A highly stereoselective transaminase mutant, encoding gene and application thereof
By performing site-directed amino acid mutations on C. violet transaminase, catalytic vitality and stereoselectivity are improved, the problem of insufficient stereoselectivity of transaminases in the prior art is solved, and efficient and low-cost preparation of (R)-3-aminobutanol is achieved, which is suitable for industrial production.
Patent Information
- Application Number
- CN202311406336.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-10-27
- Publication Date
- 2025-08-29
- Estimated Expiration
- 2043-10-27
AI Technical Summary
In the prior art, wild-type aminotransferases are insufficient in catalyzing non-natural substrates, which is difficult to meet the demand for industrial production of high optical purity (R)-3-aminobutanol, resulting in high production costs and low efficiency.
By conducting protein engineering technology for transaminases from C. violet, amino acid mutations were specifically obtained by performing amino acid mutations at positions 118, 225 and 418, and transaminase mutants with significantly improved catalytic vitality and stereoselectivity were obtained, and genetically engineered bacteria were constructed for expression.
It has achieved efficient preparation of high optical purity (R)-3-aminobutanol, with high product yield, few by-products, low production cost, and good industrial application prospects.
Smart Images

Figure CN117431228B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of bioengineering, and in particular to a transaminase mutant modified for a transaminase derived from Chromobacterium violaceum, a coding gene and application thereof in the preparation of (R)-3-aminobutanol. Background Art
[0002] Dolutegravir (DTG), chemical name: (4R,12aS)-N-[(2,4-difluorophenyl)methyl]-3,4,6,8,12,12-hexahydro-7-hydroxy-4-methyl-6,8-dioxo-2H-pyrido[1',2':4,5]pyrazino[2,1-b][1,3]oxazine-9-carboxamide, CAS registration number: 1051375-16-6. Dolutegravir is an inhibitor of human immunodeficiency virus type 1 (HIV-1) integrase, primarily used to treat HIV infection and plays a vital role in curbing the spread of AIDS.
[0003] (R)-3-Aminobutanol is an important chiral six-membered ring building block in the synthesis of dolutegravir. During the synthesis of dolutegravir, the chiral purity of (R)-3-aminobutanol determines the purity of subsequent intermediates and plays a crucial role in the synthesis of high-quality dolutegravir. Optical purity has a significant impact on the application of drugs and their intermediates. Different stereoisomers may exhibit distinct biological activities, metabolic kinetics, and toxicities. High optical purity is a key factor in ensuring optimal drug interaction with target molecules and improving drug efficacy.
[0004] Therefore, developing a method for efficiently synthesizing (R)-3-aminobutanol, especially a synthesis method with high optical purity, is helpful to improve the efficiency of drug preparation and reduce production costs.
[0005] Currently, the synthesis of (R)-3-aminobutanol with high optical purity mainly involves chemical and biological methods. Common chemical methods include kinetic resolution using lithium aluminum tetrahydride and other reducing agents, and direct synthesis using chiral compounds as starting materials. However, these methods suffer from low raw material atomic utilization, the high cost of chirally pure raw materials, and the long reaction steps, resulting in high production costs.
[0006] Compared to chemical synthesis, biosynthesis offers advantages such as mild reaction conditions, high conversion rates, and strong stereoselectivity. For example, patent document CN104131048A discloses the use of genetic engineering techniques to clone the D-aminotransferase gene from Arthrobacter.sp into Escherichia coli host cells, expressing recombinant D-aminotransferase. Finally, using 3-oxobutanol as a substrate, the enzyme catalyzes the reaction to produce (R)-3-aminobutanol. Transaminases can asymmetrically catalyze the direct synthesis of chiral amines from potentially chiral ketones, offering promising applications.
[0007] However, in practical applications, the stereoselectivity of wild-type transaminases in catalyzing non-natural substrates often falls short of practical application requirements, necessitating modification through protein engineering techniques. For example, patent document CN108823179A discloses the modification of an actinomycete-derived transaminase by mutating valine at position 80 to glycine, tryptophan at position 203 to serine, and threonine at position 294 to serine. The resulting mutant protein exhibits a 12%-25% increase in substrate conversion.
[0008] Currently, the transaminases that meet the needs of industrial applications are still relatively limited. Therefore, we will further explore transaminases from different sources and use protein engineering technology to perform molecular modification in order to expand the application space of transaminases in the chiral drug manufacturing industry. Summary of the Invention
[0009] The object of the present invention is to provide a transaminase with high catalytic activity and strong stereoselectivity for preparing high optical purity (R)-3-aminobutanol, which meets the requirements of industrial production.
[0010] To achieve the above object, the present invention adopts the following technical solutions:
[0011] The present invention uses protein engineering technology to perform amino acid mutation on the transaminase CvATA derived from Chromobacterium violaceum to obtain a transaminase mutant, that is, the transaminase mutant is a mutant of the transaminase derived from Chromobacterium violaceum with an amino acid sequence as shown in SEQ ID NO.1 obtained by amino acid mutation. Specifically, the site of the amino acid mutation is at least one of position 118, position 225, and position 418, and the asparagine at position 118 is mutated to glycine, the glycine at position 225 is mutated to alanine, and the cysteine at position 418 is mutated to threonine.
[0012] Specifically, the mutant N118G is a mutation in which the asparagine at position 118 is converted to glycine, and the amino acid sequence is shown in SEQ ID NO.3.
[0013] The mutant G225A is a mutation in which glycine at position 225 is converted to alanine, and the amino acid sequence is shown in SEQ ID NO.4.
[0014] The mutant C418T has the 418th cysteine mutated to threonine, and the amino acid sequence is shown in SEQ ID NO.5.
[0015] The mutant N118G / G225A is a mutant in which the asparagine at position 118 is mutated to glycine and the glycine at position 225 is mutated to alanine. The amino acid sequence is shown in SEQ ID NO.6.
[0016] The mutant N118G / C418T is a mutant in which the asparagine at position 118 is mutated to glycine and the cysteine at position 418 is mutated to threonine. The amino acid sequence is shown in SEQ ID NO.7.
[0017] The mutant N118G / G225A / C418T is characterized by a mutation of asparagine at position 118 to glycine, a mutation of glycine at position 225 to alanine, and a mutation of cysteine at position 418 to threonine. The amino acid sequence is shown in SEQ ID NO.8.
[0018] Studies have shown that compared with wild-type transaminase, the catalytic activity and stereoselectivity of the above-mentioned transaminase mutants are significantly improved.
[0019] Conservative substitution forms of other amino acid positions of the transaminase mutant, forms of addition or deletion of one or several amino acids, forms of amino-terminal truncation, forms of carboxyl-terminal truncation, these mutant forms are also included in the scope of the present invention.
[0020] The invention performs site-directed mutation on the transaminase encoding gene derived from Chromobacterium violaceum, clones the gene into a host cell to construct a genetically engineered bacterium, and obtains the transaminase mutant by inducing expression.
[0021] The present invention also provides a gene encoding the transaminase mutant. The present invention can optimize the encoding gene based on the codon preference of the genetically engineered bacterial host cell. Furthermore, the mutant encoding gene is obtained by mutating the codons encoding the corresponding amino acids based on the nucleotide sequence shown in SEQ ID NO.2. Specifically, N118G is a mutation of the codon AAT encoding asparagine at position 118 to the codon GGC encoding glycine, G225A is a mutation of the codon GGC encoding glycine at position 225 to the codon GCG encoding alanine, and C418T is a mutation of the codon TGT encoding cysteine at position 418 to the codon ACC encoding threonine.
[0022] The present invention also provides a recombinant expression vector comprising a gene encoding the amino acid sequence of the transaminase mutant. Preferably, the recombinant expression vector uses pET30a as a vector plasmid.
[0023] The present invention also provides a genetically engineered bacterium comprising the recombinant expression vector, wherein the genetically engineered bacterium is used to produce the transaminase mutant. The recombinant vector is used to transform a host cell to obtain the recombinant genetically engineered bacterium. The host cell can be any conventional host cell in the art. Preferably, the host bacterium for the genetically engineered bacterium is Escherichia coli, specifically E. coli BL21.
[0024] The present invention also provides a method for constructing the transaminase mutant, comprising the following steps:
[0025] (1) Designing site-directed mutagenesis primers, using a plasmid carrying a transaminase encoding gene from Chromobacterium violaceum as a template, and performing inverse PCR to obtain single-site mutation products in which N at position 118 is mutated to G, G at position 225 is mutated to A, or C at position 418 is mutated to T in the transaminase;
[0026] (2) using the single-site mutation product as a template, performing reverse PCR using the site-directed mutagenesis primer to obtain a double-site mutation product; using the double-site mutation product as a template, performing reverse PCR using the site-directed mutagenesis primer to obtain a triple-site mutation product;
[0027] (3) transforming the single-site mutation product, double-site mutation product or triple-site mutation product into a host bacterium, screening to obtain a transaminase mutant expression strain, inducing expression, and obtaining the transaminase mutant.
[0028] The primers required for the mutation of N at position 118 to G are:
[0029] N118G-F:5'-CGCGTGTTTTATACCGGCAGCGGCTCAGAATCAGTG-3';
[0030] N118G-R:5'-CACTGATTCTGAGCCGCTGCCGGTATAAAACACGCG-3';
[0031] Primers required for mutation of G to A at position 225:
[0032] G225A-F:5'-GTTGCCGCCTTTGTGGCGGAACCGATTCAG-3';
[0033] G225A-R:5'-CTGAATCGGTTCCGCCACAAAAGGCGGCAAC-3';
[0034] Primers required for mutation of C to T at position 418:
[0035] C418T-F:5'-GATTATGCGCGCCACCGGCGATCATATTGTGAGC-3';
[0036] C418T-R:5'-GCTCACAATATGATCGCCGGTGGCGCGCATAATC-3';
[0037] Preferably, the original vector of the recombinant plasmid is pET30a; and the host bacteria is Escherichia coli BL21.
[0038] Another object of the present invention is to provide the use of the transaminase mutant in the preparation of (R)-3-aminobutanol, wherein the use comprises asymmetric catalytic amination of 4-hydroxy-2-butanone to produce (R)-3-aminobutanol under the condition of adding an amine donor.
[0039] The transaminase mutant provided by the present invention asymmetric catalyzes the amination of 4-hydroxy-2-butanone in the presence of an amine donor to generate (R)-3-aminobutanol with high optical purity (optical purity >99%), and has good industrial application prospects.
[0040] The application includes: using wet bacteria obtained by centrifugation after fermentation and culture of an engineered bacterium containing a transaminase mutant encoding gene, immobilized wet bacteria cells, enzymes extracted after ultrasonic disruption of wet bacteria, or immobilized enzymes as catalysts, using 4-hydroxy-2-butanone as a substrate under the conditions of adding alanine and pyridoxal phosphate, using a buffer solution with a pH value of ≤8 containing an organic solvent as a reaction medium, reacting at 25-37°C and 150-300rpm, and after the reaction is completed, separating and purifying the reaction liquid to obtain (R)-3-aminobutanol.
[0041] The transaminase mutants of the present invention can be used in the form of whole engineered bacterial cells, unpurified crude enzymes, partially purified enzymes, or completely purified enzymes. The transaminase mutants of the present invention can also be prepared as biocatalysts in the form of immobilized enzymes or immobilized cells using immobilization techniques known in the art.
[0042] Preferably, in the reaction system, the amount of catalyst used is 20-100 g / L based on the weight of the wet cells, wherein the water content of the wet cells is 70-90%, more preferably 50 g / L.
[0043] Preferably, in the reaction system, the concentration of the substrate is 0.5-2 g / L, more preferably 1.8 g / L.
[0044] Preferably, in the reaction system, the concentration of alanine is 2-10 g / L, more preferably 9 g / L.
[0045] Preferably, in the reaction system, the concentration of pyridoxal phosphate is 0.2-0.4 g / L, more preferably 0.25 g / L.
[0046] Preferably, the pH buffer solution is a phosphate buffer, i.e., NaH2PO4-Na2HPO4 buffer, with a buffer pH value of 7.0-8.0, more preferably 7.4-7.6, and more preferably 7.5.
[0047] Preferably, the organic solvent is isopropanol or dimethyl sulfoxide, and the volume fraction of the organic solvent in the pH buffer solution is 8-12%, more preferably 10%.
[0048] The added concentrations of the above raw materials, such as wet bacteria, substrate, alanine, and pyridoxal phosphate, were all calculated based on 1 L of pH buffer.
[0049] Preferably, the reaction temperature is 37°C.
[0050] The reaction time is 3-6 hours, preferably 4 hours.
[0051] Preferably, the shaking rate is 220 rpm.
[0052] Preferably, the wet bacteria are E. coli BL21 / pET30a-CvATA-N118G / G225A / C418T. The yield of (R)-3-aminobutanol from this mutant can reach 45%, and the optical purity is >99%.
[0053] The fermentation culture method is as follows: the recombinant engineered bacteria are inoculated into LB liquid medium containing kanamycin (final concentration of 50 μg / mL) and cultured at 37°C with shaking for 18 h; the seed liquid is inoculated into fresh LB liquid medium containing kanamycin (final concentration of 50 μg / mL) at a volume ratio of 1%, and cultured at 37°C and 220 rpm with shaking until the bacterial OD reaches 0. 600 The concentration of isopropyl-β-D-thiogalactopyranoside (IPTG) was 0.1 mM, and the cells were induced at 25°C and 220 rpm for 16 h. The bacterial cells were collected by centrifugation at 4°C and 3500 rpm for 10 min.
[0054] The present invention has the following beneficial effects:
[0055] (1) The transaminase mutant provided by the present invention has higher enzyme activity than the wild-type transaminase, and can prepare (R)-3-aminobutanol using 4-hydroxy-2-butanone as a substrate with a high yield of the product and without the generation of by-products.
[0056] (2) The present invention utilizes a transaminase mutant as a biocatalyst for the chiral intermediate of dolutegravir, making it more economical and convenient to obtain a chiral product of high optical purity. The production method has the advantages of simple operation and low cost, which greatly reduces the production cost and has a good prospect for industrial application. BRIEF DESCRIPTION OF THE DRAWINGS
[0057] Figure 1 The relative spatial positions of the 118th, 225th, and 418th amino acid residues.
[0058] Figure 2 The figure shows the recombinant plasmid map.
[0059] Figure 3 This is a liquid chromatogram of the products obtained by the reaction of (S / R)-3-aminobutanol standard, E. coli BL21 blank control, and transaminase CvATA with substrate 4-hydroxy-2-butanone. DETAILED DESCRIPTION
[0060] The present invention will be further described below in conjunction with specific examples. The following examples are only used to illustrate the present invention and are not intended to limit the scope of application of the present invention. Without departing from the spirit and essence of the present invention, modifications or replacements made to the inventive method, steps or conditions all fall within the scope of the present invention.
[0061] Unless otherwise specified, the raw materials used in the present invention can be purchased from the market or are commonly used in the art. Unless otherwise specified, the methods in the following examples are all conventional methods in the art.
[0062] Nucleic acids are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxyl orientation.
[0063] Example 1: Construction of engineered bacteria capable of expressing various mutants
[0064] 1. Based on the amino acid sequence of the 6s4g protein (transaminase from Chromobacterium violaceum, www.rcsb.org / structure / 6S4G) in the PDB protein library, the corresponding encoding gene was synthesized by Shanghai Jierui Biotechnology Co., Ltd. Specifically, the amino acid sequence of the wild-type transaminase from Chromobacterium violaceum is shown in SEQ ID NO. 1, and the nucleotide sequence of the encoding gene is shown in SEQ ID NO. 2.
[0065] Then, using plasmid pET30a as a vector, a recombinant plasmid pET30a containing the coding gene was obtained through conventional preparation operations. The recombinant plasmid was transformed into Escherichia coli BL21 to obtain an engineered recombinant strain of wild-type transaminase. The recombinant strain was activated on an LB plate containing 1‰ kanamycin resistance and cultured at 37°C for 18 hours. A single colony was picked and placed in a 50 mL LB conical flask also containing 1‰ kanamycin resistance and cultured at 37°C and 220 rpm until the OD 600 The plasmid was extracted according to the instructions of the plasmid extraction kit.
[0066] 2. Construction of transaminase site 118, 225, and 418 mutants
[0067] The plasmid extracted in step 1 was used as a template to construct the mutant plasmid using the QuikChange Lightning Site-Directed Mutagenesis Kit (Agilent, United States).
[0068] Specifically, single-site mutations were performed on asparagine (N) at position 118, glycine (G) at position 225, and cysteine (C) at position 418 in the wild-type amino acid sequence, and corresponding primers were designed, as shown in Table 1.
[0069] Table 1. Mutation primers
[0070] Primers Sequence (5'-3') N118G-F: CGCGTGTTTTATACCGGCAGCGGCTCAGAATCAGTG N118G-R: CACTGATTCTGAGCCGCTGCCGGTATAAAACACGCG G225A-F: GTTGCCGCCTTTGTGGCGGAACCGATTCAG G225A-R: CTGAATCGGTTCCGCCACAAAGGCGGCAAC C418T-F: GATTATGCGCGCCACCGGCGATCATATTGTGAGC C418T-R: GCTCACAATATGATCGCCGGTGGCGCGCATAATC
[0071] The mutant plasmid constructed above was transformed into E. coli BL21 competent cells, mixed well and placed on ice for 25 minutes. After that, the E. coli BL21 competent cells were placed in a heat shock at 42°C for 90 seconds and then placed on ice for 5 minutes. Then 1 mL of LB medium was added and cultured at 37°C for 50 minutes. After that, the cells were centrifuged at 12000 rpm for 1 minute. 100 μL of the supernatant was taken to resuspend the cells, spread on an LB plate containing 1‰ kanamycin, and cultured in a constant temperature incubator at 37°C for 18 hours.
[0072] Single colonies on the plate were picked and placed in a test tube containing 5 mL of LB medium. After culturing for 8 h, 1 mL of the culture medium was taken for sequencing. If the sequencing results were correct, an equal volume of 40% glycerol solution was added to the remaining bacterial liquid and stored in a -80°C refrigerator for later use.
[0073] Transaminase mutant engineered bacteria E. coli BL21 / pET30a-CvATA-N118G, E. coli BL21 / pET30a-CvATA-G225A, and E. coli BL21 / pET30a-CvATA-C418T were obtained, respectively. Sequencing results showed that the codon AAT encoding asparagine (N) at position 118 mutated to the codon GGC encoding glycine (G); the codon GGC encoding glycine (G) at position 225 mutated to the codon GCG encoding alanine (A); and the codon TGT encoding cysteine (C) at position 418 mutated to the codon ACC encoding threonine (T). The amino acid sequences of the mutants N118G, G225A, and C418T are SEQ ID NO. 3, SEQ ID NO. 4, and SEQ ID NO. 5.
[0074] 3. Construction of transaminase combination mutants
[0075] Using the pET30a-CvATA-N118G constructed in step 2 as a template, a point mutagenesis kit was used to complete the construction of the mutant plasmid using the same method as above.
[0076] Sequencing results correctly identified the transaminase mutant engineered bacteria E. coli BL21 / pET30a-CvATA-N118G / G225A and E. coli BL21 / pET30a-CvATA-N118G / C418T. Sequencing results showed that the codon GGC encoding glycine (G) at position 225 mutated to GCG encoding alanine (A), and the codon TGT encoding cysteine (C) at position 418 mutated to ACC encoding threonine (T). The amino acid sequences of the mutants N118G / G225A and N118G / C418T are SEQ ID NO. 6 and SEQ ID NO. 7.
[0077] Furthermore, using the pET30a-CvATA-N118G / G225A plasmid as a template, a transaminase mutant engineered bacterium E. coli BL21 / pET30a-CvATA-N118G / G225A / C418T was obtained, and the corresponding amino acid sequence is SEQ ID NO.8.
[0078] Example 2: Inducible expression of each mutant
[0079] The engineered bacteria expressing the wild enzyme and the engineered bacteria expressing each mutant constructed in Example 1 were inoculated into 5 mL LB liquid culture medium containing 50 μg / mL kanamycin and cultured at 37°C for 18 h. Then, a 1% inoculum (v / v) was inoculated into 50 mL LB medium containing 50 μg / mL kanamycin and cultured at 37°C and 220 rpm until the bacterial concentration OD600 When the pH reached about 0.6, IPTG was added to a final concentration of 0.1 mmol / L and cultured at 25°C and 220 rpm for 16 h. The wet cells were collected by centrifugation at 4°C and 3500 rpm for 10 min to obtain wet cells of engineered bacteria expressing wild enzymes and engineered bacteria expressing various mutants.
[0080] Example 3: Preparation of (R)-3-aminobutanol by various mutants at a substrate concentration of 1.8 g / L
[0081] A NaH2PO4-Na2HPO4 buffer solution with a pH of 7.5 containing 9 g / L alanine, 0.25 g / L pyridoxal phosphate, 1.8 g / L 4-hydroxy-2-butanone, and 10% isopropanol was prepared as a reaction solution.
[0082] The wet cells of each mutant obtained in Example 2 were resuspended in the reaction solution to a wet cell content of 50 g / L to prepare the reaction system solution. 1 mL of this reaction system solution was placed in a constant temperature shaker at 37°C and 220 rpm for 4 hours. After the reaction, the mixture was extracted with ethyl acetate and centrifuged. Vacuum evaporation was performed at 37°C for 1.5 hours, and then reconstituted with a liquid mobile phase (aqueous perchloric acid solution with a pH of 1.0).
[0083] The yield and ee value were determined by high performance liquid chromatography (HPLC). The liquid chromatogram of the (S / R)-3-aminobutanol standard was as shown in FIG. Figure 3 The final measured product ee value and yield are shown in Table 2.
[0084] Table 2. ee values and yields of (R)-3-aminobutanol prepared by various mutants
[0085] Mutant description Yield (%) ee(%) Wild-type CvATA 29.6 28.3(R) N118G 22.1 >99(R) G225A 44.0 33.8(R) C418T 32.7 30.0(R) N118G / G225A 41.1 >99(R) N118G / C418T 24.8 >99(R) N118G / G225A / C418T 45 >99(R)
[0086] Experimental analysis shows that compared to the wild-type transaminase CvATA from Chromobacterium violaceum, the transaminase mutant provided by the present invention exhibits superior catalytic activity and high stereoselectivity. The CvATA mutant achieves a maximum space-time yield of 4.8 g / L / day for the synthesis of chiral amines, an ee value exceeding 99%, and high optical purity. Furthermore, the catalyst is easy to prepare, operates under mild reaction conditions, has a wide substrate adaptability, and is environmentally friendly. It is highly effective in catalyzing the asymmetric amination of prochiral ketones, demonstrating promising prospects for industrial application.
[0087] The above shows and describes the basic principles, main features and advantages of the present invention. Those skilled in the art should understand that the above embodiments do not limit the present invention in any form, and any technical solutions obtained by equivalent replacement or equivalent transformation fall within the scope of protection of the present invention.
Claims
1. A highly stereoselective transaminase mutant, characterized in that: The amino acid sequence of the transaminase mutant is shown in SEQ ID NO.
8.
2. A transaminase mutant gene, characterized in that: The gene is used to encode the highly stereoselective transaminase mutant according to claim 1.
3. A recombinant expression vector, characterized in that: The recombinant expression vector comprises a gene encoding the amino acid sequence of the highly stereoselective transaminase mutant according to claim 1.
4. The recombinant expression vector according to claim 3, wherein The recombinant expression vector uses pET30a as a vector plasmid.
5. A genetically engineered bacterium for producing the highly stereoselective aminotransferase mutant according to claim 1, characterized in that: The genetically engineered bacteria comprises the recombinant expression vector according to claim 3 or 4.
6. The genetically engineered bacterium according to claim 5, wherein The host bacteria is Escherichia coli.
7. Use of the highly stereoselective transaminase mutant according to claim 1 in the preparation of (R)-3-aminobutanol, characterized in that: The application includes the asymmetric catalytic amination of 4-hydroxy-2-butanone to (R)-3-aminobutanol under the condition of adding an amine donor.
8. The use according to claim 7, characterized in that The application includes: using wet bacteria obtained by centrifugation after fermentation and culture of an engineered bacterium containing a transaminase mutant encoding gene, immobilized wet bacteria cells, enzymes extracted after ultrasonic disruption of wet bacteria, or immobilized enzymes as catalysts, adding alanine and pyridoxal phosphate, using 4-hydroxy-2-butanone as a substrate, using a buffer solution with a pH value of ≤8 containing an organic solvent as a reaction medium, reacting at 25-37°C and 150-300rpm, and after the reaction is completed, separating and purifying the reaction solution to obtain (R)-3-aminobutanol.
9. The use according to claim 8, characterized in that In the reaction system, the concentration of the substrate is 0.5-2 g / L, the concentration of alanine is 2-10 g / L, the concentration of pyridoxal phosphate is 0.2-0.4 g / L, the organic solvent is isopropanol or dimethyl sulfoxide, the volume fraction is 8-12%, and the amount of the catalyst is 20-100 g / L based on the weight of the wet bacteria, wherein the water content of the wet bacteria is 70-90%.
Citation Information
Patent Citations
Biological preparation method of R-3-aminobutanol
CN104131048A
Transaminase derived from actinomyces, mutant, recombinant bacteria and application
CN108823179A
Transaminase mutant and application thereof
CN116064449A
Transaminase mutant, coding gene and application of transaminase mutant
CN116334022A