Application of tmem187 knockout zebrafish in constructing animal models of hyperlipidemia

Abstract

The present invention discloses the application of tmem187 knockout zebrafish in constructing an animal model of hyperlipidemia. Tmem187 knockout zebrafish can spontaneously develop hyperlipidemia with high stability. The hyperlipidemia animal model constructed based on tmem187 knockout zebrafish has the advantages of stable and rapid screening of new lipid-lowering drugs, and can provide a tool for large-scale drug screening for the treatment of hyperlipidemia.

Description

Technical Field

[0001] The invention belongs to the technical field of animal models, and particularly relates to an application of a tmem187 knockout zebrafish in constructing an animal model of hyperlipidemia. Background Art

[0002] Hyperlipidemia is a chronic disease of lipid metabolism disorder, which is mainly manifested in the imbalance of blood lipid levels, including the increase of low-density lipoprotein cholesterol (LDL-C) or the decrease of high-density lipoprotein cholesterol (HDL-C) in the blood. Other forms of hyperlipidemia include hypertriglyceridemia and mixed hyperlipidemia (elevated cholesterol and triglyceride levels).

[0003] A large number of epidemiological surveys and studies have shown that hyperlipidemia is a major risk factor for cardiovascular diseases such as atherosclerosis and coronary heart disease. Hyperlipidemia can also lead to fatty liver, cirrhosis, pancreatitis, peripheral vascular disease, and hyperuricemia. Lipid-lowering drugs can reduce the incidence and mortality of some diseases, but existing lipid-lowering drugs have problems such as poor efficacy or large toxic side effects, so it is very necessary to develop new lipid-lowering drugs.

[0004] The establishment of hyperlipidemia models provides an important tool for the prevention, treatment and pathogenesis of related diseases. At present, there are many methods for establishing hyperlipidemia models at home and abroad. Usually, mice, rabbits, chickens, pigs, etc. are selected and high-fat feeds such as cholesterol, sodium cholate, egg yolk powder, etc. are used to feed animals. Although these modeling methods have good effects, these animals have a long growth cycle, a long modeling time, and high costs, so they are not suitable for high-throughput rapid screening of drugs.

[0005] Zebrafish is a new model organism that has emerged in recent decades. It is highly homologous to the human genome. Zebrafish larvae are transparent throughout, suitable for staining with various lipid dyes, and easy to observe differences in lipid levels in blood vessels. At the same time, it is small in size, has a high egg production, develops rapidly, and is suitable for in vivo and large-scale drug screening experiments, which saves costs and shortens the experimental cycle. However, there are large individual differences in wild-type zebrafish when constructing a high-fat model, and the stability is low. Therefore, a zebrafish model that can stabilize spontaneous hyperlipidemia has better application prospects. Summary of the invention

[0006] In response to the above-mentioned problems in the prior art, the applicant discovered in the study that tmem187 knockout zebrafish can spontaneously develop hyperlipidemia with high stability. Therefore, the hyperlipidemia animal model constructed based on tmem187 knockout zebrafish has the advantages of stable and rapid screening of new lipid-lowering drugs, and can provide a large-scale drug screening tool for the treatment of hyperlipidemia.

[0007] To achieve the above object, the present invention adopts the following technical solution:

[0008] Tmem187 knockout zebrafish were used to construct an animal model of hyperlipidemia. Tmem187 knockout zebrafish can spontaneously develop hyperlipidemia.

[0009] Preferably, the tmem187 knockout zebrafish is homozygous.

[0010] Preferably, the tmem187 knockout zebrafish is over 5 dpf (5 days after fertilization).

[0011] More preferably, the tmem187 knockout zebrafish is over 6 dpf. Tmem187 knockout zebrafish over 6 dpf have better stability and can better meet the requirements of drug screening experiments for animal models.

[0012] More preferably, the animal model is constructed by the following method:

[0013] Tmem187 knockout zebrafish were selected, moved to culture water, and fed with high-fat food, and the animal model was obtained after 24 hours. The high-fat diet can significantly increase the blood lipid level of the animal model, making it easier to observe the efficacy of lipid-lowering drugs.

[0014] Preferably, the high-fat food is egg yolk. Preferably, the final concentration of the high-fat food in the aquaculture water is 0.01-0.5% (mass to volume ratio, unit is g / mL).

[0015] The present invention further provides application of the animal model constructed by the above method.

[0016] The beneficial effects of the present invention are:

[0017] Tmem187 knockout zebrafish can spontaneously develop hyperlipidemia with an early course and high stability, providing a tool for large-scale rapid drug screening for the treatment of hyperlipidemia. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 This is the gene sequencing verification result of the tmem187 purified zebrafish knockout mutant in the example.

[0019] Figure 2 This is a comparison of the overall oil red staining of the wild-type (WT) and tmem187 knockout (tmem187 mut) zebrafish 7 days after fertilization in Example 2.

[0020] Figure 3 This is a comparison of the oil red staining of the liver of wild-type (WT) and tmem187 knockout (tmem187 mut) zebrafish in Example 3.

[0021] Figure 4This is a comparison of the oil red staining of wild-type and tmem187 knockout zebrafish after high-fat diet in Example 4.

[0022] Figure 5 This is a comparison of Nile red staining of wild-type and tmem187 knockout zebrafish after application of lipid-lowering drugs in Example 5. DETAILED DESCRIPTION

[0023] Example 1

[0024] This example illustrates the screening and identification of homozygous tmem187 knockout zebrafish:

[0025] (1) Obtaining zebrafish embryos:

[0026] Select heterozygous zebrafish with tmem187 mutation (tmem187 + / - ) (purchased from the National Zebrafish Resource Center), placed in a breeding tank the night before for breeding, and removed the isolation plate the next morning to wait for the zebrafish to mate. After about 1-2 hours, embryos (F1 generation) were obtained and transferred to breeding water. The F1 generation zebrafish were cultured to 2 months of age (the tail fin could be cut for tail-by-tail identification), and the F1 generation with successful knockout of the target gene was identified and the knockout genotype was characterized.

[0027] (2) Zebrafish genotype identification:

[0028] The tail fin was cut and the genomic DNA was extracted as template DNA. The polymerase chain reaction (PCR) was performed using the detection primers. The detection primer sequences are as follows:

[0029] tmem187-F: CCTTTCCTGCTTTGCATGC;

[0030] tmem187-R:GACTCCACCATTAAAGCATAGC;

[0031] The total volume of the reaction system was 30 μL: including 2x Master Mix (15 μL) + Forward Primer (1 μL) + Reverse Primer (1 μL) + DNA template (1 μL) + ddH2O (12 μL). PCR reaction conditions: 96°C 3 min, 30× (96°C 30 s, 56°C 30 s, 72°C 30 s), 72°C 10 min, 4°C.

[0032] Sequencing of amplified products: The above PCR products were sent to a sequencing company for sequencing, and the sequencing primer was tmem187-R. Figure 1 is the sequencing result.

[0033] The results showed that tmem187 homozygous mutant zebrafish were successfully obtained.

[0034] Example 2

[0035] This example shows that tmem187 knockout zebrafish can spontaneously develop hyperlipidemia:

[0036] (1) Obtaining zebrafish embryos:

[0037] Wild-type zebrafish (wildtype), tmem187 knockout zebrafish (tmem187 - / - ) (the tmem187 homozygous mutant zebrafish prepared in Example 1) were placed in a breeding tank the night before for breeding, and the isolation plate was removed the next morning to wait for the zebrafish to mate. After about 1-2 hours, embryos were obtained and transferred to breeding water.

[0038] (2) Zebrafish selection:

[0039] Select wild-type zebrafish and tmem187 knockout zebrafish larvae 6 to 7 days after fertilization, transfer them to 6-well plates, and place appropriate numbers of zebrafish according to the area of ​​the well plates;

[0040] (3) Oil red staining of zebrafish:

[0041] After anesthesia, zebrafish were transferred to 4% paraformaldehyde and fixed at 4°C for 12 hours. The zebrafish samples were removed from the paraformaldehyde, washed three times with PBS, and then soaked in 60% isopropanol for 30 minutes. The zebrafish were then placed in freshly filtered oil red staining solution and stained for 2 to 4 hours. The stained zebrafish larvae were placed in 60% isopropanol again and slowly washed on a decolorizing shaker for 2 minutes to wash away the dye adhering to the zebrafish body surface. After rinsing with PBS, the samples were examined under a stereomicroscope. The lipid content in the blood was analyzed.

[0042] The results showed that the lipid content in the blood of zebrafish larvae 7 days after fertilization was significantly higher than that of wild-type zebrafish ( Figure 2 ).

[0043] Example 3

[0044] This example shows that the liver lipid levels of tmem187 knockout zebrafish are significantly higher than those of wild type:

[0045] Oil Red O staining of zebrafish liver tissue:

[0046] Six-month-old wild-type zebrafish and tmem187 knockout zebrafish were selected, anesthetized in ice water, and blood was collected by tail cutting. Plasma was collected by centrifugation for the detection of cholesterol and triglycerides in the blood. After blood collection, the zebrafish were fixed in paraformaldehyde for 12 hours, and then zebrafish liver tissue was collected and ice-cut. The slices were fixed in 4% paraformaldehyde for 5 minutes, washed with distilled water; washed with 60% isopropanol; stained with 60% Oil Red O for 10-15 minutes; separated with 60% isopropanol; washed with distilled water; counterstained with hematoxylin; washed with tap water for 1-3 minutes for blueing; washed with distilled water; sealed with glycerol, and observed and photographed.

[0047] The results showed that the lipid content in the liver of tmem187 knockout zebrafish was significantly higher than that in wild-type ( Figure 3 ).

[0048] Example 4

[0049] This example shows that under high-fat diet conditions, tmem187 - / - Zebrafish have higher levels of lipids in their blood:

[0050] (1) Zebrafish selection and processing:

[0051] The larvae of wild-type zebrafish and tmem187 knockout zebrafish at 6-7 days after fertilization were selected and transferred to 6-well plates respectively, and an appropriate number of zebrafish were placed according to the area of ​​the well plates; the wild-type zebrafish and tmem187 knockout zebrafish were fed with an egg yolk solution with a final concentration of 0.1% g / mL, the egg yolk was removed after 4 hours, the culture water was replaced, and zebrafish oil red staining was performed 18 hours later.

[0052] (2) Oil red staining of zebrafish:

[0053] After anesthesia, zebrafish were transferred to 4% paraformaldehyde and fixed at 4°C for 12h. The zebrafish samples were removed from the paraformaldehyde, washed three times with PBS, and then soaked in 60% isopropanol for 30min. The zebrafish were then placed in freshly filtered oil red staining solution and stained for 2-4h. The stained zebrafish larvae were placed in 60% isopropanol again and slowly washed on a decolorizing shaker for 2min to wash away the dye adhering to the zebrafish body surface. After rinsing with PBS, the samples were examined under a stereomicroscope. The lipid content in the blood was analyzed.

[0054] The results showed that after 7 days of high-fat diet, the lipid content in the blood of tmem187 knockout zebrafish was significantly higher than that of wild-type ( Figure 4 ).

[0055] Example 5

[0056] Application of tmem187 knockout zebrafish as an animal model for evaluation and screening of lipid-lowering drugs.

[0057] (1) Zebrafish selection:

[0058] Select wild-type zebrafish and tmem187 knockout zebrafish larvae 5 days after fertilization, transfer them to 6-well plates, and place appropriate numbers of zebrafish according to the area of ​​the well plates;

[0059] (2) Drug treatment and grouping:

[0060] Wild-type zebrafish and tmem187 knockout zebrafish were set up in two groups: a drug solvent control group and a lipid-lowering drug (atorvastatin) treatment group.

[0061] (3) Zebrafish Nile red staining and analysis:

[0062] Prepare 1mM Nile Red stock solution with dimethyl sulfoxide (DMSO) and store at -20℃ in the dark. Prepare 1μM Nile Red working solution with distilled water, add Nile Red working solution to the container containing zebrafish, incubate the fry in the dark for 60min, and then wash in distilled water for 3min. Then observe the lipids of the zebrafish fry under a fluorescence microscope (strong orange-yellow) and take pictures.

[0063] The results showed that lipid-lowering drugs can significantly improve hyperlipidemia in tmem187 knockout zebrafish ( Figure 5 ), it can be seen that the animal model constructed by the present invention can be used for drug screening.

Claims

1. A use tmem187 The method for constructing a hyperlipidemia animal model by knocking out zebrafish is characterized in that: Select tmem187 The knockout zebrafish were moved to culture water and fed with high-fat food, and the animal model was obtained after 24 hours; Said tmem187 Knockout zebrafish are homozygous.

2. The method according to claim 1, characterized in that Said tmem187 Knockout zebrafish were aged 5 dpf or older.

3. The method according to claim 2, characterized in that Said tmem187 Knockout zebrafish were aged 6 dpf or above.

4. The method according to claim 1, characterized in that: The high-fat food is egg yolk.

5. The method according to claim 1, characterized in that The final concentration of the high-fat food in the aquaculture water is 0.01-0.5% g / mL.

6. Use of the animal model obtained by the method according to any one of claims 1 to 5.

Images