A method of nucleic acid synthesis
By linking phosphoramidite group linkers to solid-phase supports via phosphoramidite trimerization, the problem of long coupling time for nucleic acid synthesis vectors has been solved, enabling efficient multi-sequence synthesis and high-throughput nucleic acid synthesis, while reducing costs and improving stability.
Patent Information
- Application Number
- CN202311293612.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-10-08
- Publication Date
- 2026-08-25
- Estimated Expiration
- 2043-10-08
AI Technical Summary
Existing nucleic acid synthesis methods involve long vector coupling times, resulting in extended production times. Furthermore, high-throughput synthesis strategies suffer from physical limitations, making it difficult to effectively increase synthesis throughput and reduce costs.
By using phosphoramidite linkers and solid-phase supports via the phosphoramidite-triester method, coupling time is shortened. Furthermore, phosphoramidite-triester method is used to link base monomers during nucleic acid synthesis, enabling the synthesis of multiple sequences. This integrates the steps of linker and solid-phase support, improving synthesis throughput and sequence diversity.
It reduces the production cycle and cost of nucleic acid synthesis vectors, increases synthesis throughput and sequence diversity, and enhances the stability of synthesis vectors, especially in chip synthesis, reducing surface modification time and increasing synthesis throughput.
Smart Images

Figure CN117362371B_ABST
Abstract
Description
Technical Field
[0001] This application relates to the field of nucleic acid synthesis, specifically to a method for nucleic acid synthesis. Background Technology
[0002] Traditional column-based nucleic acid synthesis primarily uses controlled porous glass (CPG) and polystyrene (PS) as solid-phase supports. Both CPG and PS supports require prior functionalization to enrich their surface with hydroxyl or amino groups. They are then reacted with a linker containing DMT protecting groups to cleave nucleic acid molecules from the solid support, forming the final commercially available nucleic acid synthesis carrier. However, the coupling time between the linker and the amino / hydroxylated CPG or PS carrier is lengthy (typically 6-24 hours), resulting in a prolonged production time. Furthermore, chip-based nucleic acid synthesis using chips as solid-phase supports also requires prior functionalization of the chip support to enrich its surface with hydroxyl or amino groups before reacting with the linker. The nucleic acid sequence is then synthesized via a phosphoramidite-triester method. Current technologies require a significant time for the linker to be coupled to the chip support.
[0003] Furthermore, high-throughput nucleic acid synthesis has revolutionary implications for fields such as biotechnology, synthetic biology, drug development, and agriculture. For example, it allows scientists to rapidly and accurately produce large quantities of customized DNA sequences, greatly accelerating genetic research and development. Additionally, high-throughput synthesis technologies facilitate the construction of new biological components or the rewriting of existing components to create organisms with desired properties. However, current technologies increase synthesis throughput by integrating more synthetic vectors or synthesis into the nucleic acid synthesis process. For instance, column synthesis increases throughput by allowing the synthesizer to synthesize simultaneously on multiple wells; high-throughput microarray synthesis also increases throughput by dividing a chip into multiple synthesis sites. In other words, current strategies for increasing synthesis throughput are essentially physical methods and have several limitations: for microarray synthesis, the number of synthesis sites can be increased by reducing the physical size of each synthesis site, but this also means a corresponding decrease in the amount of nucleic acid synthesized at each site; and for column synthesis, high throughput means requiring more vectors, higher synthesis costs, and more complex synthesis processes.
[0004] Therefore, current methods for nucleic acid synthesis still need improvement. Summary of the Invention
[0005] In view of the shortcomings of the existing technology, the purpose of this invention is to provide a method for nucleic acid synthesis, so as to at least alleviate or even solve at least one of the problems mentioned in the background art.
[0006] In one aspect of the present invention, a method for nucleic acid synthesis is provided, the method comprising: attaching a linker to a solid support; synthesizing a first nucleic acid sequence using the solid support to which the linker is attached, attaching the linker to the 5' end of the first nucleic acid sequence, and synthesizing a second nucleic acid sequence based on the linker to obtain a synthetic product; cleaving the synthetic product to obtain a first nucleic acid product and a second nucleic acid product; wherein the linker includes a phosphoramidite group; and the linker and the solid support are connected via a phosphoramidite trimer method.
[0007] Furthermore, the method further includes, after synthesizing the second nucleic acid sequence, linking the linker to the 5' end of the second nucleic acid sequence, and synthesizing a third nucleic acid sequence based on the linker, repeatedly synthesizing the linker and nucleic acid sequence to obtain a synthetic product in which the nucleic acid sequence and the linker are cross-linked; cleaving the synthetic product to obtain multiple nucleic acid products; wherein the base sequences of each nucleic acid product are the same or different.
[0008] Furthermore, the connector has the structure shown in Formula I:
[0009]
[0010] In Formula I, R1 and R2 are each independently selected from at least one of isopropyl, methyl, ethyl, and morpholino;
[0011] Preferably, R1 and R2 are the same in Formula I.
[0012] Furthermore, the connector has the structure shown in Formula II:
[0013]
[0014] Furthermore, before connecting the connector to the solid support, the process further includes a surface modification treatment of the solid support.
[0015] Furthermore, the method further includes: adding the linker, base monomer, and synthetic reagent to the surface-modified solid support to link the linker and the nucleic acid sequence to the solid support; performing nucleic acid synthesis based on the set synthetic sequence to obtain the synthetic product; the synthetic reagent includes deprotection reagent, coupling reagent, oxidant, and capping reagent.
[0016] Further, connecting the linker to the solid support includes: performing a linker coupling treatment on the solid support using a mixture of the coupling reagent and the linker; oxidizing the linker-coupled solid support using the oxidant; and capping the oxidized solid support using the capping reagent to obtain a solid support with the linker connected; wherein the linker coupling treatment takes 3-6 minutes and is performed at least twice.
[0017] Furthermore, the nucleic acid synthesis includes a synthesis step of linking the linker and a synthesis step of linking the base monomer.
[0018] Furthermore, each of the synthesis steps includes a cycle of deprotection reaction, coupling condensation reaction, oxidation reaction, and capping reaction.
[0019] Furthermore, when connecting the linker, the reaction time of the coupling condensation reaction is 3-6 min; when connecting the base monomer, the reaction time of the coupling condensation reaction is 50-80 s.
[0020] Further, the lysis treatment of the synthesized product includes: performing a deprotection reaction on the solid-phase support for the completion of the nucleic acid synthesis, followed by ammonolysis in icy ammonia water to obtain an ammonolysis product; and drying the ammonolysis product to obtain one or more nucleic acid products in dry powder form.
[0021] In another aspect of the invention, the invention provides the use of the above-described linker in nucleic acid synthesis.
[0022] The present invention has at least one of the following beneficial effects:
[0023] 1. The nucleic acid synthesis method of the present invention uses a linker with a phosphoramidite group, which can be quickly connected to a solid support, reducing the production cycle and time cost of the nucleic acid synthesis support, and also reducing the time cost of connecting the linker to the chip support.
[0024] 2. The nucleic acid synthesis method of the present invention uses a linker that can be linked to a base monomer. The linker can be linked to the desired cleavage site, which can realize the synthesis of multiple sequences on a single synthesis vector, thereby improving synthesis throughput and sequence diversity.
[0025] 3. The nucleic acid synthesis method of the present invention can integrate the step of coupling the linker to the solid-phase support into the nucleic acid synthesis process, which not only reduces the production cost of the synthesis support, but also improves the stability of the synthesis support.
[0026] 4. The linker used in the nucleic acid synthesis method of the present invention can be added at any position in nucleic acid synthesis to achieve multi-sequence synthesis and has the function of improving nucleic acid synthesis throughput; when applied to chip surface modification and synthesis, it can greatly reduce surface modification time and increase chip synthesis throughput; when applied to column synthesis on CPG and PS solid-phase carriers, it can increase nucleic acid synthesis throughput and sequence diversity.
[0027] The above overview is for illustrative purposes only and is not intended to be limiting in any way. In addition to the illustrative aspects, embodiments, and features described above, further aspects, embodiments, and features of this application will become readily apparent from the accompanying drawings and the following detailed description. Attached Figure Description
[0028] In the accompanying drawings, unless otherwise specified, the same reference numerals throughout the various drawings denote the same or similar parts or elements. These drawings are not necessarily drawn to scale. It should be understood that these drawings depict only some embodiments disclosed in this application and should not be construed as limiting the scope of this application.
[0029] Figure 1 This is a flowchart of a method according to an embodiment of the present invention;
[0030] Figure 2 This is a partial structural diagram of the pyrolysis of the synthesized product in one embodiment of the present invention;
[0031] Figure 3 This is a schematic diagram of the connection method between the linker and the nucleic acid sequence in Embodiment 1 of the present invention;
[0032] Figure 4 The image shows the MS characterization results of the synthesized product in Example 1 of this invention.
[0033] Figure 5 This is a schematic diagram illustrating the connection method between the linker and the nucleic acid sequence in Embodiment 2 of the present invention;
[0034] Figure 6 This is a graph showing the gel running results in Example 2 of the present invention;
[0035] Figure 7 This is a sequencing result diagram from Example 2 of the present invention. Detailed Implementation
[0036] To more clearly understand the technical features, objectives, and beneficial effects of the present invention, the technical solution of the present invention will now be described in further detail. In the following description, only certain exemplary embodiments are briefly described. As those skilled in the art will recognize, the described embodiments can be modified in various ways without departing from the spirit or scope of this application. Therefore, the drawings and description are considered exemplary in nature and not restrictive.
[0037] In one aspect, the present invention provides a method for nucleic acid synthesis. (See reference...) Figure 1 The method includes attaching a linker to a solid-phase support; synthesizing a first nucleic acid sequence using the solid-phase support with the linker attached, attaching the linker to the 5' end of the first nucleic acid sequence, and synthesizing a second nucleic acid sequence based on the linker to obtain a synthetic product; cleaving the synthetic product to obtain the first nucleic acid product and the second nucleic acid product; wherein the linker includes a phosphoramidite group, and the linker is connected to the solid-phase support via a phosphoramidite trimer method, and the resulting synthetic product is a first nucleic acid sequence-linker-second nucleic acid sequence. This method has at least one of the following beneficial effects: reducing the production cycle and time cost of nucleic acid synthesis vectors, enabling the synthesis of multiple sequences on a single synthesis vector, increasing synthesis throughput and sequence diversity, and improving the stability of the synthesis vector.
[0038] To facilitate understanding, the principle behind this method's ability to achieve the aforementioned beneficial effects will be briefly explained below:
[0039] This method utilizes linkers with phosphoramidite groups for nucleic acid synthesis. These linkers can be attached to a solid-phase support via a phosphoramidite-triester method, a process that is very short. This significantly reduces the time required for the linker-to-solid-phase support step during nucleic acid synthesis vector preparation, thereby lowering the production cycle and time cost. When using a chip as the solid-phase support for nucleic acid synthesis, this method also reduces the time cost of attaching the linker to the chip carrier. Furthermore, the linkers used in this method can be attached not only to solid-phase supports but also to base monomers via a phosphoramidite-triester method. This means that during nucleic acid synthesis, the linker can be attached to any desired cleavage site to obtain a cross-linked product of the nucleic acid sequence and the linker. This allows for the synthesis of multiple sequences on a single synthetic vector, increasing synthesis throughput and sequence diversity. Furthermore, since the linker used in this method can be linked to base monomers, that is, the linker can be used as a "synthetic monomer" to be linked to the nucleic acid sequence via the phosphoramidite method, the process of linking the linker to the solid-phase support can be integrated into the nucleic acid synthesis process without separate operation, thereby reducing the production cost of the synthetic support.
[0040] According to embodiments of the present invention, after synthesizing the second nucleic acid sequence, a linker can be further ligated to the 5' end of the second nucleic acid sequence, and a third nucleic acid sequence can be synthesized based on the ligated linker, resulting in a synthetic product linked in the order of first nucleic acid sequence-linker-second nucleic acid sequence-linker-third nucleic acid sequence. This synthetic product is then cleaved to obtain the first nucleic acid product, the second nucleic acid product, and the third nucleic acid product. Furthermore, in a specific embodiment, a linker can be further ligated again to the 5' end of the third nucleic acid sequence, and the process of synthesizing the linker and nucleic acid sequence can be repeated continuously to obtain a synthetic product with cross-linked nucleic acid sequences and linkers, such as nucleic acid sequence-linker-nucleic acid sequence-linker-nucleic acid sequence… The resulting synthetic product is then cleaved to obtain multiple nucleic acid products. However, it should be noted that in specific embodiments, each synthesized nucleic acid sequence can be the same or different, so the base sequences of the nucleic acid products obtained by cleaving the synthetic product can also be the same or different. Specifically, the resulting nucleic acid product sequence can be determined according to the set target synthetic sequence.
[0041] According to embodiments of the present invention, the linker of the present invention can be linked to a solid support and a base monomer via a phosphoramidite trimer method, and the specific structure of the linker is not particularly limited, as long as it has a phosphoramidite group and a dimethoxytriphenylmethyl group, preferably further having an acetoxy group. Specifically, the linker can have a structure including but not limited to the structure shown in Formula I below, in which the types of R1 and R2 are not particularly limited. For example, R1 and R2 can each be at least one of isopropyl, methyl, ethyl, and morpholino groups, and in specific embodiments, R1 and R2 are preferably the same group. Specifically, R1 is preferably isopropyl, and R2 is preferably isopropyl, that is to say, the linker of the present invention preferably has the structure described in Formula II below.
[0042]
[0043] According to embodiments of the present invention, the method further includes performing a surface modification treatment on the solid support to hydroxylate its surface before connecting the aforementioned linker to the solid support. This surface modification treatment includes treatment with at least one of concentrated sulfuric acid, hydrogen peroxide, and plasma to complete the hydroxylation of the solid support surface. Alternatively, after the solid support has been treated with at least one of concentrated sulfuric acid, hydrogen peroxide, and plasma, it can be further treated with a silane reagent, followed by a chemical reaction modification treatment to make the solid support surface amino and hydroxyl.
[0044] According to embodiments of the present invention, the method includes linking a linker to a solid-phase support that has undergone the aforementioned surface modification treatment, and synthesizing a synthetic product in which a nucleic acid sequence is cross-linked with the linker using the solid-phase support with the linker. The method includes obtaining the synthetic product using a phosphoramidite method. Specifically, the method includes adding a linker, a base monomer, and a synthetic reagent to a surface-modified solid-phase support, setting a target synthetic sequence, and firstly linking the linker to the solid-phase support. Then, based on the pre-defined synthetic sequence, base monomers and the linker are further linked to the solid-phase support with the linker to obtain the synthetic product. The base monomers include A, T, C, and G. In specific embodiments, the base monomers and the linker should be prepared in solutions to facilitate linking to the solid-phase support. For example, to better synthesize the nucleic acid sequence, the linker can be prepared as a linker solution with a concentration of 50-100 mg / mL, and the base monomers A, T, C, and G can be prepared as base monomer solutions with concentrations of 20-100 mg / mL, respectively. Furthermore, the components of the synthetic reagents are not particularly limited, as long as they can be used for the phosphoramidite trimer method, such as deprotecting agents, coupling agents, oxidizing agents, and capping agents. The deprotecting agent is used to deprotect the 5'-terminal DMT protecting group, generating a 5' hydroxyl group; the coupling agent reacts with the phosphoramidite-protected base monomer, forming an active intermediate that condenses with the deprotected 5' hydroxyl group to link the base monomer; the oxidizing agent oxidizes the coupled 3'-5' unstable phosphoramidite trimer to a stable phosphate trimer; and the capping agent blocks the unreacted 5' hydroxyl group, preventing its extension in subsequent cyclic reactions to reduce the proportion of missing base fragments in the synthesized product. Additionally, the synthetic reagents may further include a washing agent to clean the solid support between each reaction.
[0045] In specific embodiments, the types of deprotecting reagents, coupling reagents, oxidizing agents, capping reagents, and washing reagents are not particularly limited. For example, deprotecting reagents include reaction solutions for chemical or electrochemical deprotection, such as, but not limited to, at least one of trichloroacetic acid, dichloromethane, methanol, acetonitrile, hydroquinone, anthraquinone, tetraethylammonium p-toluenesulfonate, and 2,6-dimethylpyridine; coupling reagents include, but are not limited to, tetrazolium, such as ethylthiotetrazole; oxidizing agents include, but are not limited to, at least one of elemental iodine, pyridine, tetrahydrofuran, and water; capping reagents include, but are not limited to, at least one of acetic anhydride and N-methylimidazole; and washing reagents include volatile solvents, preferably acetonitrile or dichloromethane. Furthermore, the concentrations and amounts of deprotecting reagents, coupling reagents, oxidizing agents, capping reagents, and washing reagents are also not particularly limited, as long as a deprotection-coupling-oxidation-capping cycle can be performed to synthesize the nucleic acid sequence.
[0046] According to an embodiment of the present invention, the step of coupling the linker to the solid support includes performing a linker coupling treatment, an oxidation treatment, and a capping treatment on the solid support to obtain a solid support with the linker attached, and preferably performing a cleaning treatment with a cleaning agent between each treatment. Specifically, this step includes performing a linker coupling treatment on the surface-modified solid support to allow the phosphoramidite groups on the linker to react with the hydroxyl groups on the surface of the solid support, thereby connecting the two together; then, in order to make the connection between the solid support and the linker more stable and to seal the unreacted 5' hydroxyl groups on the surface of the solid support, the solid support after the linker coupling treatment is further subjected to an oxidation treatment and a capping treatment.
[0047] In a specific embodiment, the linker coupling treatment includes treating the solid support with a mixture of coupling reagent and linker solution, wherein the volume ratio of the coupling reagent to the linker solution is (0.5-2):(0.5-2), the treatment time is 3-6 min, and the treatment is repeated at least twice, preferably for 4-5 min. After treatment, the solid support with the linker can be further cleaned and dried with a cleaning reagent for at least 5 s, preferably 5-20 s. The oxidation treatment includes treating the cleaned solid support with an oxidant for 50-80 s, repeated at least once. After treatment, the oxidized solid support can also be further cleaned and dried with a cleaning reagent for at least 5 s, preferably 5-20 s. The capping treatment involves treating the cleaned solid support with a capping reagent comprising acetic anhydride and N-methylimidazole for 50-80 seconds and at least once. The volume ratio of acetic anhydride to N-methylimidazole in the capping reagent is (0.5-2):(0.5-2). After treatment, the capped solid support can be further cleaned and dried with a cleaning reagent for at least 5 seconds, preferably 5-20 seconds, to obtain a solid support with a linker that can be used in subsequent synthesis reactions.
[0048] According to embodiments of the present invention, nucleic acid synthesis includes the steps of linking base monomers and linking linkers on a solid-phase support with linkers, as described above, to link base monomers and linkers to the solid-phase support, thereby obtaining a synthetic product with cross-linked nucleic acid sequences and linkers. Specifically, the steps of linking linkers and linking base monomers both include a cycle of deprotection reaction, coupling condensation reaction, oxidation reaction, and capping reaction. The deprotection reaction includes deprotecting the solid-phase support with a deprotection reagent to remove the 5'-terminal DMT group, generating hydroxyl groups that can be used to link base monomers or linkers. The treatment time is 50-80 seconds, and the treatment is repeated at least twice. After treatment, the deprotected solid-phase support can be washed and dried with a washing reagent for at least 5 seconds, preferably 5-20 seconds. The coupling condensation reaction involves treating the cleaned solid support with a mixture of coupling reagent and base monomer solution or a mixture of coupling reagent and linker solution, wherein the volume ratio of coupling reagent to linker solution / base monomer solution is (0.5-2):(0.5-2). In a specific embodiment, when linking base monomers, the cleaned solid support is treated with a mixture of coupling reagent and base monomer solution, and the reaction time of the coupling condensation reaction is 50-80 s; when linking linkers, the cleaned solid support is treated with a mixture of coupling reagent and linker solution, and the reaction time of the coupling condensation reaction is 3-6 min. After the coupling condensation reaction, the deprotected solid support can be cleaned with a cleaning reagent and dried, and the cleaning time is not less than 5 s, preferably 5-20 s. The oxidation reaction involves treating the cleaned solid support with an oxidant for 50-80 seconds, repeating the treatment at least once. After treatment, the solid support can be further cleaned with a cleaning reagent and dried for at least 5 seconds, preferably 5-20 seconds. The capping reaction involves treating the cleaned solid support with a capping reagent comprising acetic anhydride and N-methylimidazole for 50-80 seconds, repeating the treatment at least once. The volume ratio of acetic anhydride to N-methylimidazole in the capping reagent is (0.5-2):(0.5-2). After treatment, the capped solid support can be further cleaned with a cleaning reagent and dried for at least 5 seconds, preferably 5-20 seconds, to obtain the synthesized product.
[0049] According to embodiments of the present invention, the method includes synthesizing a nucleic acid sequence using a synthesis apparatus. Furthermore, the type of synthesis apparatus is not particularly limited, as long as the nucleic acid sequence can be synthesized using the phosphoramidite method; for example, the synthesis apparatus includes, but is not limited to, a nucleic acid synthesizer. Specifically, the method includes placing the surface-modified solid support described above into the synthesis apparatus, and installing the prepared linker solution, A, T, C, and G base monomer solutions, and the synthesis reagents described above into the synthesis apparatus, and setting the synthesis sequence in the synthesis apparatus; performing the step of coupling the linker to the solid support; and the step of linking the nucleic acid sequence and the linker to the solid support coupled with the linker based on the set synthesis sequence, and finally linking the linker and the nucleic acid sequence to the solid support to obtain the synthesized product.
[0050] According to embodiments of the present invention, the invention further includes cleavage treatment of the synthesized product. Specifically, firstly, the DMT protecting group on the last monomer of the synthesized product is removed using a deprotecting agent. Then, the solid support is cleaned and dried using a cleaning agent for at least 1.5 minutes, preferably 1.5-5 minutes. The cleaned solid support is then placed in ice-cold ammonia water for ammonolysis to generate ammonolysis products. Specifically, the ammonolysis treatment can be carried out at a temperature of 70-90°C for 2-5 hours, preferably at a temperature of 75-85°C for 2.5-4 hours. After the ammonolysis treatment, the ammonolysis products can be dried to obtain one or more nucleic acid products in dry powder form. The drying method is not particularly limited; for example, centrifugal drying or heat drying can be used. The treatment time is also not particularly limited, as long as the ammonolysis products are dried.
[0051] In another aspect of the invention, the invention provides the use of the above-described linker in nucleic acid synthesis.
[0052] According to embodiments of the present invention, the linker can be rapidly linked to a solid-phase support and can be used as a "reactant" to be linked to the nucleic acid sequence via the phosphoramidite method. The process of linking the linker to the solid-phase support can be integrated into the nucleic acid synthesis process, eliminating the need for separate operations and reducing the production cost of the synthetic vector. Specifically, the method of the present invention can be used to link the linker to a solid-phase support, and then the linker can be linked to the nucleic acid sequence during nucleic acid synthesis to synthesize a product in which the nucleic acid sequence and linker are cross-linked.
[0053] According to embodiments of the present invention, the linker described above may also be used directly as a "reaction monomer" and linked to a commercially available nucleic acid synthesis vector during nucleic acid synthesis, without being connected to a solid support. Specifically, commercially available nucleic acid synthesis vectors pre-linked with linker molecules can also be used to synthesize synthetic products in which nucleic acid sequences are cross-linked with linkers.
[0054] Furthermore, it should be noted that because the nucleic acid sequences in the synthetic product are cross-linked with the linker, the 5' end of the terminally synthesized nucleic acid sequence is not linked to the linker, while the 5' ends of the internally synthesized nucleic acid sequences are all linked to the linker. Therefore, when the synthetic product is cleaved, because the 5' ends of the internally synthesized nucleic acid sequences are linked to the linker, the 5' ends of the cleaved nucleic acid sequences can either form an amino group (C3) or further cleave into hydroxyl groups, as shown in the following examples. Figure 2 As shown; however, the 5' end of the terminally synthesized nucleic acid sequence can only form a hydroxyl group. That is to say, the cleavage of the internally synthesized nucleic acid sequence can yield two nucleic acid products with different 5' end groups, while the cleavage of the terminally synthesized nucleic acid sequence can yield only one nucleic acid product. The overall cleavage mechanism is that the synthesized nucleic acid sequence contains many ester bonds (OAc or R1-COO-R...). 2) These ester bonds undergo hydrolysis under ammonia heating to form hydroxyl groups. The resulting hydroxyl groups nucleophilically attack the adjacent phosphate backbone, causing dephosphorylation. This results in one or more nucleic acid sequences having a hydroxyl group at their 3' end. Under alkaline conditions, the synthesized nucleic acid sequence breaks at the succinimide linker to form a 5' amino group (C3). Further cleavage forms a 5' hydroxyl group.
[0055] Example
[0056] The method proposed in this invention will be described in detail below through specific embodiments. Unless otherwise specified, the methods used in the following embodiments are conventional methods, and the reagents used are commercially available unless otherwise specified.
[0057] Example 1
[0058] This embodiment utilizes the nucleic acid synthesis method of the present invention to synthesize two nucleic acid sequences (oligo1 and oligo2). Specifically, in this embodiment, nucleic acid synthesis is performed in a nucleic acid synthesizer, using a commercially available CPG vector as the nucleic acid synthesis vector, and in this embodiment, a linker having the structure shown in Formula II above is selected, purchased from Glenresearch.
[0059] Among them, the sequence of oligo1 is 5'-GCATTCGCTCTGGTTCCGTTATGCCAAAGT-3';
[0060] The sequence of oligo2 is 5'-TAGGATCGTTTGCCTGCGTTTAAGCTTTCT-3'.
[0061] 1. Prepare reagents:
[0062] Linker solution: Dissolve 80 mg of linker in 1 mL of anhydrous acetonitrile;
[0063] Base monomer (A, T, C, G) solution: Dissolve 10g of base monomer in 200mL of anhydrous acetonitrile;
[0064] Deprotection agent: Dichloromethane solution containing 3% trichloroacetic acid (TCA);
[0065] Coupling reagent: ethylthiotetrazole;
[0066] Oxidizing agent: iodine solution;
[0067] Capping reagent: acetic anhydride and N-methylimidazole mixed in equal volumes;
[0068] Cleaning reagent: acetonitrile solution;
[0069] 2. Nucleic acid synthesis:
[0070] ① Install the prepared linker solution, deprotection reagent, coupling reagent, oxidant, capping reagent and cleaning reagent into the nucleic acid synthesizer, and weigh 20 nmol of CPG carrier powder and place it into the nucleic acid synthesizer.
[0071] ② Set the synthesis sequence. Since nucleic acid chemical synthesis starts from the 3' end to the 5' end, based on the desired nucleic acid sequences oligo1 and oligo2, the set synthesis sequence is 5'-TAGGATCGTTTGCCTGCGTTTAAGCT TTCT-linker-GCATTCGCTCTGGTTCCGTTATGCCAAAGT-3'.
[0072] ③ Perform a cycle of deprotection-coupling condensation-oxidation-capping, adding base monomers or linkers in the order of the 3'-5' ends of the predetermined synthetic sequence to obtain the synthetic product. The specific operation steps are as follows:
[0073] Deprotection reaction: The DMT groups on the CPG support were removed using a deprotection reagent. The reaction time was 60 s, and the reaction was repeated twice. After the reaction, the support was washed with a cleaning reagent for 10 s and then dried.
[0074] Coupling condensation reaction: When coupling the base monomer, the CPG carrier that has undergone deprotection reaction and cleaning is treated with a mixture of equal volume of coupling reagent and base monomer solution for 60 s, and the reaction is repeated twice. After the reaction, the carrier is washed with cleaning reagent for 10 s and then dried. When coupling the linker, the CPG carrier that has undergone deprotection reaction and cleaning is treated with a mixture of equal volume of coupling reagent and linker solution for 4 min, and the reaction is repeated twice. After the reaction, the carrier is washed with cleaning reagent for 10 s and then dried.
[0075] Oxidation reaction: The CPG carrier that has undergone the coupling condensation reaction and been cleaned was treated with an oxidant for 60 seconds and the reaction was repeated once. After the reaction, the carrier was cleaned with a cleaning agent for 15 seconds and then dried.
[0076] Capping reaction: The above-mentioned oxidized and cleaned CPG carrier was treated with a capping reagent for 60 seconds and the reaction was repeated once. After the reaction, the carrier was washed with a cleaning reagent for 15 seconds and then dried.
[0077] In the deprotection-coupling condensation-oxidation-capping cycle, in each coupling condensation reaction, one of the following additives (A, T, C, G) is added in the predetermined order from the 3'-5' ends of the synthetic sequence, and the cycle continues until the synthetic product is obtained. Furthermore, in this embodiment, the linkage obtained from the synthesized linker is ligated to the nucleic acid sequence as follows: Figure 3 As shown.
[0078] 3. Pyrolysis treatment of the synthesized product:
[0079] The last DMT group on the CPG support was removed using a deprotecting agent. The reaction time was 60 s, and the reaction was repeated twice. After the reaction, the CPG support was washed with a 10% diethylamine acetonitrile solution for 2 minutes. Finally, the CPG support was dried and placed in 2 mL of fresh ice-cold ammonia water for ammonolysis in an oven at 80 °C for 3 h. After ammonolysis, the ammonolysis solution was transferred to a centrifuge tube and centrifuged overnight to obtain a dry powder product.
[0080] 4. Verification of the synthesized product
[0081] Dissolve in 1 mL of sterile water and characterize by mass spectrometry (MS). Since oligo1 was synthesized first, followed by oligo2, the 5' end of oligo1 was connected to the linker. During cleavage, the 5' end of oligo1 cleaved to yield two groups, while the 5' end of oligo2 only formed a hydroxyl group. In other words, the cleavage products included three target sequences, as detailed below:
[0082] oligo1: 5'OH-GCATTCGCTCTGGTTCCGTTATGCCAAAGT-3'OH (Molecular weight: 9164)
[0083] oligo1: 5'amino C3-GCATTCGCTCTGGTTCCGTTATGCCAAAGT-3'OH (Molecular weight: 9301.08)
[0084] oligo2: 5'OH-TAGGATCGTTTGCCTGCGTTTAAGCTTTCT-3'OH (molecular weight: 9185).
[0085] MS characterization results are as follows Figure 4 As shown, the three target sequences obtained above, although the 5' end modification of the oligo1 sequence is different, does not affect the use of the oligo1 sequence in PCR experiments. Furthermore, since this is a crude MS sample, it contains N+1 molecules; the fourth peak represents an N+1 impurity.
[0086] Example 2
[0087] This embodiment utilizes the nucleic acid synthesis method of the present invention to synthesize two nucleic acid sequences (oligo1 and oligo2). Specifically, in this embodiment, nucleic acid synthesis is performed in a nucleic acid synthesizer, using a chip as a solid-phase carrier, and a linker with the structure shown in Formula II above is selected, purchased from Glenresearch.
[0088] Among them, the sequence of oligo1 is 5'-GCATTCGCTCTGGTTCCGTTATGCCAAAGT-3';
[0089] The sequence of oligo2 is 5'-TAGGATCGTTTGCCTGCGTTTAAGCTTTCT-3'.
[0090] 1. Prepare reagents:
[0091] Except for the deprotection reagent, all are the same as in Example 1.
[0092] Deprotection reagent: Add 22g hydroquinone, 2g anthraquinone, and 60g tetraethylammonium p-toluenesulfonate to a mixture of 400mL methanol and 2.5L acetonitrile. Stir the mixture thoroughly, add 2.32mL 2,6-dimethylpyridine, and then add acetonitrile to a total volume of 4.0L. Stir until completely dissolved to obtain the deprotection reagent.
[0093] 2. Coupling of solid-phase supports and linkers, and nucleic acid synthesis:
[0094] This embodiment integrates the step of coupling the linker to the solid-phase carrier into the nucleic acid synthesis process.
[0095] The prepared linker solution, deprotection reagent, coupling reagent, oxidant, capping reagent, and cleaning reagent are installed into the nucleic acid synthesizer, and the hydroxyl-modified chip is placed in the nucleic acid synthesizer.
[0096] (1) Coupling between solid support and connector
[0097] The chip was treated with an equal volume mixture of coupling reagent and linker solution for 4 minutes, repeated twice. After the reaction, the chip was cleaned with a cleaning reagent for 10 seconds and then dried. The cleaned chip was then treated with an oxidant for 60 seconds, repeated once. After the reaction, the chip was cleaned with a cleaning reagent for 15 seconds and then dried. Finally, the cleaned chip was treated with a capping reagent for 60 seconds, repeated once. After the reaction, the chip was cleaned with a cleaning reagent for 15 seconds and then dried, resulting in a chip carrier coupled with a linker.
[0098] (2) Nucleic acid synthesis:
[0099] ① Set the synthesis sequence: Since nucleic acid chemical synthesis starts from the 3' end to the 5' end, based on the desired nucleic acid sequences oligo1 and oligo2, the set synthesis sequence is 5'-TAGGATCGTTTGCCTGCGTTTAAGCT TTCT-linker-GCATTCGCTCTGGTTCCGTTATGCCAAAGT-3'.
[0100] ② Perform a cycle of deprotection-coupling condensation-oxidation-capping: Add base monomers or linkers in the order of the 3'-5' ends of the set synthetic sequence to obtain the synthetic product. Except for the deprotection reaction, which is electrochemical deprotection, the specific operation steps of the other coupling condensation reaction, oxidation reaction, and capping reaction are the same as in Example 1. The specific operation of the electrochemical deprotection step is as follows:
[0101] Deprotection reaction: Deprotection was performed using a constant voltage method with a deprotection reagent. The voltage was turned on at 2.0V for 10 seconds, then at 0V for 5 seconds, for a total of 6 cycles. After the reaction was completed, the chip was cleaned with a cleaning reagent for 10 seconds and then dried.
[0102] In the deprotection-coupling condensation-oxidation-capping cycle, in each coupling condensation reaction, one of the following additives (A, T, C, G) is added in the predetermined order from the 3'-5' ends of the synthetic sequence, and the cycle continues until the synthetic product is obtained. Furthermore, in this embodiment, the linkage obtained from the synthesized linker is ligated to the nucleic acid sequence as follows: Figure 5 As shown.
[0103] 3. Pyrolysis treatment of the synthesized product:
[0104] The above deprotection reaction was performed to remove the last DMT group on the chip. After the reaction, the chip was washed with a 10% diethylamine acetonitrile solution for 2 minutes. Finally, the chip was dried and placed in 2 mL of fresh ice-cold ammonia water, and ammonolyzed in an oven at 80°C for 3 hours. After ammonolysis, the ammonolysate was transferred to a centrifuge tube and centrifuged overnight to obtain a dry powder product.
[0105] 4. Verification of the synthesized product
[0106] The product was dissolved in 40 μL of sterile water, and the dissolved product was used as upstream and downstream primers for PCR amplification and sequencing analysis of the purchased template. The template used for amplification was:
[0107] 5'-TAGGATCGTTTGCCTGCGTTTAAGCTTTCTTTGCTGGTCGAAACTT TGCTTTTTAACTTTGCTTTTTAACTTTGCTGGTGGAGGTGCGAGGCGATTA CGGAGTTCCTATAGACCGAGTCGACTTTGGCATAACGGAACCAGAGCGAA TGC-3'.
[0108] The PCR amplification system is shown in Table 1 below, and the amplification program is shown in Table 2 below.
[0109] Table 1: PCR amplification system
[0110] DNA template 2μg Target product (primers) after lysis 6μL Phu enzyme 2.5U 10×Buffer 5μL 2.5mM dNTPs 4μL <![CDATA[H2O]]> Add to 50 μL
[0111] Table 2: PCR amplification program
[0112] Pre-variation 94℃ 5min transsexual 94℃ 30s annealing 65℃ 30s extend 72℃ 30s Final extension 72℃ 5min store 4℃ ∞
[0113] The lysed target product was amplified and enriched by PCR, then bluntly ligated into a plasmid vector to form recombinant DNA. The recombinant DNA was then introduced into recipient cells, where it replicated and was expressed. Finally, single-clone products were selected for first-generation sequencing. The gel electrophoresis results of the single-clone products are shown below. Figure 6 As shown, the bands are clear. Sequencing results are as follows: Figure 7 As shown, the single sequence synthesized by the chip electrochemical synthesis is cleaved into the double sequence oligo1 and oligo2, which can be used as primers for PCR amplification without any deletions or mutations.
[0114] In summary, existing technologies suffer from long coupling reaction times between solid-phase supports and linkers, hindering the integration of linkers into nucleic acid synthesizers for functional applications. This results in the synthesis of only single nucleic acid molecules, leading to low throughput and poor diversity. However, the linker of this invention can be integrated into the synthesis apparatus as a synthetic monomer. It can be linked at cleavage sites as needed, enabling automated synthesis of multiple sequences on a single synthetic support, thus improving throughput and sequence diversity. The method of this invention allows for direct and rapid linker connection to solid-phase supports, and the ability to link linkers at cleavage sites as required significantly increases synthesis throughput. Each additional linker introduced doubles the synthesis throughput.
[0115] In summary, the nucleic acid synthesis method proposed in this invention utilizes a linker with a phosphoramidite group for nucleic acid synthesis. This linker rapidly connects to a solid-phase support, reducing the time cost of attaching the linker to the solid-phase support. Furthermore, during nucleic acid synthesis, the linker can be ligated at any desired cleavage site, enabling the synthesis of multiple sequences on a single synthetic vector, thus increasing throughput and sequence diversity. Moreover, the process of ligating the linker to the solid-phase support can be integrated into the nucleic acid synthesis process, eliminating the need for separate operations and reducing the production cost of the synthetic vector.
[0116] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. It will be apparent to those skilled in the art that the present invention is not limited to the details of the exemplary embodiments described above, and that the invention can be implemented in other specific forms without departing from its spirit or basic characteristics. Therefore, the embodiments should be considered exemplary and non-limiting in all respects.
[0117] Furthermore, it should be understood that although this specification describes embodiments, not every embodiment contains only one independent technical solution. This narrative style is merely for clarity. Those skilled in the art should consider the specification as a whole, and the technical solutions in each embodiment can also be appropriately combined to form other embodiments that can be understood by those skilled in the art.
Claims
1. A method for nucleic acid synthesis, characterized in that, The method includes: Connect the connector to the solid support; A first nucleic acid sequence is synthesized using a solid-phase support with the linker attached, and the linker is attached to the 5' end of the first nucleic acid sequence. A second nucleic acid sequence is then synthesized based on the linker to obtain the synthetic product. The synthesized product was cleaved to obtain a first nucleic acid product and a second nucleic acid product; The connector is connected to the solid support via a phosphoramidite method; The linker, as a synthetic monomer, is ligated into the nucleic acid sequence via the phosphoramidite method. The connector has the structure shown in Formula I: Formula I In Formula I, R1 and R2 are each independently selected from at least one of isopropyl, methyl, and ethyl.
2. The method according to claim 1, characterized in that, In Equation I, R1 and R2 are the same.
3. The method according to claim 1 or 2, characterized in that, The method further includes, after synthesizing the second nucleic acid sequence, linking the linker to the 5' end of the second nucleic acid sequence, and synthesizing a third nucleic acid sequence based on the linker, and repeatedly synthesizing the linker and nucleic acid sequence to obtain a synthetic product in which the nucleic acid sequence and the linker are cross-linked; The synthesized product was cleaved to obtain multiple nucleic acid products; The base sequences of each of the nucleic acid products may be the same or different.
4. The method according to claim 1 or 2, characterized in that, The connector has the structure shown in Formula II: Formula II.
5. The method according to claim 1 or 2, characterized in that, Before connecting the connector to the solid support, the process further includes surface modification of the solid support.
6. The method according to claim 1 or 2, characterized in that, The method further includes: The linker, base monomer, and synthetic reagent are added to the surface-modified solid support to link the linker and the nucleic acid sequence to the solid support; Based on the set synthetic sequence, the nucleic acid is synthesized to obtain the synthetic product; The synthetic reagents include deprotection reagents, coupling reagents, oxidizing agents, and capping reagents.
7. The method according to claim 6, characterized in that, Connecting the connector to the solid support includes: The solid support is subjected to linker coupling treatment using a mixture of the coupling reagent and the linker; The solid support coupled with the linker is oxidized using the oxidant. The solid support that has undergone the oxidation treatment is capped using the capping reagent to obtain a solid support with the linker attached. The processing time for the connector coupling process is 3-6 minutes, and the number of processing times is no less than 2.
8. The method according to claim 6, characterized in that, The nucleic acid synthesis includes a synthetic step of linking the linker and a synthetic step of linking the base monomers. The synthetic steps all include a cycle of deprotection reaction, coupling condensation reaction, oxidation reaction, and capping reaction. When connecting the connector, the reaction time of the coupling condensation reaction is 3-6 minutes; The reaction time for the coupling condensation reaction when connecting the base monomer is 50-80 s.
9. The method according to claim 1 or 2, characterized in that, The pyrolysis treatment of the synthesized product includes: The solid-phase support used for the completion of nucleic acid synthesis is subjected to a deprotection reaction, followed by ammonolysis in icy ammonia water to obtain the ammonolysis product; The ammonolysis product is dried to obtain one or more nucleic acid products in powder form.
10. The use of the linker according to claim 1, 2 or 4 in nucleic acid synthesis, characterized in that, The linker, as a synthetic monomer, is linked to the nucleic acid sequence via a phosphoramidite method, wherein the purpose enables the synthesis of multiple sequences on a single synthetic vector.
Citation Information
Patent Citations
Probe inversion process for in situ synthesized probe arrays
CN106467913A