Method for constructing a PRMT2 gene mutant and a tilapia antibacterial strain

Abstract

The present invention relates to molecular biology and aquaculture breeding, specifically to a method for obtaining a PRMT2 gene mutant by knocking out the gene based on CRISPR / Cas9 technology, and establishing an antibacterial strain of tilapia with a PRMT2 knockout. By knocking out this gene, a tilapia strain resistant to Streptococcus agalactiae can be obtained. Infection experiments revealed that tilapia with a PRMT2 knockout gene exhibited enhanced antibacterial activity compared to wild-type tilapia. This invention provides an important model for disease-resistant tilapia breeding and offers gene targets and new research directions for creating more disease-resistant fish strains and varieties.

Description

Technical Field

[0001] The present invention belongs to the fields of molecular biotechnology and aquaculture breeding, and specifically relates to a method for obtaining a prmt2 gene mutant by knocking out the gene based on CRISPR / Cas9 technology, and establishing an antibacterial tilapia strain with the prmt2 gene knockout. By knocking out the gene, a tilapia strain resistant to Streptococcus agalactiae can be obtained. Background Art

[0002] Tilapia (Tilapia) is a small to medium-sized fish of the family Cichlidae, order Perciformes, genus Tilapia. Also known as Vietnamese crucian carp, Vietnamese fish, South Sea crucian carp, golden phoenix fish, and tilapia in Guangdong, it is also known as the "longevity fish." Tilapia is native to Africa and closely resembles another common freshwater fish, the crucian carp, earning it the nickname "African crucian carp." Tilapia has few bones, a firm and plump texture, and is high in protein and essential amino acids, making it a highly nutritious option for European and American palates. It is therefore known as the "white salmon" and the "fish of the 21st century." It is a freshwater farmed fish that is the focus of research and development in the global aquaculture industry and is hailed as one of the future's main sources of animal protein. In recent years, it has become a hotspot for farming, processing, and export.

[0003] Tilapia is a tropical fish primarily found in Guangdong, Hainan, Guangxi, and Fujian. In recent years, the rise of large-scale intensive aquaculture, coupled with its tropical habitat, has led to repeated outbreaks of streptococcosis in tilapia. This highly contagious, lethal, and widespread disease has caused significant economic losses to the tilapia industry. While antibiotics and other preventative measures have proven effective, they pose drawbacks such as drug residues, drug resistance, and environmental pollution, making them difficult to meet the demands of sustainable, green aquaculture development. Therefore, the development of disease-resistant tilapia varieties is urgently needed.

[0004] Based on advances in fish genetics and genomics, current fish breeding techniques primarily include family and population selection, molecular marker-assisted selection, and whole-genome selection, all of which have been successfully applied to a wide range of farmed fish. However, breeding for disease resistance in fish primarily relies on phenotypic screening, where disease is introduced generation after generation. This approach suffers from drawbacks such as long breeding cycles and inconsistent results. Therefore, finding an efficient and stable breeding technique is crucial for promoting the development of disease-resistant varieties of farmed fish in my country.

[0005] In 2013, Cell, Science, Nature Biotechnology, and other journals reported almost simultaneously on a novel genome editing method: CRISPR / Cas9 (Clustered regularly interspaced shortpalindromic repeats—CRISPR associated system). Compared with traditional gene editing technologies, this system offers advantages such as excellent targeting, simple construction, and the ability to manipulate multiple genes simultaneously.

[0006] CRISPR / Cas9, a genome-specific editing technology developed in recent years, has the following outstanding features: direct blocking of DNA transcription with higher and more accurate blocking levels; simultaneous editing of multiple targets; ability to achieve reversible gene silencing; high silencing efficiency; simple vector construction, requiring only the design of sgRNA for the target gene.

[0007] These significant advantages make this technology a powerful tool for the advancement of human medicine, animal research, and plant breeding, and it is a powerful tool for studying gene function. In recent years, CRISPR / Cas9 technology has been widely used in zebrafish, a model animal, to study related scientific issues. However, due to the long maturation period of farmed fish and the difficulty of manipulation, gene editing technology has been less widely used in farmed fish. CRISPR / Cas9 gene editing technology has opened up new directions for fish breeding.

[0008] Arginine methyltransferase (PRMT) family proteins and the arginine methylation they mediate are closely associated with the development and progression of diseases. Arginine methylation mediated by the protein arginine methyltransferase (PRMT) family is a widespread post-translational modification in eukaryotes, playing a key role in numerous biological processes, including transcription, cell signaling, pre-mRNA splicing, and DNA damage signaling. PRMTs use S-adenosyl-methionine (SAM) as a methyl donor to transfer a methyl group to the nitrogen atom of the arginine side chain of proteins, generating S-adenosyl-l-homocysteine ​​and methylarginine. PRMT2, a key member of the PRMT family, contains a highly conserved catalytic Ado-Met binding domain and a unique Src homology domain that binds proteins with proline-rich motifs. PRMT2 plays a crucial role in regulating cell signaling and gene expression by methylating histone and non-histone proteins. Studies have shown that members of the PRMT family (such as PRMT3, PRMT6, and PRMT7) have the ability to negatively regulate anti-disease immune responses. At the same time, PRMT2 can weaken the zebrafish's antiviral innate immune response by inhibiting the activation of TRAF6. After knocking out the PRMT2 gene, the zebrafish's resistance to carp spring viremia virus is significantly improved.

[0009] There has been no research on whether the prmt2 gene is relevant to fish resistance to bacterial infection and whether it is a breeding target gene. Summary of the Invention

[0010] The present invention aims to provide an application of the prmt2 gene, and to obtain a tilapia strain with disease resistance by knocking out and editing the prmt2 gene.

[0011] Another object of the present invention is to provide a method for constructing a disease-resistant model of tilapia with a prmt2 gene knockout by optimizing and improving CRISPR / Cas9 technology. The present invention uses CRISPR / Cas9 technology to obtain sgRNA and Cas9 protein to construct a tilapia model with a stable prmt2 gene knockout. Tilapia with stable prmt2 gene knockout show good disease resistance.

[0012] In order to achieve the above object, the technical solution provided by the present invention is:

[0013] The prmt2 gene can be used to construct antibacterial strains of tilapia, especially strains resistant to streptococcal infection.

[0014] Another technical solution of the present invention is a specific target site sgRNA of the prmt2 gene, which targets the sequence shown in SEQ ID No. 1 in exon 1 of the prmt2 gene.

[0015] SEQ ID No.1: GGTGGTGGGCAGAGCTGCAG

[0016] Furthermore, the specific target site sgRNA of the prmt2 gene is characterized by containing the nucleotide sequence shown in SEQ ID No.5.

[0017] SEQ ID No.5: GGUGGUGGGCAGAGCUGCAGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGGCUUUU

[0018] Preferably, the specific target site sgRNA nucleotide sequence of the prmt2 gene is shown as SEQ ID No.5.

[0019] A PRMT2 gene mutant, wherein nucleotides 209-228 in exon 1 are gene-edited.

[0020] Furthermore, the T and G bases at positions 224 and 225 are deleted in exon 1 of the prmt2 gene mutant.

[0021] Preferably, the sequence of exon 1 of the prmt2 gene mutant is shown as SEQ ID No.6.

[0022] SEQ ID No.6: ATGATGCGTCCTGTGAGGAGTATGTTGCCCGGTCAGATTTCACTGGAAGTGGCACCGATCAGGTCAGAGAGACCCGCAAACCTCAGAGATCCTAACCTTAAAACGGGAGGTGGGGGTATCAGCAATAACCGTGTGACTTGTTTTGTCTCACAGCTTAGTTTCAGCAGAGGGG ACAGACTGCTTGTACACGCCAAGCCCTCCTCAGAGTGGTGGTGGGCAGAGCCAGGGGGTCATAGGTTATGTCCCTGCCGGCTACCTGAGCCAGGATGCTGCAGGGGAGGAGGAGGAGGACCCCTCAATAGAAGACCCGTGGCAAGATGAAGAATACTTTGGCAATTATGGAACGCTG.

[0023] The specific target site sgRNA of the prmt2 gene or the prmt2 gene mutant can be used to cultivate antibacterial tilapia strains, especially tilapia strains resistant to streptococcal infection.

[0024] Tilapia with a knockout of the PRMT2 gene, particularly one with a mutation in exon 1 of the PRMT2 gene, have improved resistance to bacterial infection. Specifically, tilapia with a mutation in nucleotides 209-228 of exon 1 of the PRMT2 gene have improved resistance to bacterial infection.

[0025] In a preferred embodiment of the present invention, tilapia with the PRMT2 gene knocked out, specifically tilapia with the T and G bases at positions 224 and 225 deleted in exon 1 of the PRMT2 gene (i.e., the PRMT2 gene exon 1 sequence is shown as SEQ ID No. 6), exhibit resistance to bacterial infection, particularly Streptococcus infection. Following infection, not only is the survival rate significantly improved, but the bacterial load in the body is also significantly reduced.

[0026] A method for constructing an antibacterial strain of tilapia comprises the following steps:

[0027] (1) Based on CRISPR / Cas9 gene knockout technology, the specific target site sgRNA and Cas9 protein of the prmt2 gene were microinjected into tilapia embryos to edit the nucleotides 209-228 at the exon 1 position of the prmt2 gene; after embryo cultivation, positive tilapia were screened to obtain F0 generation positive tilapia;

[0028] (2) F0 generation positive tilapia were mated with wild type tilapia to obtain F1 generation heterozygous tilapia;

[0029] (3) F1 generation heterozygous tilapia were hybridized to obtain F2 generation tilapia, and F2 generation homozygous tilapia were screened to establish an antibacterial tilapia strain.

[0030] Preferably, the antibacterial strain of tilapia is an anti-streptococcal strain.

[0031] In steps (1)-(3), PCR amplification and sequencing are used to screen F0 generation positive tilapia, F1 generation heterozygous tilapia and F2 generation homozygous tilapia.

[0032] The upstream and downstream sequences used for PCR amplification sequencing are shown in SEQ ID No. 7 and SEQ ID No. 8.

[0033] SEQ ID No.7:GAGAGACCCGCAAACCTCAG(prmt2-seq-F)

[0034] SEQ ID No.8: TCTTCATCTTGCCACGGGTC(prmt2-seq-R)

[0035] Preferably, the positive F0 generation tilapia prmt2 gene has two bases deleted at positions 224 and 225 of exon 1. Specifically, the t and g bases at positions 224 and 225 are deleted.

[0036] Preferably, the genome sequencing result of the F2 generation homozygous tilapia is as SEQ ID No.12.

[0037] Preferably, in step (1), the PCR product of the F0 generation positive tilapia shows two bands at a position of about 300 bp; the wild type shows a single band.

[0038] Preferably, step (3) can also use T7E1 enzyme digestion to screen F2 generation homozygous tilapia. Specifically, primers represented by SEQ ID No. 9 and SEQ ID No. 10 are used for amplification, and the PCR product is digested with T7E1. The PCR digestion product of F2 generation homozygous tilapia shows three bands.

[0039] SEQ ID No.9: TGCGTCCTGTGAGGAGTATG(prmt2-T7E1-F)

[0040] SEQ ID No.10: GGGTGATGCATTAAAGAAAGGC(prmt2-T7E1-R)

[0041] Tilapia with prmt2 gene knockout can also be used to construct disease-resistant fish breeding.

[0042] The beneficial effects and advantages of the present invention are:

[0043] Based on CRISPR / Cas9 gene knockout technology, the present invention constructs a sgRNA for the prmt2 gene knockout tilapia model and knocks out the tilapia prmt2 gene. By knocking out this gene, a tilapia strain with antibacterial properties, especially resistance to Streptococcus agalactiae, can be obtained.

[0044] This study successfully established a PRMT2 gene knockout model for the first time, providing an important model for disease-resistant tilapia breeding. Infection experiments revealed that the PRMT2-knockout tilapia exhibited resistance to bacterial infection, particularly Streptococcus infection. Based on the conserved nature of PRMT2 function, this study lays a solid foundation for further research on its function and could provide a gene target and new research direction for molecular disease-resistant fish strains and varieties. BRIEF DESCRIPTION OF THE DRAWINGS

[0045] Figure 1 Schematic diagram of the construction scheme for prmt2 gene knockout tilapia;

[0046] Figure 2 The results of T7E1_PCR gel electrophoresis in Example 4 are as follows;

[0047] Figure 3 This is the result of enzyme digestion of prmt2-F2 generation_T7E1 in Example 4;

[0048] Figure 4 The prmt2 gene knockout site and peak diagram of the F0 generation positive tilapia in Example 2;

[0049] Figure 5 For Example 4, the knockout sites and peaks of the prmt2 gene in F2 generation homozygous tilapia (prmt2- / -) and wild-type tilapia (prmt2+ / +) as well as the length of the expressed protein;

[0050] Figure 6 The wild type (infected-WT) and prmt2 knockout tilapia (infected-PRMT2) infected with Streptococcus agalactiae in Example 5 were - / - ) Survival curves, WT and PRMT2 - / - These are uninfected wild-type and prmt2 knockout tilapia;

[0051] Figure 7 The statistical data of bacterial load in spleen of F2 homozygotes after intraperitoneal injection of Streptococcus in Example 5;

[0052] Figure 8 The figures are statistics of bacterial load in the liver of F2 homozygotes after intraperitoneal injection of streptococci in Example 5. DETAILED DESCRIPTION

[0053] This mutant strain was obtained by single-target knockout. The specific implementation methods provided by the present invention are described in detail below with reference to the accompanying drawings.

[0054] Materials needed for the experiment:

[0055] 1) Enzymes used in PCR: (for sgRNA synthesis) 2× Accurate Taq Master Mix (Accurate Biotechnology Co., Ltd.);

[0056] 2) PCR product purification: QIAquick@PCR Purification Kit (QIAGEN);

[0057] 3) In vitro transcription: MAXIscriptTM SP6 / T7 transcription kit (Thermo);

[0058] 4) Cas9 protein: GenCrispr NLS-Cas9-NLS Nuclease (GenScript);

[0059] 5) T7E1 enzyme: T7 Endonuclease I (Biyuntian);

[0060] 6) Enzyme for T7E1_PCR: 2*Taq Plus Master Mix II (Dye plus) (Vazyme)

[0061] The construction scheme and experimental steps of prmt2 gene knockout tilapia are as follows Figure 1 As shown, the process includes constructing sgRNA and injecting it into tilapia embryos with Cas protein, cultivating and screening to obtain F0 generation positive tilapia; hybridizing F0 generation positive tilapia with wild-type tilapia to obtain F1 generation heterozygous tilapia; hybridizing female and male F1 generation heterozygous tilapia, screening F2 generation homozygous tilapia, and verifying by infection with Streptococcus agalactiae (S. agalactiae).

[0062] Example 1 prmt2 gene knockout tilapia

[0063] (1) Construct a specific target sgRNA for the prmt2 gene.

[0064] The sgRNA target sequence SEQ ID NO. 1 of the prmt2 is shown in Table 1 and is located at positions 209-228 of the prmt2 exon.

[0065] The crRNA and tracrRNA primer sequences SEQ ID NO.2 and SEQ ID NO.3 are shown in Table 2:

[0066] Linearize and purify DNA and transcribe with Cas9 protein in vitro.

[0067] Table 1: sgRNA target sequences of prmt2 (SEQ ID NO.1)

[0068] sgRNA name Sequence (5'-3') Prmt2-sgRNA-target sequence <![CDATA[GGTGGTGGGCAGAGC TG CAG(SEQ ID NO.1)]]>

[0069] Table 2: crRNA and tracrRNA primer sequences SEQ ID NO. 2 and SEQ ID NO. 3

[0070]

[0071] The sgRNA sequence was obtained by in vitro transcription using the DNA fragment of SEQ ID No. 4 as a template.

[0072] GATCACTAATACGACTCACTATAGGTGGTGGGCAGAGCTGCAGGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCTTTT (SEQ ID NO. 4)

[0073] The template includes DNA fragments for transcribing crRNA and tracerRNA (SEQ ID No. 2 and SEQ ID No. 3).

[0074] The DNA fragment for transcribing crRNA is shown in SEQ ID No. 2, including a T7 promoter sequence, a target sequence (SEQ ID NO. 1), and a sequence complementary to tracrRNA. The DNA fragment for transcribing tracerRNA is shown in SEQ ID No. 3, which includes a sequence complementary to crRNA.

[0075] Using MAXIscript TM Use SP6 / T7 transcription kit to perform in vitro transcription, purify and obtain the transcribed sgRNA sequence:

[0076] GGUGGUGGGCAGAGCUGCAGGUUUUAGAGCUAGAAAUAGCAAGUUAAAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCCGGUGCUUUU(SEQ ID NO.5)

[0077] (2) Carefully cultivate sexually mature tilapia until they lay eggs and obtain high-quality cell-stage embryos through in vitro fertilization, and in vitro transcribe the purified sgRNA and Cas9 protein described in step (1) and microinject them into tilapia embryos.

[0078] The embryos that survive the injection are carefully cultured until they break the membrane and survive, and these are the F0 generation of tilapia.

[0079] Example 2 Positive F0 generation tilapia PCR identification method and results

[0080] After 20-30 days of age, the tail fins of F0 tilapia were cut to extract DNA. PCR amplification was performed and the product was sequenced. Primer information, PCR reaction system, and PCR reaction procedure are shown in Tables 3-5.

[0081] PCR detection was performed on F0 generation tilapia using primers prmt2-seq-F+prmt2-seq-R (SEQ ID NOs. 7 and 8), and the amplified fragment size was 260 bp.

[0082] The editing efficiency was detected by T7E1 digestion in F0 tilapia: PCR products were amplified and digested.

[0083] 1) T7E1_PCR amplification:

[0084] The amplification primers of T7E1_PCR are SEQ ID No. 9 and 10, and the amplified PCR product fragment size is 740 bp; the T7E1_PCR reaction system and T7E1_PCR reaction procedure are shown in Tables 6 and 7. The gel electrophoresis results of T7E1_PCR products are shown in Figure 2 .pass Figure 2 A single PCR product band can be seen, and the next experiment can be carried out.

[0085] prmt2-T7E1-F TGCGTCCTGTGAGGAGTATG(SEQ ID NO.9)

[0086] prmt2-T7E1-R GGGTGATGCATTAAAGAAAGGC (SEQ ID NO.10)

[0087] Table 6 Reaction system

[0088] Element volume 2xTaq Plus Master MixⅡ(Dye plus) 5μl prmt2-T7E1-F (10 μmol / μl) 0.5 μl prmt2-T7E1-R (10 μmol / μl) 0.5 μl <![CDATA[ddH20]]> 3 μl DNA template 1 μl Total 10 μl

[0089] Table 7 PCR reaction procedure

[0090]

[0091]

[0092] 2) T7E1 digestion

[0093] The PCR products were annealed in a PCR instrument using the annealing reaction system and reaction conditions shown in Tables 8 and 9. After the reaction, 0.25 μl of T7E1 enzyme was added and the mixture was incubated in a metal bath for 30 min. The enzyme digestion reaction was terminated by adding 0.75 μl of 0.5 M EDTA.

[0094] Table 8 PCR annealing reaction system

[0095] Element volume PCR products 5μl ddH20 4 μl Buffer 1 μl Total 10l

[0096] Table 9 PCR annealing reaction program

[0097] Reaction temperature Reaction time 95℃ 5min 85℃ 10s 25℃ 10min 12℃ ～

[0098] The electrophoresis results of the enzyme digestion products are as follows Figure 3 The five single bands on the left represent WT or KO, with no overlapping peaks; the five bands on the right represent overlapping peaks, i.e., heterozygotes.

[0099] The above tilapia were sequenced, and some of the gene sequencing results are as follows Figure 4 Comparison of the sequencing results with those of wild-type tilapia (prmt2) showed that the prmt2 gene of the F0 generation mutant tilapia had a base deletion in exon 1 (Exon1), knocking out the t and g at positions 224 and 225.

[0100] In the target sequence shown in SEQ ID No.1, the underlined site is the mutated site: GGTGGTGGGCAGAGC TG CAG.

[0101] Table 3 PCR reaction primer information

[0102]

[0103] Table 4 PCR reaction system

[0104] Element volume 2x Accurate Taq Master Mix 10 μl prmt2-seq-F (10 μmol / μl) 1 μl prmt2-seq-R (10 μmol / μl) 1 μl <![CDATA[ddH20]]> 7 μl DNA template 1 μl Total 20 μl

[0105] Table 5 PCR reaction procedure

[0106]

[0107] Example 3 Obtaining and Genotyping F1 Tilapia

[0108] Positive F0 generation mutant tilapia were selected and mated with wild-type tilapia to obtain F1 generation heterozygous tilapia.

[0109] The PCR amplification products were sequenced and the overlapping peaks were observed to screen heterozygotes. The PCR amplification primers, reaction system and reaction procedure were the same as in Example 2.

[0110] The PCR amplified sequence of the F1 generation heterozygous tilapia is shown in SEQ ID NO.11:

[0111] CCCCTCCTTACGGGAGGTGGGGGTATCAGCAATAACCGTGTGACTTGTTTTGTCTCACAGCTTAGTTTCAGCAGAGGAGACAGACTGCTTGTACACGCCAAGCCCTCCTCAGAGTGGTTGGTGGGCAGAGCTGCGGGGGCATATGTGATGTGCCTGTGCCCTAACCTGTGCCCCGAGGCGGTGCGGGAGGAGGAGAAGGAGACCTCTCTATAAAACACCCGGGGAGATAAAAAAAA

[0112] Example 4 Obtaining F2 generation homozygous tilapia and identifying genotypes

[0113] The F1 generation heterozygous tilapia screened in Example 3 were hybridized to screen and obtain F2 generation homozygous tilapia, which is the prmt2 gene knockout tilapia model.

[0114] The identification method of F2 generation homozygous tilapia is to identify a band ( Figure 3 ) PCR products were directly sequenced and the sequences were compared to screen WT and KO; the PCR amplification primers, reaction system and reaction procedure were the same as in Example 2.

[0115] PCR amplification and Sanger sequencing of the F2 generation homozygous tilapia showed the result as SEQ ID NO.12, indicating homozygous.

[0116] SEQ ID NO.12:

[0117] ACGGTCGTTAACGGGGGAGGTGGGGGTATCAGCAATAACCGTGTGACTTGTTTTGTCTCACAGCTTAGTTTCAGCAGAGGAGACAGACTGCTTGTACACGCCAAGCCCTCCTCAGAGTGGTGGTGGGCAGAGCCAGGGGGTCATAGGTTATGTCCCTGCCGGCTACCTGAGCCAGGATGCTGCAGGGGAGGAGGAGGAGGACCCCTCAATAGAAGACCCGTGGCAAGATGAAGAA

[0118] like Figure 5Comparison of sequencing results with those of wild-type tilapia (prmt2+ / +) revealed that the prmt2 gene in the homozygous F2 generation (prmt2- / -) underwent a base deletion in exon 1 (E1), removing the T and G at positions 224 and 225. The protein expressed by prmt2+ / + is 443 amino acids long, while the protein expressed by (prmt2- / -) is 106 amino acids long.

[0119] Example 5 Detection of F2 generation homozygous tilapia resistance to streptococci

[0120] Using 2x10 7 F2 homozygous tilapia and wild-type tilapia were infected by intraperitoneal injection of Streptococcus agalactiae at a concentration of 100 μL. The survival rate and bacterial load of infected tilapia were detected, and uninfected F2 homozygous tilapia and wild-type tilapia were used as controls.

[0121] Survival curves such as Figure 6 As shown in Figure 3, the survival rate of F2 homozygotes infected with Streptococcus was significantly improved compared with wild-type tilapia.

[0122] At the same time, the bacterial load in the F2 generation homozygotes was also significantly reduced, such as Figure 7 and 8 As shown, after intraperitoneal injection of streptococci, the bacterial load in the spleen and liver of the F2 homozygotes was significantly lower than that of the wild type.

[0123] The above experiments preliminarily show that F2 generation homozygous tilapia has the ability to resist streptococcal infection.

[0124] The above is only a preferred embodiment of the present invention. It should be pointed out that ordinary technicians in this technical field can make several improvements and supplements without departing from the method of the present invention. These improvements and supplements should also be regarded as the scope of protection of the present invention.

Claims

1. Application of specific target site sgRNA of prmt2 gene in constructing anti-streptococcal strain of tilapia, characterized in that, The specific target site sgRNA nucleotide sequence of the prmt2 gene is shown in SEQ ID No.

5.

2. A method for constructing a tilapia anti-streptococcal strain, characterized in that: The steps include: (1) Knockout the prmt2 gene by microinjecting Cas9 protein and sgRNA targeting the specific target site of the prmt2 gene as shown in SEQ ID No. 5 into tilapia embryos to delete the bases 224 and 225 of exon 1 of the prmt2 gene; after embryo cultivation, positive tilapia were screened to obtain F0 generation positive tilapia; (2) Crossbreeding positive F0 generation tilapia with wild-type tilapia to obtain F1 generation heterozygous tilapia; (3) F1 generation heterozygous tilapia are hybridized to obtain F2 generation tilapia, and F2 generation homozygous tilapia are screened, which are tilapia resistant to streptococcal infection.

3. The construction method according to claim 2, characterized in that In steps (1)-(3), PCR amplification and sequencing were used to screen the F0 generation positive tilapia, the F1 generation heterozygous tilapia and the F2 generation homozygous tilapia.

4. An application of a prmt2 gene mutant in constructing a tilapia anti-streptococcal strain, characterized in that: The bases 224 and 225 of exon 1 of the prmt2 gene mutant are deleted.

Images