mRNA encoding SARS-CoV-2 viral antigens and vaccines

Abstract

This invention provides an mRNA encoding a SARS-CoV-2 viral antigen and a vaccine, relating to the field of vaccine technology. The mRNA encoding the SARS-CoV-2 viral antigen contains a segment encoding an open reading frame (OPF); the amino acid sequence of the SARS-CoV-2 viral antigen encoded by the OPF segment is shown in Seq_1. Delivering this mRNA encoding the SARS-CoV-2 viral antigen to the body enables the body to effectively produce neutralizing antibodies against the main circulating strains of the SARS-CoV-2 virus, alleviating the technical problem of existing vaccines' poor protective effect against variant strains.

Description

Technical Field

[0001] This invention relates to the field of vaccine technology, and in particular to an mRNA encoding SARS-CoV-2 viral antigen and a vaccine. Background Technology

[0002] Currently marketed and most COVID-19 vaccines in clinical trials are designed with antigens targeting this strain. Since July 2020, variants of the COVID-19 virus, including the Alpha strain, Beta strain, Delta strain, and Omicron strain, have emerged.

[0003] Compared to the original SARS-CoV-2 strain sequence, the Omeprung variant has at least 60 new mutations, including more than 35 mutations in the spike protein (S protein), with 15 mutations in the most critical receptor-binding domain of the S protein. In contrast, the Delta variant has only 2 mutations in this region. Based on the differences in mutation sites, the main circulating strains of the Omeprung variant include BA.1, BA.2, BA.2.12.1, BA.4, and BA.5.

[0004] Studies have found that existing vaccines offer varying degrees of protection against variant strains, particularly the Omicron strain of the novel coronavirus. Therefore, the development of a COVID-19 vaccine with better protective efficacy against variant strains is urgently needed.

[0005] In view of this, the present invention is hereby proposed. Summary of the Invention

[0006] The primary objective of this invention is to provide an mRNA encoding a SARS-CoV-2 viral antigen. When this mRNA is delivered into the body, it can induce an immune response, protecting the body against SARS-CoV-2 viral variants, particularly the Omicron strain, thus alleviating the technical problem of existing vaccines' poor protective effect against variants.

[0007] A second objective of the present invention is to provide a vaccine containing the mRNA encoding the SARS-CoV-2 viral antigen, or related biological material.

[0008] To solve the above-mentioned technical problems, the present invention adopts the following technical solution:

[0009] According to one aspect of the present invention, an mRNA encoding a SARS-CoV-2 viral antigen is provided, comprising a segment encoding an open reading frame; said segment encoding the open reading frame encodes an amino acid sequence as shown in Seq_1.

[0010] Preferably, the total GC% content in the segment of the encoded open reading frame is 30-70%, and the GC% content in any 60 bp segment of the encoded open reading frame is not less than 40%.

[0011] Preferably, the nucleotide sequence of the fragment encoding the open reading frame is as shown in Seq_2 or Seq_21.

[0012] Preferably, the mRNA comprises, from the 5' end to the 3' end, the following components in sequence: a 5' cap, a 5' UTR, a segment encoding the open reading frame, a 3' UTR, and a 3' polyA tail.

[0013] Preferably, the 5' cap is: m7G(5')(2'-OMeA)pG;

[0014] And / or, the sequence of the 5'UTR is as shown in Seq_3;

[0015] And / or, the sequence of the 3'UTR is as shown in Seq_4;

[0016] And / or, the sequence of the 3' polyA tail is shown in Seq_25.

[0017] According to one aspect of the present invention, the present invention also provides a biomaterial comprising a material selected from (a1) to (a4);

[0018] (a1) The DNA encoding the mRNA;

[0019] (a2) Nucleic acids complementary to DNA as defined in (a1);

[0020] (a3) Expression cassettes or vectors containing DNA from (a1) or (a2);

[0021] (a4) Host cell, which is transformed by the vector.

[0022] According to one aspect of the invention, the invention also provides a vaccine containing mRNA encoding the SARS-CoV-2 viral antigen and the vaccine, or the biological material.

[0023] Preferably, the vaccine contains nucleic acid lipid nanoparticles, and the nucleic acid lipid nanoparticles contain the mRNA and lipid components;

[0024] The lipid component comprises, by molar percentage, 20-50% protonable cationic lipids, 20-50% structural lipids, 5-20% auxiliary lipids and 1-5% surfactants, wherein the total molar content of protonable cationic lipids, structural lipids, auxiliary lipids and surfactants is 100%.

[0025] The protonable cationic lipids include at least one of DlinMC3-DMA, DODMA, C12-200 and DlinDMA;

[0026] And / or, the assisting lipids include at least one of DSPC, DOPE, DOPC, DOPG, and DOPS;

[0027] And / or, the structural lipids include cholesterol and / or cholesterol derivatives;

[0028] And / or, the surfactant includes at least one of PEG-DMG, PEG-DSPE and TPGS.

[0029] Preferably, the lipid components, in molar percentage, comprise 50% Dlin-MC3-DMA, 10% DOPG, 38.5% cholesterol, and 1.5% PEG-DMG.

[0030] Preferably, the nucleic acid lipid nanoparticles are prepared according to the following method:

[0031] An aqueous phase containing the mRNA encoding the SARS-CoV-2 viral antigen and an organic phase containing the lipid components were mixed evenly to obtain a mixture. After removing the organic phase, the mRNA concentration in the system was adjusted to 1~100 μg / ml to obtain the nucleic acid lipid nanoparticles.

[0032] The aqueous phase is an aqueous buffer containing 0.08~1.2 mg / L of the mRNA encoding the SARS-CoV-2 viral antigen, and the aqueous buffer is a citrate buffer or a sodium acetate buffer.

[0033] The organic phase is an anhydrous C1-C4 low carbon alcohol containing 5-7 mg / L of the lipid component;

[0034] The volume ratio of the aqueous phase to the organic phase is 1:2~4.

[0035] Compared with the prior art, the present invention has the following beneficial effects:

[0036] The mRNA encoding SARS-CoV-2 viral antigen provided by this invention contains at least the S protein coding region encoding the Omicron strain of SARS-CoV-2 virus. The amino acid sequence of the S protein encoded by this mRNA is shown in Seq_1. This S protein exhibits strong immunogenicity; the mRNA provided by this invention, after delivery into the body, can express the S protein and trigger an immune response. Experiments by this invention have shown that the mRNA encoding the S protein of a SARS-CoV-2 viral variant, when delivered into mice, can induce antibody production in the mice. This antibody has a neutralizing effect against both the SARS-CoV-2 viral variant and the original strain.

[0037] Based on the inventive concept of the mRNA encoding the SARS-CoV-2 viral antigen and its resulting technical effects, this invention also utilizes this mRNA or related biological materials to develop a vaccine. This vaccine has advantages such as rapid development, high safety, and easy industrialization. It can be rapidly prepared to target currently circulating strains of COVID-19 (including original and variant strains), achieving sufficient protective efficacy and outperforming existing vaccine technologies in terms of safety and efficacy. Animals vaccinated with the vaccine provided by this invention produce effective antibodies, showing neutralizing effects against circulating strains, especially the Omicron strain. Currently, there are no similar products on the market. Attached Figure Description

[0038] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the drawings used in the description of the specific embodiments or the prior art will be briefly introduced below. Obviously, the drawings described below are some embodiments of the present invention. For those skilled in the art, other drawings can be obtained from these drawings without creative effort.

[0039] Figures 1-5 The GC% content of mRNA encoding SARS-CoV-2 viral antigen provided in Examples 1-5 of this invention;

[0040] Figure 6 The results of the neutralizing activity of serum produced after immunizing C57 mice with the vaccine formulations of comparative examples 9 to 14 against SARS-CoV-2 pseudovirus are presented.

[0041] Figure 7 Results of the neutralizing activity test of SARS-CoV-2 pseudovirus in serum produced after immunizing C57 mice with the vaccine formulations provided in Examples 7 and 8. Detailed Implementation

[0042] The technical solution of the present invention will be clearly and completely described below with reference to the embodiments. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.

[0043] According to one aspect of the present invention, an mRNA encoding a SARS-CoV-2 viral antigen is provided. This mRNA contains a segment encoding an open reading frame (OPF). The OPF segment encodes the S protein coding region of the SARS-CoV-2 virus Omicron strain, as shown in Seq_1. The S protein in Seq_1 contains an SN mutation, which involves the substitution of two proline residues at positions 983 and 984 in the amino acid sequence of the full-length S protein (Seq_5). The SN mutation can increase pre-fusion stability. After translation of the target protein in mammals and humans, this mRNA is structurally closer to the S protein of the Omicron strain, a variant of the prevalent SARS-CoV-2 virus, and exhibits more stable expression in vivo, thereby better protecting the body against infection by the SARS-CoV-2 variant.

[0044] In some optional embodiments, the total GC% content in the segment encoding the open reading frame is 30% to 70%, for example, but not limited to 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, or 70%, or a range between any two points thereof. Preferably, the total GC% content in the segment encoding the open reading frame is 50% to 60%, more preferably 54% to 60%.

[0045] Meanwhile, the GC% content of any 60 bp fragment in the open reading frame is not less than 40%. Experiments show that mRNA containing fragments encoding open reading frames with the above-mentioned structure has a higher antigen expression level.

[0046] In some alternative embodiments, the nucleotide sequence of the fragment encoding the open reading frame is as shown in Seq_2 or Seq_21. mRNAs containing open reading frames with sequences as shown in Seq_2 or Seq_21 exhibit higher protein expression levels and are more effective at successfully immunizing mice to produce neutralizing antibodies, with mRNAs containing open reading frames with sequences as shown in Seq_2 showing particularly good results.

[0047] In some alternative embodiments, the mRNA encoding the SARS-CoV-2 viral antigen comprises, from the 5' end to the 3' end, the following components in sequence: a 5' cap, a 5' UTR, an mRNA fragment encoding the open reading frame, a 3' UTR, and a 3' polyA tail.

[0048] The 5' cap structure can increase mRNA stability and prevent mRNA from being degraded by exonucleases. The preferred 5' cap structure is m7G(5')(2'-OMeA)pG.

[0049] The 5'UTR and 3'UTR can regulate mRNA translation. The preferred 5'UTR sequence is GGGAGAAAGCUUACC (as shown in Seq_3).

[0050] The preferred 3'UTR sequence is: GGACUAGUUAUAAGACUGACUAGCCCGAUGGGCCUCCCAACGGGCCCUCCUCCCCUCCUUGCACCGAGAUUAAU (as shown in Seq_4).

[0051] The 3' polyA tail can prevent mRNA from being degraded by exonucleases and terminate transcription. The polyA length is preferably 100 bp, and the sequence is shown in Seq_25.

[0052] According to another aspect of the invention, the invention also provides a biomaterial selected from the following (a1) to (a4):

[0053] (a1) DNA encoding the mRNA, wherein the DNA molecule is capable of being transcribed to produce the mRNA;

[0054] (a2) A nucleic acid complementary to DNA as defined in (a1), wherein the nucleic acid includes RNA or DNA;

[0055] (a3) An expression cassette or vector containing DNA from (a1) or (a2), such as a plasmid containing DNA from (a1) or (a2), which is used to clone the DNA from (a1) or (a2), to transcribe the mRNA, or to express the S protein encoded by the mRNA;

[0056] (a4) A host cell, which is transformed by the vector. The host cell includes prokaryotic or eukaryotic cells, and specific examples include, but are not limited to, Escherichia coli, yeast, insect cells, or mammalian cells.

[0057] According to another aspect of the present invention, the present invention also provides a vaccine containing mRNA encoding a SARS-CoV-2 viral antigen or the aforementioned biological material. The vaccine may, for example, but is not limited to, using mRNA encoding a SARS-CoV-2 viral antigen, DNA capable of transcribing the mRNA, a vector containing the DNA, or a microorganism or cell line containing the mRNA or DNA as the main active ingredient. The vaccine is capable of expressing the SARS-CoV-2 viral antigen with an amino acid sequence as shown in Seq_1 in vivo, thereby inducing an immune response in the body and producing antibodies against the SARS-CoV-2 virus.

[0058] In some preferred embodiments, the vaccine contains nucleic acid lipid nanoparticles (LNPs), which are nanoparticles formed by encapsulating nucleic acids with lipid components. LNPs enable the encapsulated nucleic acids to be delivered into cells more effectively. Therefore, it is preferred to encapsulate the mRNA encoding the SARS-CoV-2 viral antigen in lipid components to prepare LNPs, so as to improve the immunogenicity of the mRNA in the vaccine.

[0059] In some optional embodiments, the lipid components forming the LNP, by molar percentage, include 20-50% protonable cationic lipids, for example, but not limited to, 20%, 25%, 30%, 35%, 40%, 45%, or 50%; 20-50% structural lipids, for example, but not limited to, 20%, 25%, 30%, 35%, 40%, 45%, or 50%; 5-20% accessory lipids, for example, but not limited to, 5%, 10%, 15%, or 20%; and 1-5% surfactants, for example, but not limited to, 1%, 2%, 3%, 4%, or 5%. The total molar content of the protonable cationic lipids, structural lipids, accessory lipids, and surfactants is 100%. The protonable cationic lipids preferably include at least one of DlinMC3-DMA, DODMA, C12-200 and DlinDMA; the auxiliary lipids preferably include at least one of DSPC, DOPE, DOPC, DOPG and DOPS; the structural lipids preferably include cholesterol and / or cholesterol derivatives; and the surfactants preferably include at least one of PEG-DMG, PEG-DSPE and TPGS.

[0060] In some preferred embodiments, the lipid components comprise, by molar percentage, 50% Dlin-MC3-DMA, 10% DOPG, 38.5% cholesterol, and 1.5% PEG-DMG.

[0061] In some optional embodiments, the LNP in the vaccine is prepared by the following method: an aqueous phase containing the mRNA encoding the SARS-CoV-2 viral antigen and an organic phase containing the lipid component are mixed evenly to obtain a mixture; the organic phase is removed and the concentration of mRNA in the system is made to be 1~100 μg / ml, for example, but not limited to 1, 5, 10, 20, 30, 40, 50, 60, 70, 80, 90 or 100 μg / ml, preferably 55 μg / ml, to obtain the nucleic acid lipid nanoparticles.

[0062] The mixing of the aqueous and organic phases is preferably carried out using a microfluidic device, with the flow rate controlled at >3 ml / min.

[0063] The preferred method for removing the organic phase is to first dilute the mixture 50 to 100 times with a buffer solution, for example, but not limited to 50, 60, 70, 80, 90 or 100 times, and then use tangential flow filtration (TFF) to remove the organic phase from the solution, and then concentrate the mRNA in the system to the target concentration.

[0064] The aqueous phase is an aqueous buffer containing 0.08~1.2 mg / L of mRNA encoding the SARS-CoV-2 viral antigen. The concentration of mRNA in the aqueous phase can be, for example, but not limited to, 0.08, 0.1, 0.2, 0.5, 0.8, 1.0, 1.1 or 1.2 mg / L. The aqueous buffer is a citrate buffer or a sodium acetate buffer.

[0065] The organic phase is an anhydrous C1-C4 low-carbon alcohol containing 5-7 mg / L of the lipid component. The concentration of the lipid component can be, for example, but not limited to, 5, 5.5, 6, 6.5 or 7 mg / ml; the anhydrous C1-C4 low-carbon alcohol is preferably ethanol.

[0066] The volume ratio of the aqueous phase to the organic phase is 1:2 to 4, for example, but not limited to 1:2, 1:3 or 1:4.

[0067] The technical effects of the present invention will be further illustrated below with reference to preferred embodiments.

[0068] The mutations SN, SM, and SL in the following examples represent: SN mutation results in two proline residue substitutions at positions 983 and 984 of the full-length S protein amino acid sequence Seq ID NO.5 (i.e., a full-length S protein with the amino acid sequence Seq_1); SM mutation results in a full-length SARS-CoV-2 protein with proline residue substitutions at positions 813, 889, 886, 939, 983, and 984 of the full-length S protein amino acid sequence Seq_5; and SL mutation results in a full-length SARS-CoV-2 protein with RRAR mutations at positions 682, 683, 684, and 685 of the full-length S protein amino acid sequence Seq ID NO.5, which is GSGG.

[0069] Example 1

[0070] This embodiment provides an mRNA encoding a SARS-CoV-2 viral antigen, which contains a fragment encoding an open reading frame. The nucleotide sequence of the fragment encoding the open reading frame is shown in Seq_2. The encoded antigen is the S protein + SN mutation of the Omicron BA.2 strain, and its amino acid sequence is shown in Seq_1.

[0071] The mRNA provided in this embodiment consists of the following components from 5' to 3': a 5' cap, a 5' UTR, an mRNA fragment encoding the open reading frame as shown in Seq_2, a 3' UTR, and a 3' polyA tail; wherein...

[0072] The 5' cap is: m7G(5')(2'-OMeA)pG;

[0073] The sequence of the 5'UTR is GGGAGAAAGCUUACC (Seq_3);

[0074] The polyA tail is 100 A's (Seq_25);

[0075] The 3'UTR sequence is:

[0076] GGACUAGUUAUAAGACUGACUAGCCCGAUGGGCCUCCCAACGGGCCCUCCUCCCCUCCUUGCACCGAGAUUAAU (Seq_4).

[0077] Examples 2 to 5

[0078] The only difference between Examples 2-5 and Example 1 is the sequence encoding the open reading frame (OPF). The antigen encoded by the mRNA in Examples 2-5 is the same as in Example 1, namely the S protein + SN mutation of the Omicron BA.2 strain, and its amino acid sequence is shown in Seq_1. The difference between the mRNAs encoding the OPF fragments in Examples 1-5 lies in the GC content of the mRNA, as shown in the table below. The GC content of Examples 1-5 is as follows: Figures 1-5 As shown, the horizontal axis represents the local GC% content. "Local GC% content" refers to the GC% content in a local sequence with a window size of 60bp, from the 3' end to the 5' end of the ORF.

[0079] Group mRNA coding region GC% content in the mRNA coding region sequence Maximum GC% content in a local area of ​​the mRNA coding region sequence Minimum GC% content in a local area of ​​the mRNA coding region sequence Example 1 Seq_ 2 54%-60% 78% Above 40% Example 2 Seq_ 21 54%-60% 73% Above 40% Example 3 Seq_ 22 Below 54% 80% Above 40% Example 4 Seq_ 23 Above 60% 75% Above 40% Example 5 Seq_ 24 54%-60% 70% Below 40%

[0080] Example 6

[0081] This embodiment provides a method for preparing lipid nanoparticles containing mRNA encoding SARS-CoV-2 viral antigen, wherein the lipid nanoparticles comprise, by molar percentage: 50% Dlin-MC3-DMA, 10% DOPG, 38.5% cholesterol, and 1.5% PEG-DMG. The preparation method is as follows:

[0082] (a) The mRNA encoding the SARS-CoV-2 viral antigen was dissolved in a citrate buffer at pH 4 and the concentration was adjusted to 0.1 mg / ml to obtain the aqueous phase.

[0083] (b) Dissolve Dlin-MC3-DMA, DOPG, cholesterol and PEG-DMG in anhydrous ethanol according to the formulation amount, and adjust the concentration of lipid components in the organic phase to 6 mg / mL to obtain the organic phase.

[0084] (c) The aqueous phase from step (a) and the organic phase from step (b) were mixed at a volume ratio of 1:3 using a microfluidic device at a flow rate of 12 mL / min. The mixture was immediately diluted 100 times with PBS solution at pH 7.4, and the ethanol component in the solution was removed by tangential flow filtration (TFF). The mixture was then concentrated to a concentration of 55 μg / ml of mRNA to obtain lipid nanoparticles containing mRNA encoding SARS-CoV-2 viral antigen.

[0085] Example 7

[0086] Example 7 provides a vaccine formulation. This example uses the preparation method of lipid nanoparticles provided in Example 6 to prepare a vaccine formulation from the mRNA encoding SARS-CoV-2 viral antigen provided in Example 1. The LNP encapsulation rate was found to be above 90%, and the particle size was approximately 70 nm.

[0087] Example 8

[0088] Example 8 provides a vaccine formulation. This example uses the preparation method of lipid nanoparticles provided in Example 6 to prepare a vaccine formulation from the mRNA encoding SARS-CoV-2 viral antigen provided in Example 2. The LNP encapsulation rate was found to be above 90%, and the particle size was about 70 nm.

[0089] Comparative Examples 1 to 8

[0090] The only difference between Comparative Examples 1 to 8 and Example 1 is the sequence of the mRNA encoding the open reading frame fragment. The sequence information of the mRNA encoding the SARS-CoV-2 viral antigen in Example 1 and Comparative Examples 1 to 8 is shown in the table below.

[0091] Group mRNA coding region The S protein encoded by the mRNA coding region and its amino acid sequence Example 1 Seq_2 The amino acid sequence encoding the S protein of the Omicron BA.2 strain is a +SN mutation, as shown in Seq_1. Comparative Example 1 Seq_ 11 The amino acid encoding the S protein (Seq_5) of the SARS-CoV-2 Omicron BA.2 strain is shown. Comparative Example 2 Seq_ 12 The amino acid encoding the S protein (Seq_9) of the SARS-CoV-2 Omicron BA.1 strain is shown. Comparative Example 3 Seq_ 13 The S protein (Seq_10) encoding the amino acid sequence of the SARS-CoV-2 Omicron BA.3 strain is described. Comparative Example 4 Seq_ 14 The four sub-variant strains encoding the wild-type S protein + Omicron strain share a common mutation site (Seq_6). Comparative Example 5 Seq_ 15 The amino acid encoding is the wild-type S protein + a common mutation site among the four sub-variant strains of the Omicron strain + a common mutation site (Seq_7) between Omicron strains BA.1 and BA.3. Comparative Example 6 Seq_ 16 The amino acid encoding is the wild-type S protein + a common mutation site among the four sub-variant strains of the Omicron strain + a common mutation site (Seq_8) between Omicron strains BA.2 and BA.3. Comparative Example 7 Seq_ 1 7 The amino acid sequence encoding the S protein of the Omicron BA.2 strain is a +SM mutation, as shown in Seq_19. Comparative Example 8 Seq_ 1 8 The amino acid sequence encoding the S protein of the Omicron BA.2 strain is a +SL mutation, as shown in Seq_20.

[0092] Comparative Example 9

[0093] Comparative Example 9 provides a vaccine formulation. This comparative example uses the preparation method of lipid nanoparticles provided in Example 6 to prepare a vaccine formulation from the mRNA encoding SARS-CoV-2 viral antigen provided in Comparative Example 1. The LNP encapsulation rate was found to be above 90%, and the particle size was approximately 70 nm.

[0094] Comparative Example 10

[0095] Comparative Example 10 provides a vaccine formulation. This comparative example uses the preparation method of lipid nanoparticles provided in Example 6 to prepare a vaccine formulation from the mRNA encoding SARS-CoV-2 viral antigen provided in Comparative Example 2. The LNP encapsulation rate was found to be above 90%, and the particle size was about 70 nm.

[0096] Comparative Example 11

[0097] Comparative Example 11 provides a vaccine formulation. This comparative example uses the preparation method of lipid nanoparticles provided in Example 6 to prepare a vaccine formulation from the mRNA encoding SARS-CoV-2 viral antigen provided in Comparative Example 3. The LNP encapsulation rate was found to be above 90%, and the particle size was about 70 nm.

[0098] Comparative Example 12

[0099] Comparative Example 12 provides a vaccine formulation. This comparative example uses the preparation method of lipid nanoparticles provided in Example 6 to prepare a vaccine formulation from the mRNA encoding SARS-CoV-2 viral antigen provided in Comparative Example 4. The LNP encapsulation rate was found to be above 90%, and the particle size was about 70 nm.

[0100] Comparative Example 13

[0101] Comparative Example 13 provides a vaccine formulation. This comparative example uses the preparation method of lipid nanoparticles provided in Example 6 to prepare a vaccine formulation from the mRNA encoding SARS-CoV-2 viral antigen provided in Comparative Example 5. The LNP encapsulation rate was found to be above 90%, and the particle size was about 70 nm.

[0102] Comparative Example 14

[0103] Comparative Example 14 provides a vaccine formulation. This comparative example uses the preparation method of lipid nanoparticles provided in Example 6 to prepare a vaccine formulation from the mRNA encoding SARS-CoV-2 viral antigen provided in Comparative Example 6. The LNP encapsulation rate was found to be above 90%, and the particle size was about 70 nm.

[0104] Example of effect 1

[0105] The LNP formulations of Comparative Examples 9 to 14 all showed an encapsulation efficiency of over 90% and a particle size of approximately 70 nm. These vaccine formulations were used in C57 mouse immunization experiments. Each mouse received a 5 microgram (based on mRNA) intramuscular injection in the lateral thigh of the hind limb, followed by a second immunization 7 days later. Three mice were in each group. Fourteen days after the initial immunization, mouse serum was collected and sent to a third-party laboratory for SARS-CoV-2 pseudovirus neutralization activity testing. Mouse serum was diluted at different ratios (initial dilution factor 30) in 96-well plates, and SARS-CoV-2 infective pseudovirus was added. Cell controls and virus controls were also included. After incubation for 1 hour, pre-prepared cells were added and cultured in a cell culture incubator for 20–28 hours. A portion of the supernatant was discarded, and luciferase assay reagent was added. After reaction at room temperature in the dark, the cells were repeatedly pipetted and aspirated to ensure complete cell lysis. The cells were then placed in a chemiluminescence analyzer to read the luminescence value. Ensuring the validity of the virus and cell controls, the ID50 value was calculated using the Reed-Muench method. Serum corresponding group numbers and results are as follows Figure 6 As shown in the figure. Numbers 1 to 6 correspond to Comparative Examples 9 to 14, respectively.

[0106] from Figure 1 The results show that:

[0107] (1) Because the S protein of the two sub-variants BA.1 and BA.2 of the Omega strain of the novel coronavirus has more site mutations compared with the S protein of the Delta strain of the novel coronavirus, when the amino acid sequence of the S protein encoded by the mRNA vaccine coding region is as shown in Seq_5~ Seq_10, the prepared vaccine preparation has low antibody activity in stimulating mice to produce neutralizing antibodies against the pseudovirus of the Delta strain of the novel coronavirus.

[0108] (2) Vaccine preparations made when the amino acid sequence of the S protein encoded by the mRNA vaccine coding region is shown in Seq_5~Seq_10 can stimulate mice to produce antibodies that have neutralizing ability against the two sub-variant pseudoviruses BA.1 and BA.2 of the Omeprone variant of the novel coronavirus.

[0109] (3) Among the vaccine formulations prepared by encoding different S proteins in the mRNA vaccine coding region (amino acid sequences as shown in Seq_5~Seq_10), the mRNA vaccine encoding the S protein with an amino acid sequence such as Seq_5 (encoding the S protein of the Omicron BA.2 strain of the novel coronavirus) has a high neutralizing ability against the two sub-variant pseudoviruses BA.1 and BA.2 of the Omicron BA.2 strain of the novel coronavirus.

[0110] Example 2

[0111] Based on the characteristic mutation sequence of the S protein coding region of the Omicron strain of SARS-CoV-2 and other mutations such as SN and SM mentioned in other inventions and literature that can improve precursor stability, a series of mRNA sequences were designed, specifically including those shown in Example 1 (Seq_2), Comparative Example 1 (Seq_11), Comparative Example 7 (Seq_17) and Comparative Example 8 (Seq_18).

[0112] Cells were transfected with mRNAs encoding SARS-CoV-2 viral antigens provided in Example 1 (Seq_2), Comparative Example 1 (Seq_11), Comparative Example 7 (Seq_17), and Comparative Example 8 (Seq_18), and the expression of the full-length S protein in the cells was detected. The results are shown in Table 3. Detailed methods are as follows: HEK293 cells transfected with each mRNA for 24 hours were lysed, and 10 μg of total protein was loaded onto an SDS-PAGE gel. Immunoblotting was performed using anti-SARS-S1 protein antibody, and the cells were labeled with goat anti-mouse HRP secondary antibody, followed by color development. Protein expression levels were standardized and quantified using the internal control β-actin, and the differences in protein expression after cell transfection with different mRNAs were compared. Cells not transfected with mRNA served as negative controls. Expression of both the full-length S protein and the S1 subunit was detected. The expression levels of each sequence were measured as relative OD values, as shown in Table 3; the relative OD value was calculated as: (sample OD value - average value of negative controls) / (OD value of sample 1 - average value of negative controls).

[0113] Group Sample number mRNA coding region sequence The S protein encoded by the mRNA coding region and its amino acid sequence relative expression level Comparative Example 1 1 Seq_ 11 The S protein encoding the amino acid sequence of the Omicron BA.2 strain is shown in Seq_5. 1 Example 1 2 Seq_ 2 The S protein of the Omicron BA.2 strain, encoded by a +SN mutation, has the amino acid sequence shown in Seq_1. 1.5 Comparative Example 7 3 Seq_ 17 The S protein of the Omicron BA.2 strain, encoded by a +SM mutation, has the amino acid sequence shown in Seq_19. 0.4 Comparative Example 8 4 Seq_ 18 The S protein +SL mutation encoding the amino acid sequence of the Omicron BA.2 strain is shown in Seq_20. 0.6

[0114] As can be seen from the table:

[0115] (1) S protein was expressed in cells transfected with mRNA designed with four different sequences.

[0116] (2) After transfecting cells with SM mutation sample 3 and SL mutation sample 4, the S protein content was much lower than that of other mRNA transfected samples under the same conditions. This indicates that SM mutation and SL mutation will lead to a decrease in S protein expression. Therefore, the amino acid sequences Seq_19 and Seq_20 corresponding to SM mutation and SL mutation of sample 3 and sample 4, and the corresponding mRNA sequences Seq_17 and Seq_18 are not suitable as potential vaccine options.

[0117] (3) After transfecting cells with sample 2 containing the SN mutation, the S protein content was higher than that of sample 1 without the SN mutation under the same conditions, indicating that the SN mutation significantly increased the expression of the S protein in the transfected cells. Therefore, the amino acid sequence Seq_1 and the corresponding mRNA sequence Seq_2 of sample 2 with the SN mutation are suitable as potential vaccine candidates.

[0118] The inventors also mutated other sites in Seq_5, such as G614S, based on other publicly reported findings, and designed corresponding mRNA sequences based on the Seq_11 sequence. They detected the protein expression results of mRNA transfected cells using Western blotting and found that these mutations and the corresponding mRNA sequence optimizations, compared with the mRNA sequences shown in Seq_1 and Seq_11, led to a decrease in expression levels.

[0119] Based on the full-length S protein mRNA of SARS-CoV-2 published in WOUS21032609, GB2002166, and WOUS21016979, as well as the optimization methods of Seq_12 mRNA and Seq_13 mRNA, we designed a method to detect the protein expression of mRNA transfected cells using Western blot. We found that these mutations and the corresponding mRNA sequence optimizations led to a decrease in expression levels compared to the Seq_11 mRNA and Seq_12 mRNA sequences.

[0120] Example 3

[0121] Based on the optimization principles of the S protein (amino acid sequence as shown in Seq_1) and mRNA sequence of the Omicron strain of SARS-CoV-2, a series of mRNA sequences were designed, resulting in the sequences shown in Examples 1 to 5, with coding region information as shown in Table 4.

[0122] Cells were transfected with the mRNAs provided in Examples 1-5, and the expression of the full-length S protein in the cells was detected. The results are shown in Table 4. Detailed methods are as follows: HEK293 cells transfected with each mRNA for 24 hours were lysed, and 10 μg of total protein was loaded onto an SDS-PAGE gel. Immunoblotting was performed using an anti-SARS-S1 protein antibody, and the cells were labeled with goat anti-mouse HRP secondary antibody before staining. Protein expression levels were standardized and quantified using the internal control β-actin to compare the differences in protein expression after cell transfection with different mRNAs. Cells not transfected with mRNA served as a negative control. Expression of both the full-length S protein and the S1 subunit was detected. The expression levels of each sequence were measured as relative OD values, as shown in Table 4; the relative OD value was calculated as: sample OD value / OD value of sample 1. GC content in Examples 1-5 is as follows: Figures 1-5 As shown, the horizontal axis represents the local GC% content.

[0123] Group Sample number mRNA coding region sequence GC% content in the mRNA coding region sequence Maximum GC% content in a local area of ​​the mRNA coding region sequence Minimum GC% content in a local area of ​​the mRNA coding region sequence relative expression level Example 1 1 Seq_ 2 54%-60% 78% Above 40% 1.2 Example 2 2 Seq_ 21 54%-60% 73% Above 40% 1 Example 3 3 Seq_ 22 Below 54% 80% Above 40% 0.5 Example 4 4 Seq_ 23 Above 60% 75% Above 40% 0.4 Example 5 5 Seq_ 24 54%-60% 70% Below 40% 0.7

[0124] As can be seen from the table above:

[0125] (1) S protein was expressed in cells transfected with mRNA designed with four different sequences.

[0126] (2) When the overall GC% content of the mRNA coding region sequence is 54-60%, and the local GC% content is not less than 40%, the relative expression level of S protein is high (see Seq_2 and Seq_21); when the overall GC% content of the mRNA coding region is less than 54%, and the local GC% content is not less than 40%, the relative expression level of S protein is low (see Seq_22); when the overall GC% content of the mRNA coding region is higher than 60%, and the local GC% content is not less than 40%, the relative expression level of S protein is low (see Seq_22); when the overall GC% content of the mRNA coding region is 54-60%, and the local GC% content is less than 40%, the relative expression level of S protein is low (see Seq_23).

[0127] (3) When the overall GC% content of the mRNA coding region sequence is 54-60%, and the local GC% content is not less than 40%, the S protein expression level of the mRNA coding region sequence Seq_2 is higher than that of the mRNA coding region sequence Seq_21.

[0128] Example of effect 4

[0129] The vaccine formulations provided in Examples 7 and 8 were used in an immunization experiment on C57 mice. Each mouse received an intramuscular injection of 5 micrograms (based on mRNA) into the lateral thigh of the hind limb. A second immunization was administered 7 days later, with 3 mice per group. Fourteen days after the first immunization, mouse serum was collected and sent to a third-party laboratory for SARS-CoV-2 pseudovirus neutralization activity testing. Mouse serum was diluted at different ratios (initial dilution factor 30) in 96-well plates, and SARS-CoV-2 infective pseudovirus was added. Cell controls and virus controls were also included. After incubation for 1 hour, pre-prepared cells were added, and the plates were cultured in a cell culture incubator for 20–28 hours. A portion of the supernatant was discarded, and luciferase assay reagent was added. After reaction at room temperature in the dark, the cells were repeatedly pipetted and aspirated to ensure complete cell lysis. The cells were then placed in a chemiluminescence analyzer to read the luminescence value. The ID50 value was calculated using the Reed-Muench method, ensuring the validity of the virus and cell controls. Serum group numbers and results are as follows. Figure 7 As shown, Sample 1 is the vaccine formulation of Example 7, and Sample 2 is the vaccine formulation of Example 8.

[0130] from Figure 7The results show that vaccine formulations prepared when the amino acid sequence of the S protein encoded by the mRNA vaccine coding region is as shown in Seq_1 can stimulate mice to produce antibodies with neutralizing ability against five pseudoviruses of the Omega SARS-CoV-2 Omega variant: BA.1, BA.2, BA.2.12.1, BA.4, and BA.5 (Note: The BA.4 and BA.5 sub-variants of the Omega SARS-CoV-2 Omega variant have the same mutations on the S protein compared to the original strain).

[0131] When the overall GC% content of the mRNA coding region sequence is 54-60%, and the local GC% content is not less than 40%, the mRNA vaccine preparation can stimulate mice to produce antibodies with neutralizing ability against the BA.1 and BA.2 sub-variant pseudoviruses of the Omeprone variant of SARS-CoV-2. Due to the high expression level of mRNA sequence Seq_2, the mRNA vaccine preparation prepared from mRNA sequence Seq_2 produces the best antibody neutralizing ability.

[0132] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. mRNA encoding SARS-CoV-2 viral antigen, characterized in that, It contains an open reading frame; the amino acid sequence of the open reading frame is shown in SEQ ID NO.

1.

2. The mRNA according to claim 1, characterized in that, The total GC content in the open reading frame is 30% to 70%, and the GC content in any 60bp segment within the open reading frame is not less than 40%.

3. The mRNA encoding SARS-CoV-2 viral antigen according to claim 2, characterized in that, The nucleotide sequence encoding the open reading frame is shown in SEQ ID NO.2 or SEQ ID NO.

21.

4. The mRNA encoding SARS-CoV-2 viral antigen according to any one of claims 1-3, characterized in that, The mRNA comprises, from the 5' end to the 3' end, the following components in sequence: 5' cap, 5' UTR, open reading frame, 3' UTR, and 3' polyA tail.

5. The mRNA encoding SARS-CoV-2 viral antigen according to claim 4, characterized in that, The 5' cap is: m7G(5')(2'-OMeA)pG; And / or, the sequence of the 5'UTR is as shown in SEQ ID NO.3; And / or, the sequence of the 3'UTR is as shown in SEQ ID NO.4; And / or, the sequence of the 3' polyA tail is as shown in SEQ ID NO.

25.

6. A biomaterial, characterized in that, Including those selected from (a1) to (a4); (a1) DNA encoding the mRNA of any one of claims 1 to 5; (a2) Nucleic acids complementary to DNA as defined in (a1); (a3) Expression cassettes or vectors containing DNA from (a1) or (a2); (a4) Host cell, which is transformed by the vector.

7. A vaccine, characterized in that, Contains the mRNA as described in any one of claims 1-5, or the biological material as described in claim 6.

8. The vaccine according to claim 7, characterized in that, The invention comprises nucleic acid lipid nanoparticles, wherein the nucleic acid lipid nanoparticles contain the mRNA and lipid components as described in any one of claims 1-5; The lipid component comprises, by molar percentage, 20-50% protonable cationic lipids, 20-50% structural lipids, 5-20% auxiliary lipids and 1-5% surfactants, wherein the total molar content of protonable cationic lipids, structural lipids, auxiliary lipids and surfactants is 100%. The protonable cationic lipids include at least one of DlinMC3-DMA, DODMA, C12-200 and DlinDMA; And / or, the assisting lipids include at least one of DSPC, DOPE, DOPC, DOPG, and DOPS; And / or, the structural lipids include cholesterol and / or cholesterol derivatives; And / or, the surfactant includes at least one of PEG-DMG, PEG-DSPE and TPGS.

9. The vaccine according to claim 8, characterized in that, The lipid composition, by molar percentage, includes 50% Dlin-MC3-DMA, 10% DOPG, 38.5% cholesterol, and 1.5% PEG-DMG.

10. The vaccine according to claim 9, characterized in that, The nucleic acid lipid nanoparticles were prepared according to the following method: An aqueous phase containing the mRNA encoding the SARS-CoV-2 viral antigen and an organic phase containing the lipid components were mixed evenly to obtain a mixture. After removing the organic phase, the mRNA concentration in the system was adjusted to 1~100 μg / ml to obtain the nucleic acid lipid nanoparticles. The aqueous phase is an aqueous buffer containing 0.08~1.2 mg / L of the mRNA encoding the SARS-CoV-2 viral antigen, and the aqueous buffer is a citrate buffer or a sodium acetate buffer. The organic phase is an anhydrous C1-C4 low carbon alcohol containing 5-7 mg / L of the lipid component; The volume ratio of the aqueous phase to the organic phase is 1:2~4.

Images