 weeks of age, a unilateral anterior crossbite (UAC) model was constructed in mice under general anesthesia to induce TMJOA formation and build an experimental TMJOA model mouse.

[0067] 2. Experimental grouping and intervention methods Mice were randomly divided into three groups: 1) Negative control group (NC group): Intervention was performed by intra-articular injection of an equal volume of AgomiR-NC in TMJ, at a dose of 20 μM; 2) TMJOA group: TMJOA model mice were treated by intra-articular injection of an equal amount of AgomiR-NC (20 μM) into the TMJ joint cavity; 3) TMJOA+Agomir group: The TMJOA model was constructed by UAC, and AgomiR-143-3p was injected into the joint cavity of the TMJ for intervention, with a dosage of 20μM.

[0068] (III) Results Evaluation Methods 1. Behavioral assessment of the impact of miR-143-3p on pain associated with temporomandibular joint osteoarthritis. Pain threshold testing (Vonfry test) was performed weekly after modeling.

[0069] 2. Imaging assessment of changes in subchondral bone mineral density in each group. Quantitative analysis of bone quality was performed by reconstructing and analyzing the morphology and surface bone changes of each group of condyles using X-ray microscopy (Micro-CT), and by measuring bone volume / total volume, trabecular thickness, and trabecular separation.

[0070] 3. Histological assessment of subchondral bone resorption in osteoarthritis. Three weeks after modeling induction, each experimental group began intra-articular injection of different interventions TMJ every three days. The mice were sacrificed at 6 weeks, and temporomandibular joint tissues were collected, fixed with 4% paraformaldehyde for 48 hours, decalcified with 10% EDTA for one month, dewaxed and embedded, sectioned, and sectioned to a thickness of 4 μm. The sections from each group were stained with TRAP and the results were statistically analyzed.

[0071] 4. Histological evaluation of calcitonin gene-related peptide (CGRP) expression in osteoarthritis cartilage. Three weeks after modeling induction, each experimental group began intra-articular injection of different interventions of TMJ every three days. The mice were sacrificed at 6 weeks, and the temporomandibular joint tissues were collected, fixed with 4% paraformaldehyde for 48 hours, decalcified with 10% EDTA for two and a half months, dewaxed and embedded, sectioned, and sectioned to a thickness of 4 μm. The sections of each group were stained with CGRP immunofluorescence and the results were statistically analyzed.

[0072] II. Experimental Results (a) Behavioral assessment of changes in joint pain threshold in each group like Figure 4 As shown in Figure A, the Vonfry pain threshold results indicate that the pain threshold of mice in the NC group increased with age during the first 14 days after the start of the study, and then remained relatively stable. The pain thresholds of the TMJOA group and the TMJOA+Agomir group were comparable to those of the NC group at the start of the study, but the pain thresholds did not increase with age during the first 14 days. After modeling, the pain threshold of the TMJOA group showed a downward fluctuation, and the decrease was significant. After modeling, the pain threshold of the TMJOA+Agomir group showed a slight decrease, but was still significantly higher than that of the TMJOA group.

[0073] (II) Imaging assessment of subchondral bone changes in each group like Figure 4 As shown in Figure B, Micro-CT three-dimensional reconstruction and analysis revealed that the subchondral bone mineral density was significantly decreased in the TMJOA group, while the subchondral bone mineral density was significantly increased in the TMJOA+Agomir group compared to the TMJOA group, with statistically significant differences (p < 0.05).

[0074] (III) Histological evaluation of subchondral bone osteoclast activity and CGRP expression changes in each group 1. For example Figure 5 As shown in Figure A, TRAP staining revealed that the positive rate of TRAP in the subchondral bone was low in the NC group, significantly increased in the TMJOA group, and significantly lower in the TMJOA+Agomir group compared to the TMJOA group (p < 0.05).

[0075] 2. For example Figure 5 As shown in Figure B, CGRP immunofluorescence staining revealed that the CGRP positivity rate in the subchondral bone was low in the NC group, significantly increased in the TMJOA group, and significantly lower in the CGRP positivity rate in the subchondral bone of the TMJOA+Agomir group compared to the TMJOA group (p < 0.05).

[0076] The above results indicate that miR-143-3p can alleviate joint pain, increase cartilage bone density, and relieve osteoarthritis by inhibiting subchondral bone resorption.

[0077] In summary, this invention, by administering AgomiR-143-3p or miR-143-3p mimics, enhances the expression level of miR-143-3p, effectively alleviates surface wear and congestion of the TMJOA articular disc, significantly increases the content of type II collagen in cartilage, alleviates the degeneration of cartilage tissue in temporomandibular joint osteoarthritis, reduces joint pain, increases cartilage bone density, and treats temporomandibular joint osteoarthritis.

Claims

1. The use of a substance that increases miR-143-3p expression levels in the preparation of a drug for treating temporomandibular joint osteoarthritis, characterized in that, The substance that enhances the expression level of miR-143-3p is miR-143-3p; the nucleotide sequence of miR-143-3p is shown in SEQ ID NO.

1.

2. The use of a substance that increases miR-143-3p expression levels in the preparation of a drug for treating temporomandibular joint osteoarthritis, characterized in that, The substance that enhances the expression level of miR-143-3p is miR-143-3p agomir, which consists of a forward sequence and a reverse sequence. The nucleotide sequences of the forward and reverse sequences are shown in SEQ ID NO.3 and SEQ ID NO.4, respectively.

Images