S2 feeder cells, preparation method and application thereof

Abstract

The present invention discloses an S2 feeder cell, a preparation method and an application thereof, wherein the S2 feeder cell contains a gene sequence expressing a CD3 / CD28 antibody Fab segment, and the gene sequence is shown in SEQ ID NO: 1. The target gene is transfected into insect S2 cells to obtain S2 feeder cells, and the S2 feeder cells express the CD3 / CD28 antibody Fab segment on the cell surface, which can effectively activate and amplify T cells. Compared with the prior art, the technical solution of the present invention does not require magnetic beads or antibody coating, does not require antibody purification and other steps, and reduces the cost of T cell activation and amplification.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to an S2 feeder cell, a preparation method and application thereof. Background Art

[0002] T cell immunotherapy is an important part of tumor immunotherapy, which attacks cancer cells by changing the patient's immune system. When using T cell immunotherapy, T cells need to be activated. T cell activation means that they enter an active state from a dormant state in order to perform their immune functions.

[0003] T cell activation is currently generally achieved by co-culturing T cells with CD3 / CD28 antibody-coated magnetic beads to stimulate T cell activation and expansion. Since CD3 / CD28 antibody-coated magnetic beads are very expensive, a large number of magnetic beads are required to expand T cells, resulting in high costs for T cell activation. Summary of the invention

[0004] The main purpose of the present invention is to propose an S2 feeder cell, a preparation method and an application thereof, and to express the CD3 / CD28 antibody Fab segment on the surface of the S2 feeder cell, so as to activate and amplify T cells, aiming to solve the problem that the current CD3 / CD28 antibody-coated magnetic beads are very expensive, a large number of magnetic beads are needed when amplifying T cells, resulting in high cost of T cell activation.

[0005] To achieve the above object, the present invention provides an S2 feeder cell, wherein the S2 feeder cell contains a gene sequence for expressing a CD3 / CD28 antibody Fab segment, and the gene sequence is shown in SEQ ID NO:1.

[0006] The present invention provides a method for preparing S2 feeder cells, comprising the following steps:

[0007] S10, cloning the gene sequence combined with the FLAG tag into an expression vector to obtain a recombinant vector;

[0008] S20, transfecting the recombinant vector and the resistance plasmid into insect S2 cells to obtain S2 feeder cells.

[0009] Optionally, in step S10, the expression vector is pAc5.1 / V5-His A.

[0010] Optionally, the resistance plasmid is a pCoBlast plasmid.

[0011] Optionally, in step S10, the gene sequence of the FLAG tag is as shown in SEQ ID NO:2.

[0012] Optionally, step S10 includes:

[0013] S11, codon optimization of the original gene sequence of the CD3 / CD28 antibody Fab segment combined with the FLAG tag was performed, and the gene sequence shown in SEQ ID NO: 1 was synthesized;

[0014] S12, designing primers according to the gene sequence shown in SEQ ID NO: 1;

[0015] S13, amplifying by PCR amplification technology to obtain the gene sequence of the CD28 / CD3 antibody Fab segment;

[0016] S14, connecting the gene of the CD28 / CD3 antibody Fab segment after PCR and the expression vector through seamless cloning to obtain a recombinant vector.

[0017] Optionally, in step S12, the primers include:

[0018] P1: 5'-TCCAGAGACCCCGGATCGGGGTACCATGCAGTGCAACTAGTGCAGA G-3';

[0019] P2: 5'-AGGCTGATCAGCGGGTTTAAAACTCACAATGACTCAGGAAACACA-3';

[0020] P3 5'-TGAGTTTTAAACCCGCTGATCAGCCT-3';

[0021] P4 5'-GGTACCCCGATCCGGGGTCTCTGGA-3'.

[0022] Optionally, the gene sequence of the original CD3 / CD28 antibody Fab segment combined with a FLAG tag is shown in SEQ ID NO:3.

[0023] Optionally, step S20 includes:

[0024] S21, transfecting the recombinant vector into bacterial competent cells to obtain transfected cells;

[0025] S22, extracting the recombinant vector in the transfected cells;

[0026] S23, transfecting the recombinant vector and the resistance plasmid extracted in step S22 into insect S2 simultaneously to obtain S2 feeder cells.

[0027] The present invention provides an application of the S2 feeder cells in preparing activated and amplified T cell preparations.

[0028] In the technical solution provided by the present invention, the gene sequence of the CD3 / CD28 antibody Fab segment obtained after codon optimization is shown in SEQ ID NO: 1, and the target gene is transfected into insect S2 cells. The insect S2 cells express the CD3 / CD28 antibody Fab segment on the surface of S2 feeder cells, which can effectively activate and amplify T cells. Compared with the prior art, the technical solution of the present invention does not require magnetic bead coating, purification and other steps, thereby reducing the cost of T cell activation and amplification. BRIEF DESCRIPTION OF THE DRAWINGS

[0029] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without paying creative work.

[0030] Figure 1 The protein gel electrophoresis diagram for verifying successful transfection of the recombinant vector provided in Example 3 of the present invention;

[0031] Figure 2 This is a diagram showing the survival status of S2 feeder cells in T cell culture medium provided in Example 3 of the present invention;

[0032] Figure 3 This is a diagram showing the effect of S2 cells and S2 feeder cells provided in Example 3 of the present invention on the activation of human T lymphocyte tumor cells;

[0033] Figure 4 This is a diagram showing the effect of S2 feeder cells provided in Example 3 of the present invention on the activation of primary CD4 T cells;

[0034] Figure 5 This is a diagram showing the effect of S2 feeder cells on primary CD8 T cell activation provided in Example 3 of the present invention;

[0035] Figure 6 This is a diagram showing the effect of S2 feeder cells on T cell proliferation provided in Example 3 of the present invention. DETAILED DESCRIPTION

[0036] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0037] T cell immunotherapy is an important part of tumor immunotherapy. It attacks cancer cells by changing the patient's immune system. When using T cell immunotherapy, T cells need to be activated. T cell activation means that they enter an active state from a dormant state in order to perform their immune functions. T cell activation is currently generally achieved by co-culturing T cells with CD3 / CD28 antibody-coated magnetic beads to stimulate T cell activation and expansion. Since CD3 / CD28 antibody-coated magnetic beads are very expensive, a large number of magnetic beads are needed to amplify T cells, resulting in high costs for T cell activation.

[0038] In view of this, the present invention provides an S2 feeder cell, wherein the S2 feeder cell contains a gene sequence for expressing a CD3 / CD28 antibody Fab segment, and the gene sequence is shown in SEQ ID NO:1.

[0039]

[0040] In the above technical solution, the target gene is transfected into insect S2 cells to obtain S2 feeder cells. The S2 feeder cells express the CD3 / CD28 antibody Fab fragment on the surface of the S2 feeder cells, which can effectively activate and amplify T cells. Compared with the prior art, the technical solution of the present invention does not require magnetic bead coating, purification and other steps, thereby reducing the cost of T cell activation and amplification.

[0041] The present invention provides a method for preparing S2 feeder cells, comprising the following steps:

[0042] S10, cloning the gene sequence combined with the FLAG tag into an expression vector to obtain a recombinant vector;

[0043] S20, transfecting the recombinant vector and the resistance plasmid into insect S2 to obtain S2 feeder cells.

[0044] In the above steps, T cells can be activated and amplified by expressing the CD28 / CD3 antibody Fab fragment on the surface of S2 feeder cells, which greatly reduces the cost. At the same time, since insect S2 feeder cells are completely unable to survive in the culture medium of T cells, other substances will not be introduced to contaminate T cells while activating and amplifying T cells in this way.

[0045] Furthermore, in step S10, the expression vector is pAc5.1 / V5-His A, and the recombinant vector constructed by the target gene and the expression vector pAc5.1 / V5-His A can stably exist in the S2 feeder cells and be inherited to the next generation.

[0046] Furthermore, the resistance plasmid is a pCoBlast plasmid, which protects the transfected S2 feeder cells from external antibiotic attacks.

[0047] Furthermore, the gene sequence of the FLAG tag is shown in SEQ ID NO: 2, specifically GACTACAAGGATGACGATGATAAA, which acts as a marking tag. In protein expression and localization studies, the target gene to be studied and the FLAG-tag gene sequence can be connected by genetic engineering technology, and can be connected to the C-terminus or N-terminus of the target protein, and then the integrated gene is transferred into cells or embryonic stem cells or fertilized eggs. Subsequent detection is mainly achieved through the specific binding of the immune determinant cluster formed by the FLAG-tag peptide chain and its monoclonal antibody, and the detection methods include immunofluorescence, Western Blotting, etc.

[0048] Further, step S10 includes:

[0049] S11, codon optimization of the original gene sequence of the CD3 / CD28 antibody Fab segment combined with the FLAG tag was performed, and the gene sequence shown in SEQ ID NO: 1 was synthesized;

[0050] Specifically, the CD3 / CD28 antibody Fab segment gene sequence of the present application carries a FLAG tag for easy labeling and tracking.

[0051] S12, designing primers according to the gene sequence shown in SEQ ID NO: 1;

[0052] S13, amplifying by PCR amplification technology to obtain the gene sequence of the CD28 / CD3 antibody Fab segment;

[0053] Specifically, the PCR amplification system is shown in Table 1.

[0054] Table 1

[0055] Reagents dose Double distilled water 22μL DNA template 1μL Forward primer (10 μM) 1μL Reverse primer (10 μM) 1μL 2×PCR mix 25μL

[0056] Reaction conditions: denaturation at 94°C for 5 min, followed by 40 cycles of denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 2 min. After 40 cycles, a final extension at 72°C for 10 min was performed. PCR products were detected by 1% agarose gel electrophoresis.

[0057] S14, connecting the gene of the CD28 / CD3 antibody Fab segment after PCR and the expression vector through seamless cloning to obtain a recombinant vector.

[0058] The CD28 / CD3 antibody Fab segment is cloned into the expression vector, and the formed recombinant vector can be stably expressed in insect S2 and can be stably passed on to the next generation.

[0059] Further, in step S12, the primers include:

[0060] P1

[0061] 5'-TCCAGAGACCCCGGATCGGGGTACCATGCAGGTGCAACTAGTGCAGA G-3';

[0062] P2

[0063] 5'-AGGCTGATCAGCGGGTTTAAAACTCACAATGACTCAGGAAACACA-3';

[0064] P3 5'-TGAGTTTTAAACCCGCTGATCAGCCT-3';

[0065] P4 5'-GGTACCCCGATCCGGGGTCTCTGGA-3'.

[0066] Specifically, P1 and P2 amplify the CD28 / CD3 antibody Fab gene fragment, and P3 and P4 amplify the vector fragment, wherein the P1 nucleotide sequence is shown in SEQ ID NO:4, the P2 nucleotide sequence is shown in SEQ ID NO:5, the P3 nucleotide sequence is shown in SEQ ID NO:6, and the P4 nucleotide sequence is shown in SEQ ID NO:7.

[0067]

[0068] Further, step S20 includes:

[0069] S21, transfecting the recombinant vector into bacterial competent cells to obtain transfected cells;

[0070] S22, extracting the recombinant vector in the transfected cells;

[0071] S23, transfecting the recombinant vector and the resistance plasmid extracted in step S22 into insect S2 simultaneously to obtain S2 feeder cells.

[0072] In the above technical solution, the recombinant vector is first transfected into bacterial competent cells, and after verification, the recombinant vector is extracted and transfected into insect S2.

[0073] The technical solution of the present invention is further described in detail below in conjunction with specific embodiments and drawings. It should be understood that the following embodiments are only used to explain the present invention and are not used to limit the present invention.

[0074] Material

[0075] LB medium: tryptone 10 g / L, yeast extract 5 g / L, sodium chloride 10 g / L;

[0076] Sf900 serum-free medium: purchased from Thermo Fisher Scientific;

[0077] T cell culture medium: 435 ml RPMI-1640 medium supplemented with 50 ml heat-inactivated fetal bovine serum, 5 ml penicillin-streptomycin, 5 ml sodium pyruvate, 5 ml non-essential amino acids, 10 ml 4-hydroxyethylpiperazineethanesulfonic acid, and 1.9 μl β-mercaptoethanol.

[0078] Example 1 Construction of CD3 / CD28 Fab-FLAG tag protein expression vector

[0079] 1) Based on species-preferred expression, the original CD28 / CD3 Fab-FLAG gene sequence was codon optimized, and the optimized gene sequence is shown in SEQ ID NO: 1;

[0080] 2) Based on the optimized gene sequence, the primers are designed as follows:

[0081] P1

[0082] 5'-TCCAGAGACCCCGGATCGGGGTACCATGCAGGTGCAACTAGTGCAGAG-3';

[0083] P2

[0084] 5'-AGGCTGATCAGCGGGTTTAAAACTCACAATGACTCAGGAAACACA-3';

[0085] P3 5'-TGAGTTTTAAACCCGCTGATCAGCCT-3';

[0086] P4 5'-GGTACCCCGATCCGGGGTCTCTGGA-3'.

[0087] 3) PCR amplification to obtain the target fragment SEQ ID NO: 1;

[0088] The synthesized DNA was amplified by PCR to obtain the target fragment. The specific operation is as follows:

[0089] Reagents dose Double distilled water 22μL DNA template 1μL Forward primer (10 μM) 1μL Reverse primer (10 μM) 1μL 2×PCR mix 25μL

[0090] Reaction conditions: denaturation at 94°C for 5 min, followed by 40 cycles of denaturation at 94°C for 30 s, annealing at 60°C for 30 s, and extension at 72°C for 2 min. After 40 cycles, a final extension at 72°C for 10 min was performed. PCR products were detected by 1% agarose gel electrophoresis.

[0091] 4) PCR products were recovered by gel electrophoresis

[0092] (1) Prepare 500 mL of 1×TAE (10 mL of 50×TAE diluted in 490 mL of deionized water);

[0093] (2) Prepare 1% agarose gel, heat to boiling, add 1 μL of Gelred dye, introduce into the gel mold and insert a large-tooth comb;

[0094] (3) Carefully apply the sample to an agarose gel and electrophoresed at 100 volts for approximately 20 minutes.

[0095] (4) Gel imaging, then use ultraviolet light to locate the target band, cut out the band that is consistent with the predicted size and position, and place it in a 1.5 mL Eppendorf centrifuge tube (EP tube);

[0096] (5) Weigh immediately, remove the weight of the empty 1.5 mL EP tube, and mark it;

[0097] (6) Use the gel recovery kit from Zymo Research to recover the sample band according to the instructions.

[0098] 5) Recombination ligation using seamless ligation kit

[0099] Use the HB-infusion kit of Hanheng Biotechnology Co., Ltd., 50ng of insert fragment (CD28 / CD3 Fab-FLAG gene), 50ng of pAc5.1 / V5-His A plasmid fragment (expression vector), 5μL 2× reaction buffer, add water to 10μL; connect at 50℃ for 0.5h, and use it to transform competent cells.

[0100] 6) Transformation experiment

[0101] Take out the TOP10 E. coli stored at -80℃ and thaw on ice. Pipette 5μL of the recombinant vector into a centrifuge tube containing competent cells and incubate on ice for 20-25min to allow DNA to adsorb to the cell surface. Heat shock in a 42℃ water bath for 90s. Then immediately put it in an ice bath, add 1mL of LB medium after 2min on ice, and oscillate to mix, so that the cells recover from heat shock and resume growth. Incubate on a 37℃ shaker for 45-60min. Spread 100μL on a plate containing ampicillin. Incubate in a 37℃ constant temperature incubator overnight. After overnight incubation, carefully pick up the single colony with a pipette tip into an EP tube containing 800μL LB medium. Incubate on a 37℃ shaker for 4 hours, and then use PCR technology to detect whether there is a target fragment. Those identified as positive were sent to Shanghai Shenggong Biological Co., Ltd. for sequencing.

[0102] 7) Plasmid extraction

[0103] (1) Cultivate 100 mL of transformed E. coli overnight;

[0104] (2) Extract the recombinant vector according to the instructions of the plasmid extraction kit provided by Omega Biotechnology Co., Ltd.

[0105] (3) Use Nanodrop to measure the concentration of the extracted plasmid.

[0106] Example 2S2 Establishment of feeder cells

[0107] 1) Passaging of insect S2 cells

[0108] Insect S2 cells were cultured in Sf900 serum-free medium. The cells grew in clusters. Every 3-4 days, the cells were passaged at a ratio of 1:2 to 1:5. The cells were cultured at 24°C until the density reached 6-20x 106 cells / mL.

[0109] 2) Recombinant vector infects insect S2 cells

[0110] Refer to the operation protocol of Invitrogen's calcium phosphate transfection kit, the specific steps are as follows:

[0111] (1) Inoculation 3×106 The insect S2 cells were cultured in 60 mm tissue culture dishes and the culture medium was Sf-900II SFM for S2 cells.

[0112] (2) In a sterile 1.5 mL centrifuge tube, add 233 μL of double distilled water, 36 μL of 240 mM calcium chloride, 19 μL of 1 μg / μL LCD3 / CD28 Fab-FLAG-pAc5.1 / V5-His A plasmid, and 2 μL of 0.5 μg / μL pCoBlast plasmid in sequence;

[0113] (3) After slowly mixing for 1 min, transfer to a centrifuge tube containing 200 μL of 2× HEPES HBS and mix well;

[0114] (4) leaving the mixture at room temperature for 30-40 min;

[0115] (5) Slowly add the mixture to the cell culture medium and mix thoroughly;

[0116] (6) Culture in a constant temperature incubator at 24°C for 1 day;

[0117] (7) Changing the cell culture medium;

[0118] (8) After culturing at 24°C for two days, 20 μg / mL Blasticidin was added to screen clones and establish a stable transfected cell line.

[0119] Example 3S2 Validation of Feeder Cells

[0120] 1) Extract proteins from transfected insect S2 cells and perform protein gel electrophoresis, such as Figure 1 As shown, the FLAG tag band can be detected at the target 42Kd in the transfected cells, indicating that the recombinant vector transfection is successful. Figure 1 Feeder in the figure indicates S2 feeder cells, and actin indicates actin bands.

[0121] 2) Cultivate the S2 feeder cells in T cell culture medium and observe their growth, such as Figure 2 As shown, S2 feeder cells were cultured alone in T cell culture medium, and flow cytometry was performed 2 days later, and the results showed that almost all cells underwent apoptosis. Figure 2 In the table, SF900 medium is SF900 medium, T cell culture medium is T cell culture medium, the FSC-A abscissa is the forward scattering area, and the SSC-A ordinate is the side scattering area.

[0122] 3) S2 cells and S2 feeder cells were co-cultured with T cells at different ratios. After 1 day, the expression levels of T cell activation biomarkers, such as CD25, CD69 and HLA-DR, were detected by flow cytometry. Figure 3 As shown, the results show that S2 cells have no effect on T cell activation, while S2 feeder cells can regulate the expression levels of T cell CD25, CD69 and HLA-DR by adjusting the amount of S2 feeder cells within a certain basic range, thereby promoting T cell activation. Figure 3 In the figure, CD25 MFI is the mean fluorescence intensity of leukocyte differentiation antigen 25, CD69 MFI is the mean fluorescence intensity of leukocyte differentiation antigen 69, HLA-DR is human leukocyte antigen-DR isotype, Feeder is S2 feeder cells, S2 is untransfected insect S2 cells, and the abscissas in Figures A, B, and C are the ratios of S2 feeder cells and untransfected insect S2 cells to T cells.

[0123] 4) Purchase purified human primary T cells, S2 cells or S2 feeder cells from Miaoshun Biotechnology and co-culture them with T cells in different ratios. Figure 4 and 5 As shown, the results showed that S2 cells had no effect on T cell activation, while S2 feeder cells could upregulate the expression levels of CD25, CD69 and HLA-DR in CD4 T cells and CD8 T cells in a dose-dependent manner, promoting T cell activation. Figure 4 In the figure, CD4+T cells are CD4 T cells, CD4 is leukocyte differentiation antigen 4, %HLA-DR+in CD4+T cells is the content of human leukocyte antigen-DR isotype in CD4 T cells, %CD69+in CD4+T cells is the content of leukocyte differentiation antigen 69 in CD4 T cells, %CD25+in CD4+T cells is the content of leukocyte differentiation antigen 25 in CD4 T cells, Feeder is S2 feeder cells, S2 is untransfected insect S2 cells, and the horizontal axes in Figures A, B, and C are the ratios of S2 feeder cells and untransfected insect S2 cells to T cells. Figure 5 In the text, %CD69+in CD8+T cells is the content of leukocyte differentiation antigen 69 in CD8 T cells, %CD25+in CD8+T cells is the content of CD8 T cells, %HLA-DR+in CD8+T cells is the content of human leukocyte antigen-DR isotype in CD8 T cells, and the meanings of the remaining English words are the same as Figure 4 The same as in.

[0124] 5) T cells were labeled with CFSE dye and co-cultured with S2 or S2 feeder cells at different ratios. Cell proliferation was detected after 7 days. Figure 6 As shown, the results show that the CFSE fluorescence intensity is the lowest in T cells co-cultured with S2 feeder cells, indicating that these T cells proliferate the fastest. Figure 6 In Figure A, Feeder CFSE MFI / S2 CFSE MFI (%) is the ratio of the average fluorescence intensity of carboxyfluorescein diacetate succinimidyl ester of T cells cultured with S2 feeder cells to the average fluorescence intensity of carboxyfluorescein diacetate succinimidyl ester of T cells cultured with S2 cells; the abscissa is the ratio of S2 feeder cells and untransfected insect S2 cells to T cells; in Figure B, the ordinate is the average fluorescence intensity, the abscissa is carboxyfluorescein diacetate succinimidyl ester, T cells+0.2S2 means T cells are cultured with 0.2 times S2 cells, and T cells+0.2 S2 Feeder means T cells are cultured with 0.2 times S2 feeder cells.

[0125] The above are only preferred embodiments of the present invention, and do not limit the patent scope of the present invention. For those skilled in the art, the present invention may have various changes and modifications. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the patent protection scope of the present invention.

Claims

1. An S2 feeder cell, characterized in that The S2 feeder cells contain a gene sequence expressing the Fab segment of the CD3 / CD28 antibody, and the gene sequence is shown in SEQ ID NO: 1; The S2 feeder cells are used for co-culture with T cells.

2. A method for preparing S2 feeder cells, characterized in that: The following steps are involved: S10, cloning the gene sequence of claim 1 combined with the FLAG tag into an expression vector to obtain a recombinant vector; S20, transfecting the recombinant vector and the resistance plasmid into insect S2 cells to obtain S2 feeder cells.

3. The method for preparing S2 feeder cells according to claim 2, characterized in that: In step S10, the expression vector is pAc5.1 / V5-His A.

4. The method for preparing S2 feeder cells according to claim 2, characterized in that: The resistance plasmid is pCoBlast plasmid.

5. The method for preparing S2 feeder cells according to claim 2, characterized in that: In step S10, the gene sequence of the FLAG tag is shown as SEQ ID NO:

2.

6. The method for preparing S2 feeder cells according to claim 2, characterized in that: Step S10 includes: S11, codon optimization of the original gene sequence of the CD3 / CD28 antibody Fab segment combined with the FLAG tag was performed, and the gene sequence shown in SEQ ID NO: 1 was synthesized; S12, designing primers according to the gene sequence shown in SEQ ID NO: 1; S13, amplifying by PCR amplification technology to obtain the gene sequence of the CD28 / CD3 antibody Fab segment; S14, connecting the gene of the CD28 / CD3 antibody Fab segment after PCR and the expression vector through seamless cloning to obtain a recombinant vector.

7. The method for preparing S2 feeder cells according to claim 6, characterized in that: In step S12, the primers include: P1: 5'-TCCAGAGACCCCGGATCGGGGTACCATGCAGGTGCAACTAGTGCAGAG-3'; P2: 5'-AGGCTGATCAGCGGGTTTAAAACTCACAATGACTCAGGAAACACA-3'; P3 5'-TGAGTTTTAAACCCGCTGATCAGCCT-3'; P4 5'-GGTACCCCGATCCGGGGTCTCTGGA-3'.

8. The method for preparing S2 feeder cells according to claim 6, characterized in that: The gene sequence of the original CD3 / CD28 antibody Fab segment combined with a FLAG tag is shown in SEQ ID NO:

3.

9. The method for preparing S2 feeder cells according to claim 2, characterized in that: Step S20 includes: S21, transfecting the recombinant vector into bacterial competent cells to obtain transfected cells; S22, extracting the recombinant vector in the transfected cells; S23, transfecting the recombinant vector and the resistance plasmid extracted in step S22 into insect S2 cells simultaneously to obtain S2 feeder cells.

10. Use of the S2 feeder cells according to claim 9 in preparing an activated and expanded T cell preparation.

11. A use of the S2 feeder cells in activating and expanding T cells, characterized in that: The S2 feeder cells include the S2 feeder cells according to claim 1, or the S2 feeder cells prepared by the method for preparing S2 feeder cells according to any one of claims 2 to 9; The S2 feeder cells are used for co-culture with T cells.

Images