Candida albicans long non-coding RNA for apparent regulation of fluconazole resistance and application thereof

By discovering long non-coding RNAs in Candida albicans through whole transcriptomics and utilizing the bitter melon protein MAP30 to regulate nuclear transcription factors, the problem of fluconazole resistance in Candida albicans was solved, enhancing its sensitivity to fluconazole and providing a theoretical basis for new antifungal drugs.

CN121022841BActive Publication Date: 2026-04-14SHANXI UNIV OF CHINESE MEDICINE
View PDF 0 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-09-23
Publication Date
2026-04-14

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively explain the mechanism of Candida albicans resistance to fluconazole, leading to an increase in drug-insensitive strains, high transmissibility, and high mortality rates, and lacking a theoretical basis for addressing the problem of antifungal drug resistance.

Method used

We discovered and validated long non-coding RNAs (lncRNAs) in Candida albicans that epigenetically regulate fluconazole resistance using whole transcriptomics. We then used the bitter melon protein MAP30 to inhibit the expression of these lncRNAs, regulate nuclear transcription factors, and reverse fluconazole resistance.

Benefits of technology

This study reversed the fluconazole resistance in Candida albicans, enhanced its sensitivity to fluconazole, and provided a theoretical basis for new antifungal drugs and treatment strategies.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN121022841B_ABST
    Figure CN121022841B_ABST
Patent Text Reader

Abstract

The application discloses a long-chain non-coding RNA of Candida albicans for epigenetically regulating fluconazole resistance and application thereof, belongs to the technical field of biological medicines, and relates to antifungal medicines. The long-chain non-coding RNA for epigenetically regulating fluconazole resistance comprises three nucleotide sequences shown in SEQ ID NO. 1-3. The application further provides application of Momordica charantia protein MAP30 in inhibiting expression of the long-chain non-coding RNA of the Candida albicans genome. The application provides nucleotide sequencing of the long-chain non-coding RNA of the Candida albicans genome for epigenetically regulating fluconazole resistance, open reading frame (ORF) alignment, positioning of the lncRNA on a chromosome, inhibition of lncRNA expression by using the Momordica charantia protein MAP30, and realization of reversing fluconazole resistance, which provides a theoretical basis for revealing the Candida albicans resistance mechanism, developing new antifungal medicines and treatment strategies.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, and relates to antifungal medicine, specifically to a Candida albicans long non-coding RNA that epigenetically modulates fluconazole resistance and its application. Background Technology

[0002] Candida albicans is the leading pathogen of invasive candida diseases (ICDs). Clinical types of ICD include candidemia, disseminated candidiasis, intraperitoneal candidiasis, and central nervous system candidiasis, and it is the second leading cause of infectious disease-related deaths. Globally, the total number of ICD patients is enormous, and the proportion of Candida albicans infections is on the rise. Specifically, for candidemia alone, approximately 90% of patients are diagnosed through blood cultures, but for other types of ICD, only 20% of cases with negative blood cultures are diagnosed.

[0003] Triazoles are commonly used antifungal drugs in clinical practice. Their extensive, prophylactic use, coupled with intra-abdominal infections, has led to a year-on-year increase in the detection rate of drug-resistant Candida albicans strains. These drug-resistant bacteria exhibit multidrug resistance, high transmissibility, and high mortality rates, increasingly becoming a global focus and drawing clinical attention to the problem of antifungal drug resistance.

[0004] Parasexual reproduction is the genetic mechanism by which *Candida albicans* evolves into drug-resistant strains. Factors such as aneuploid chromosomal recombination, loss of chromatin heterozygosity, mutations at heterozygous or mating loci, and the formation of diploid heterogeneity induce genetic variations such as drug resistance gene mutations or changes in gene expression, providing the genetic basis for the evolution of drug resistance in *Candida albicans*. During parasexual reproduction in *Candida albicans*, drug resistance gene recombination or mutations spread or accumulate among strains, enabling them to acquire or enhance drug resistance. To date, even with an understanding of genetic variation factors, elucidating the drug resistance mechanism of *Candida albicans* still faces significant theoretical challenges. As an important supplement to the "central dogma," epigenetics in *Candida albicans* has been found to be closely related to drug resistance. Certain epigenetic modification events, such as the acetylation and methylation of H3 histones by histone acetyltransferase GCN5 and methyltransferase Set1, respectively, lead to resistance to azoles in *Candida albicans*. Conversely, depletion of GCN5 or the resulting loss of histone acetylation increases the fungus's sensitivity to antifungal drugs.

[0005] The central dogma establishes the importance of mRNA in the flow of genetic information. However, many non-coding RNAs can also be transcribed from DNA, accounting for over 98% of all transcript types in the genome. Under normal circumstances, the Pol II or Pol III complex participates in DNA transcription, and the transcripts are spliced ​​into non-coding RNAs longer than 200 nucleotides (i.e., long non-coding RNAs, lncRNAs). Based on genomic locus and transcription direction, lncRNAs are classified into long intergenic non-coding RNAs, intron lncRNAs, sense / antisense lncRNAs, pseudogene lncRNAs, enhancer lncRNAs, and promoter lncRNAs. It has been found that some lncRNAs (such as enhancer lncRNAs) possess epigenetic regulatory activity, regulating gene expression in multiple ways and thus affecting most biological processes (including eukaryotic apoptosis, the Wnt signaling pathway, epigenetics, development, and cell morphogenesis). Research on the role of lncRNAs in epigenetics has revealed the complexity of gene regulation in eukaryotes. Currently, the general rules or principles governing the interaction between lncRNAs and epigenetics still need to be explored in depth, and there is a serious lack of relevant information available for detailed reviews. However, understanding the new connections between lncRNAs and epigenetics is becoming a cutting-edge scientific hotspot in solving the problem of fungal resistance.

[0006] To elucidate the mechanisms of Candida albicans drug resistance, develop new antifungal drugs and treatment strategies, and to provide a theoretical basis, this invention provides a set of epigenetically responsive Candida albicans long non-coding RNAs to fluconazole resistance and their application in pharmacological regulation. Summary of the Invention

[0007] The purpose of this invention is to provide a long non-coding RNA of the Candida albicans genome.

[0008] Another object of the present invention is to provide applications of the aforementioned long non-coding RNA.

[0009] A Candida albicans long non-coding RNA that epigenetically regulates fluconazole resistance, with nucleotide sequences shown in SEQ ID NO. 1-3.

[0010] Furthermore, the present invention also provides the application of the long non-coding RNA as an endogenous drug resistance regulating molecule in antifungal drugs.

[0011] The antifungal drug is bitter melon protein MAP30; it utilizes bitter melon protein MAP30 to inhibit lncRNA expression, thereby reducing fluconazole MIC50.

[0012] This invention provides lncRNA sequences expressed in fluconazole-sensitive (FCS) and fluconazole-resistant (FCR) Candida albicans using whole transcriptomics testing. The invention includes: homology alignment of lncRNA sequences with genomic sequences; localization of lncRNAs on chromosomes and identification of open reading frames (ORFs); screening of target genes regulated by lncRNAs; quantitative comparison of endogenous lncRNA expression levels in the FCS and FCR Candida albicans genomes; comparison of lncRNA expression changes in FCR fungi regulated by Momordica charantia protein (MAP30); screening and verification of specific nuclear transcription factors activated by lncRNAs in FCR Candida albicans; determination of expression changes of fluconazole resistance target genes and resistance-related genes dependent on nuclear transcription factors in FCR Candida albicans; and establishment of the relationship between LncRNA expression inhibition and fluconazole resistance reversal in Candida albicans based on the pharmacological effects of MAP30.

[0013] The epigenetic regulators of Candida albicans resistance described in this invention, MSTRG.3070, MSTRG.4532, and MSTRG.4530, are derived using whole transcriptomics sequencing methods (such as...). Figure 1 As shown in A, B, and C), this is the first lncRNA molecule obtained. MSTRG.3070 (i.e., lncRNA1), MSTRG.4532 (i.e., lncRNA2), and MSTRG.4530 (i.e., lncRNA3) are located in the Ca22chr4A_C_albicans_SC5314 region of the Candida albicans chromosome (319686 to 319997, 312 nt in length, as shown in Figure 1). Figure 1 As shown in E), Ca22chr7A_C_albicans_SC5314 (118328 to 119857, length 1530 nt, as shown in E), Figure 1 As shown in F), Ca22chr7A_C_albicans_SC5314 (122235 to 122614, length 380 nt, as shown in F). Figure 1 MSTRG.3070 (as shown in G) is a lncRNA endogenously expressed throughout the genome of Candida albicans. MSTRG.3070 has one ORF, 84 bp in length (as shown in G). Figure 1 As shown in H). MSTRG.4532 has 7 ORFs, the longest of which is 153 bp (as shown in H). Figure 1As shown in Figure I). MSTRG.4530 has one ORF, which is 111 bp in length (as shown in Figure I). Figure 1 (As shown in J). These lncRNA molecules are processed by full transcription from the Candida albicans genome via splicing of the Ago / Dcr1 protein complex (e.g., Figure 2 As shown in A and B), they are synthesized according to the expression of the target genes GPT1, FRE10, and HSE1 mRNA linked to them (see Figure 1). Figure 2 CH is shown.

[0014] The MSTRG.3070, MSTRG.4532, and MSTRG.4530 epigenetically modulate Candida albicans resistance in this invention belong to antisense lncRNA, intergenic lncRNA, and divergent lncRNA molecules, respectively. Figure 1 (As shown in D), this is a type of lncRNA that was first discovered and reported in fluconazole-resistant Candida albicans.

[0015] MSTRG.3070, MSTRG.4532, and MSTRG.4530, which epigenetically regulate Candida albicans resistance, all activate the expression of specific nuclear transcription factors, including BRG1 (see Appendix). Figure 3 A) BCR1 (see appendix) Figure 3 B), FGR27 (see appendix) Figure 3 C) AHR1 (see appendix) Figure 3 D), MRR2 (see appendix) Figure 3 E), WOR1 (see appendix) Figure 3 F) and EFG1 (see appendix) Figure 3 (G). Silenting of these three lncRNAs with siRNA downregulated the expression levels of nuclear transcription factor mRNAs, indicating that MSTRG.3070, MSTRG.4532, and MSTRG.4530 are epigenetic regulatory lncRNAs, which is the first time they have been discovered and reported in fluconazole-resistant (FCR) Candida albicans.

[0016] Nuclear transcription factor activation positively regulates the transcriptional levels of Candida albicans resistance target genes and resistance-related genes (including FAS2 (see Appendix)). Figure 4 A) BGL2 (see appendix) Figure 4 B), ALS3 (see appendix) Figure 4 C) ALS1 (see appendix) Figure 4 D), YWP1 (see appendix) Figure 4 E), HWP1 (see appendix) Figure 4 F), MP65 (see appendix) Figure 4 G), ERG11 (see appendix) Figure 4H), DBP6 (see appendix) Figure 4 I), ALS6 (see appendix) Figure 4 Upregulation of the mRNA synthesis of these three lncRNAs (MSTRG.3070, MSTRG.4532, and MSTRG.4530) enhances the interaction between epigenetic regulation of nuclear transcription factors and the fluconazole resistance response, elucidating a novel mechanism for Candida albicans resistance.

[0017] Pharmacological effects of bitter melon protein MAP30: It downregulates the expression of lncRNAs of MSTRG.3070, MSTRG.4532, and MSTRG.4530; downregulates the expression of nuclear transcription factor mRNAs; inhibits the expression of drug resistance target genes and drug resistance-related genes in Candida albicans; and enhances the sensitivity response of Candida albicans to fluconazole (i.e., downregulation of drug resistance response). This is the first report of the effects of bitter melon protein MAP30 in Candida albicans through downregulation of lncRNA expression and induction of epigenetic regulation, thereby inhibiting fluconazole resistance.

[0018] Compared with existing technologies, this invention provides a long non-coding RNA (three lncRNA molecules) in the Candida albicans genome that epigenetically regulates fluconazole resistance, and its research methods. The research methods include nucleotide sequencing, open reading frame (ORF) alignment, lncRNA localization on chromosomes, and target gene identification techniques linked to lncRNAs. It provides experimental techniques for the epigenetic regulation of Candida albicans' response to fluconazole resistance by lncRNAs, as well as experimental techniques for reverse verification of lncRNA function using siRNA. Using lncRNAs as pharmacological molecules, and utilizing the bitter melon protein MAP30 to inhibit lncRNA expression and reverse fluconazole resistance, this invention provides a theoretical basis for revealing the mechanism of Candida albicans resistance and developing new antifungal drugs and treatment strategies. Attached Figure Description

[0019] Figure 1 To test lncRNA expression in FCS, FCR, and Bitter Melon Protein MAP30-treated FCR Candida albicans using whole transcriptomics methods;

[0020] Figure 2 This study investigated the biosynthesis of lncRNA in FCS, FCR, and bitter melon protein MAP30-treated FCR Candida albicans and the changes in mRNA expression of genes linked to lncRNA.

[0021] Appendix Figure 3 The results of qRT-PCR experiments show that LncRNA positively regulates the expression of nuclear transcription factor mRNA and the pharmacological effects of bitter melon protein MAP30.

[0022] Figure 4 The results of qRT-PCR assays show that the bitter melon protein MAP30 inhibits the expression of fluconazole resistance target genes and related genes mRNA.

[0023] Figure 5 The minimum inhibitory concentration (MIC50, mg / L) of fluconazole against different phenotypes of Candida albicans is given. Detailed Implementation

[0024] The present invention will be further described below with reference to the accompanying drawings and embodiments. Example

[0025] The lncRNA sequences expressed by FCR Candida albicans treated with FCS, FCR, and MAP30 were determined. Homology comparison of fragment sequences in the whole genome of lncRNA sequences was performed. Target genes linked to lncRNAs were screened, and the distribution and localization of their ORFs on chromosomes were determined.

[0026] The original strain was selected from the Candida albicans experimental samples. Candida albicans SC5314 (i.e., FCS bacteria, minimum inhibitory concentration MIC50 ≤ 4.6 mg / L). A technical protocol for obtaining fluconazole resistance was employed, using a conditioned stimulus of progressively increasing fluconazole concentrations (0.53, 1.05, 2.1, 4.2, 8.4 mg / L). Positive colonies of the fungus (FCR fungi, MIC ≥ 8.4 mg / L) were screened on yeast peptone glucose YPD agar plates, transferred to test tube culture media, and stored at 4°C for later use.

[0027] Technical procedure for preparing bitter melon protein MAP30: 100g of peeled bitter melon seeds were soaked in physiological saline at room temperature, ground into a paste, coarsely filtered, and centrifuged at low temperature and ultra-high speed (50,000 rpm, 30 minutes). The supernatant was collected and freeze-dried. The crude product was salted out with saturated sodium persulfate solution, the precipitate was collected, filtered, desalted, and purified by HPLC. The purity was identified by SDS-PAGE electrophoresis. MAP30 has a molecular weight of approximately 30 kD, and its purity was determined to be ≥ 70% by the BCA method. The product is a powder and is stored frozen for later use.

[0028] Technical protocol for MAP30 treatment of FCR Candida albicans: The drug-resistant bacteria were inoculated onto YPD agar plates supplemented with MAP30. The MAP30 dosage was 0.3, 0.6, and 1.2 μL of MAP30 stock solution (concentration of 540.5 μg / μL) per 1 mL of YPD agar medium, with apparent concentrations of 5, 10, and 20 μM, respectively. The inoculated bacterial suspensions were statically cultured at 28°C for 24 hours, and single colonies were selected. Bacterial suspensions (OD200) of FCS, FCR, and MAP30-treated FCR Candida albicans were prepared separately. 600= 0.001, which is ×10 5 (CFU / mL) was inoculated into YPD liquid medium, and OD was measured after 24 hours of incubation. 600 = 0.8-1.0. Take 50 mL of bacterial culture, centrifuge at 4°C (4000 × g, 5 minutes), discard the supernatant, and wash the bacterial precipitate. After flash freezing with liquid nitrogen, transfer to a pre-cooled mortar and grind rapidly into a fine powder, continuously adding liquid nitrogen to prevent melting.

[0029] RNA extraction method: A column-based fungal total RNA extraction and purification kit (Shanghai Sangon Biotech, product number: B518659) was used. 450 μL of buffer lysis-FG was transferred to a 1.5 mL RNase-free centrifuge tube for later use. FCS, FCR, and MAP30-treated FCS Candida albicans samples, ground into powder using liquid nitrogen, were added to the aforementioned 1.5 mL centrifuge tubes, immediately vortexed to mix, and incubated at room temperature for 5 minutes. Centrifuged at 12000 rpm at 4°C for 3 minutes, and the supernatant was transferred to a 1.5 mL RNase-free centrifuge tube. Half a volume of anhydrous ethanol was added, and the mixture was thoroughly mixed. The adsorption column was placed in a collection tube, and the entire solution was added to the column using a pipette. The column was allowed to stand for 1 minute, then centrifuged at 12000 rpm for 1 minute at room temperature. The waste liquid in the collection tube was discarded. The adsorption column was returned to the collection tube, 500 μL of GT Solution was added, the column was allowed to stand for 1 minute, then centrifuged at 10000 rpm for 1 minute at room temperature. The waste liquid in the collection tube was discarded. Place the adsorption column back into the collection tube, add 500 μL of NT Solution, let stand for 1 minute, centrifuge at 10,000 rpm for 1 minute at room temperature, and discard the waste liquid in the collection tube. Place the adsorption column back into the collection tube and centrifuge at 12,000 rpm for 2 minutes at room temperature. Transfer the adsorption column to a 1.5 ml RNase-free centrifuge tube, add 30 μL of DEPC-treated ddH2O to the center of the adsorption membrane, let stand for 2 minutes, and centrifuge at 12,000 rpm for 2 minutes. Store the resulting RNA solution at -70°C and send samples for whole transcriptomics experiments.

[0030] Whole transcriptomics testing: After removing ribosomal RNA from the sample, it was randomly fragmented into short strands. Using the fragment sequence as a template, the first strand of cDNA was synthesized using six-base random hexamers. The second strand of cDNA was then synthesized with buffer, dNTPs, RNase H, and DNA polymerase I. The cDNA was purified using a QIAquick PCR kit and eluted with EB buffer. After end repair, addition of base A, and the addition of sequencing adapters, the second strand was degraded by UNG (Uracil-N-Glycosylase). Fragment size selection was performed using agarose gel electrophoresis, followed by PCR amplification. Finally, sequencing was performed using the constructed library. The raw data obtained from sequencing was filtered to obtain clean reads. The effective reads after removing ribosomal RNA from the clean reads were aligned with the reference sequence. Based on the alignment results, analyses such as new transcript prediction and differentially spliced ​​gene detection were performed. Quantitative analysis was performed on known and novel genes, differential expression analysis was conducted based on gene expression levels in different sample groups, and further in-depth analysis was performed, including prediction of the coding capacity of differentially expressed transcription factors. Functional prediction was also performed on differentially expressed lncRNAs, including... cis / trans Functional analysis and antisense lncRNA-mRNA sequence similarity.

[0031] Based on StringTie assembly results, a series of stringent screening conditions were set according to the structural characteristics of lncRNAs and their non-coding protein functional characteristics. CPC analysis, CNCI analysis, and pfam protein domain analysis were selected to predict coding potential and to statistically identify negative (NC) transcripts. In RNA-seq analysis, gene expression levels were assessed by counting sequencing reads located in genomic regions or gene exons. To ensure comparability of read counts between different genes and experimental groups, the FPKM (Expected number of fragments per kilobase of transcript sequence per millions of base pairs sequenced) method was used to estimate gene expression levels. The BLAST database (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) was used to perform homology comparisons between lncRNA sequences and whole genome sequences to determine their distribution and location on the Candida albicans chromosome and to screen for target genes linked to lncRNAs. The ORF results of lncRNAs were predicted using the ORF Finder tool (https: / / www.ncbi.nlm.nih.gov / orffinder / ).

[0032] Quantitatively compare the endogenous expression levels of lncRNAs in the genomes of FCS and FCR Candida albicans, and compare the changes in lncRNA expression levels in FCR fungi inhibited by MAP30.

[0033] The protein splicing complex (Protein Argonaute, Ago and Protein Dicer, Dcr1) endogenously expressed by lncRNA in Candida albicans was determined by Western blotting (WB). Protein extraction: 50 mL of Candida albicans bacterial culture treated with FCS, FCR, and MAP30 (5, 10, 20 μM) was centrifuged at 4°C (4000×g, 5 min), the supernatant was discarded, and the bacterial pellet was flash-frozen in liquid nitrogen. The pellet was then transferred to a pre-chilled mortar and rapidly ground into a fine powder. The powder was transferred to 100 μL of lysis buffer, and 2 μL of protease inhibitor was added. Lysis was performed on ice for 30 min, followed by centrifugation (12000×g, 15 min), and the supernatant was collected. Protein concentration was determined by BCA method. WB analysis: 4 μL of sample was added to each well for SDS-PAGE electrophoresis separation, followed by membrane transfer, blocking, and antibody incubation. The primary antibodies used were Ago1 (code: 5053T, dilution 1:2000) and Dcr1 (code: 24622-1-AP, dilution 1:2000). The secondary antibody was rabbit anti-GAPDH antigen affinity-purified pAb (code: AB0038, dilution 1:5000). The internal control was GAPDH (glyceraldehyde phosphate dehydrogenase, code: 60004-1-Ig, dilution 1:50000).

[0034] The expression levels of lncRNAs and their linked genes were determined using quantitative reverse transcription PCR (qRT-PCR). Candida albicans treated with FCS, FCR, and MAP30 (5, 10, 20 μM) were collected, and RNA was extracted using a column-based fungal total RNA extraction and purification kit. 1 μg of RNA was transferred and reverse transcribed using the PrimeScript reverse transcriptase reagent kit. cDNA templates were synthesized and amplified using a PCR instrument.

[0035] Primer sequences involved:

[0036] MSTRG.3070, 5′-taCCGGGGGCGTTTACTAAGC-3′(F) / 5′-CGTGTTACCAGATCTCGTCGA-3′(R);

[0037] MSTRG.4532, 5′-tcAACTGTCTGAAATCCTTGGA-3′(F) / 5′-CCAGCTT GGGTTCACACCTT-3′(R);

[0038] MSTRG.4530, 5′-gtTGAGGCGTAGGGTATGCA-3′(F) / 5′-GCGGGCGggttttgatattt-3′(R);

[0039] The gene GPT1,5′-TT GGCGTCTAGTCGTGTCAC-3′(F) / 5′-CGATACTGACATCACCCCCG-3′(R) is linked to MSTRG.3070.

[0040] The gene FRE10,5′-TGGTTGATGCCACCATTGGT-3′(F) / 5′-CATACCGACCCCATGAGCAA-3′(R) is linked to MSTRG.4532.

[0041] The gene HSE1,5′-ATCGCCTCCAGTGGAAACAG-3′(F) / 5′-TCCTCTCCACCAGTCACGAT-3′(R) is linked to MSTRG.4530.

[0042] Glyceraldehyde-3-phosphate dehydrogenase 3 (TDH3, primers: 5′-AAGGACTGGAGAGGTGGTAGAACTG-3′(F) / 5′-GAAACATCGGTGGTTGGGACTC-3′(R)) was selected as an internal control, and the results of lncRNA and its linked gene expression mRNA were analyzed according to the ΔΔCT statistical method.

[0043] In FCR Candida albicans, we verified the nuclear transcription factors specifically activated by lncRNA and investigated the pharmacological effects of MAP30.

[0044] We constructed siRNA-induced lncRNA expression silencing bacteria (MSTRG.3070 siRNA silencing bacteria, MSTRG.4532 siRNA silencing bacteria, and MSTRG.4530 siRNA silencing bacteria), and compared the results with the negative control group (NC group, i.e., lithium acetate transfection without siRNA). We also compared the changes in mRNA expression of common nuclear transcription factors in FCR Candida albicans before and after MAP30 (20 μM) treatment.

[0045] The siRNA sequence used is

[0046] MSTRG.3070 siRNA:UUCCAUUGGAUAAGUCAUGC,

[0047] MSTRG.4532 siRNA:UUAGUAGGAUUAAUUUACC,

[0048] MSTRG.4530 siRNA:UAAUUCUGUAACAUGUACG.

[0049] 100 nmol siRNA was continuously induced for 24 hours using lithium acetate transfection. Then, siRNA-transfected and siRNA + MAP30-treated FCR fungi were inoculated onto YPD agar plates. Positive colonies were screened, transferred, stored, and stored for later use. Total RNA was extracted using a column-based fungal total RNA extraction and purification kit. Approximately 1 μg of RNA sample was transferred and reverse transcribed using the PrimeScript reverse transcriptase reagent kit. cDNA template was synthesized and amplified by PCR. PCR primer sequences for nuclear transcription factors were determined.

[0050] BRG1: 5′-GAATCGCCACACATTGCCTC CTTTG-3′(F) / 5′-TGTTGTTGTTGTGGTGGTGGTTG-3′(R);

[0051] BCR1: 5′-CAATC ACAGCACGCATCTATGGC-3′(F) / 5′-AGCAGGTATTGGTGGCAATGGAG-3′(R);

[0052] FGR27: 5′-AAGACTCCGCCATGTGGTGTG-3′(F) / 5′-CGATGCAACCCC AAAGACTGTG-3′(R);

[0053] AHR1: 5′-CAATAAAGCGCAGCCGGACAC-3′(F) / 5′-CAATAAAGCGCAGCCGGACAC-3′(R);

[0054] MRR2: 5′-CACCACTGCCACCAT TTGCTTG-3′(F) / 5′-GGGCTCGGTATGTATGCTTCTCC-3′(R);

[0055] WOR1: 5′-CC TGGTGGATCAAGTGGTAGTGG-3′(F) / 5′-TGTTTCCAGCAGCAACCAATGTTC-3′(R);

[0056] EFG1: 5′-TCAGTATCCTGCCGCAACATCTC-3′(F) / 5′-TGCTGAGGTTGTGGCTGTGAC-3′(R);

[0057] Internal reference TDH3: 5′-AAGGACTGGAGAGGTGGTA GAACTG-3′(F) / 5′-GGAAACATCGGTGGTTGGGACTC-3′(R).

[0058] Then, the ΔΔCT statistical method was used to analyze the changes in mRNA expression of nuclear transcription factors specifically activated by MSTRG.3070, MSTRG.4532, and MSTRG.4530, including the results of BRG1, BCR1, FGR27, AHR1, MRR2, WOR1, and EFG1.

[0059] In FCR Candida albicans, the expression changes of fluconazole resistance target genes and resistance-related genes regulated by nuclear transcription factors were measured, and the relationship between the inhibition of Candida albicans LncRNA expression and the reversal of fluconazole resistance based on the pharmacological effect of MAP30 was established.

[0060] In *Candida albicans* refractory cultivar (FCR), the expression of fluconazole resistance target genes and resistance-related genes regulated by nuclear transcription factors was determined by qRT-PCR, and the results were compared with those of *Candida albicans* refractory cultivars treated with 5, 10, and 20 μM MAP30. Bacterial strains were inoculated onto solid YPD plates, positive colonies were selected, cultured in YPD liquid medium, and total RNA was extracted. Fluconazole resistance target genes and resistance-related genes included FAS2, BGL2, ALS3, ALS1, YWP1, HWP1, MP65, ERG11, DBP6, and ALS6.

[0061] The reverse transcription primer sequence is

[0062] FAS2:5′-GTTGGGACGCTCGTACCTATGG-3′(F) / 5′-CAAGGCTTCAACAGTGGCAACC-3′(R)

[0063] BGL2:5′-AGCTGCTGAA GCTGAAGGATTCC-3′(F) / 5′-TGGTGGAGACGGAAATCTTTGGC-3′(R)

[0064] ALS3:5′-AGGAACCACCAAACCCAACTGTC-3′(F) / 5′-CTGGAGGAGCGGTA ATGGTAGTG-3′(R)

[0065] ALS1:5′-TGACAACAGGCACCTCAGCATC-3′(F) / 5′-T GGCAACAGCTCCACCAGTAAC-3′(R)

[0066] YWP1:5′-TTCTCCATCTGGTTCC GAATCCG-3′(F) / 5′-AGTAGCAGTAGCGGCAGAATCAC-3′(R)

[0067] HWP1:5′-T CTGCTCCTGCTCCTGAAATGAC-3′(F) / 5′-TGGAGAAGAAGAAGCACCTG GAC-3′(R)

[0068] MP65:5′-ACTCTGGTGCTTGGGTCTTGC-3′(F) / 5′-ACTCTTAGA TGGAACGGCGACAC-3′(R)

[0069] ERG11:5′-GGGGTTGCCAATGTTATGAAAA CTC-3′(F) / 5′-AGCAGCATCACGTCTCCAATAATG-3′(R)

[0070] DBP6:5′-CCGAT GTCATCAACTACGACTTACC-3′(F) / 5′-CTTGGTTGGCTCTCGCAGTTC-3′(R)

[0071] ALS6:5′-AGAGGCGTTTGGTACCGTCAG-3′(F) / 5′-ACAGTGTTCGTTC CAGCAGT-3′(R).

[0072] In general, the ΔΔCT kit is strong.

[0073] The relationship between MAP30 inhibition of Candida albicans lncRNA expression and reversal of fluconazole (FC) resistance was investigated using the microdilution gradient method to determine MIC50. Candida albicans was cultured in YPD liquid medium containing MSTRG.3070 siRNA-silenced, MSTRG.4532 siRNA-silenced, and MSTRG.4530 siRNA-silenced bacteria, as well as MSTRG.3070 siRNA-silenced, MSTRG.4532 siRNA-silenced, and MSTRG.4530 siRNA-silenced bacteria treated with 20 μM MAP30. FC was added to the liquid medium at concentration gradients ranging from 134.4 to 0.63 mg / L, while the control group received no FC. The fungal cultures were incubated on a shaker for 24 hours at 37°C. The optical density (OD) was measured using a UV-Vis spectrophotometer. 600 The antibacterial rate was calculated, and the result was repeated three times to calculate the average value. The Boltzmann equation was used to fit the curve of antibacterial rate versus FC molar concentration to obtain the MIC50 value.

[0074] Figure 1 To identify long non-coding RNAs (lncRNAs) expressed by fluconazole-sensitive (FCS) Candida albicans, fluconazole-resistant (FCR) Candida albicans, and FCR Candida albicans treated with bitter melon protein MAP30 using whole transcriptomics methods; Figure A: Principal component analysis (PCA, n=3) of transcriptomics results; B: OPLS-DA analysis of FCS and FCR group samples (n=3); C: OPLS-DA analysis of FCR and FCR-MAP30 treated samples (n=3); D: LncRNA classification statistics, identifying 5 classes of lncRNAs (Intergenic, Antisense, Divergent, Intronic, Sense); E: MSTRG.3070 lncRNA in Candida albicans. Candida albicans Location and sequence site distribution of SC5314 on chromosome 4; F): MSTRG.4530 lncRNA in Candida albicans Candida albicans Location and sequence site distribution of SC5314 on chromosome 7; G): MSTR G.4532 lncRNA in Candida albicans Candida albicans Location and sequence site distribution on chromosome 7 of SC5314; H): Number of open reading frames (ORFs) of MSTRG.3070 lncRNA, their ORF frameshift type, and sequence length; I): Number of open reading frames (ORFs) of MSTRG.4530 lncRNA, their ORF frameshift type, and sequence length; J): Number of open reading frames (ORFs) of MSTRG.4532 lncRNA, their ORF frameshift type, and sequence length.

[0075] Appendix Figure 2 This study describes the biosynthesis of lncRNAs and the changes in mRNA expression of genes linked to lncRNAs in fluconazole-sensitive (FCS), fluconazole-resistant (FCR), and *Candida albicans* treated with MAP30 (bitter melon protein) (n=3). Figures show: A) and B): Western blotting results of the Ago / Dcr1 splice protein complex; C): MSTRG.3070 lncRNA expression; D): MSTRG.4530 lncRNA expression; E): MSTRG.4532 lncRNA expression; F): GPT1 mRNA expression linked to MSTRG.3070; G): FRE10 mRNA expression linked to MSTRG.4530; H): HSE1 mRNA expression linked to MSTRG.4532. Statistical differences or ranges refer to... p The value is calculated using the t-test method. p ≥0.05 indicates no difference (NS). p <0.05 (#: FCR) versus FCS; *: MAP30-FCR versus FCR indicates a difference. p ≤0.01 indicates a significant difference (##: FCR) versus FCS; **: MAP30-FCR versus FCR). p ≤0.001 indicates an extremely significant difference (###: FCR) versus FCS; ***: MAP30-FCR versus FCR).

[0076] Appendix Figure 3 The results of qRT-PCR experiments (n=3) on the positive regulation of nuclear transcription factor mRNA expression by lncRNA and the pharmacological effects of bitter melon protein MAP30 are shown in the figure. Figure A): Changes in nuclear transcription factor BRG1 mRNA expression; B): Changes in nuclear transcription factor BCR1 mRNA expression; C): Changes in nuclear transcription factor FGR27 mRNA expression; D): Changes in nuclear transcription factor AHR1 mRNA expression; E): Changes in nuclear transcription factor MRR2 mRNA expression; F): Changes in nuclear transcription factor WOR1 mRNA expression; G): Changes in nuclear transcription factor EGF1 mRNA expression. Statistical differences or ranges refer to... p The value is calculated using the t-test method. p ≥0.05 indicates no significance (NS). p <0.05 (#: FCR) versus FCS; *: MAP30-FCR versus FCR; MSTRG.3070 siRNA versus FCR; MSTRG.4532 siRNA versus FCR; MSTRG.4530 siRNA versus FCR; MSTRG.3070 siRNA / or MSTRG.4532 siRNA / or MSTRG.4530 siRNA versus (MAP30+ MSTRG.3070 siRNA / or MSTRG.4532 siRNA / or MSTRG.4530 siRNA) indicates a difference. p ≤0.01 indicates a significant difference (##: FCR) versus FCS; **: MAP30-FCR versus FCR; MSTRG.3070 siRNA versus FCR; MSTRG.4532 siRNA versus FCR; MSTRG.4530 siRNA versus FCR). p ≤0.001 indicates an extremely significant difference (###: FCR) versus FCS; ***: MAP30-FCR versus FCR; : MSTRG.3070 siRNA versus FCR; MSTRG.4532 siRNA versus FCR; MSTRG.4530 siRNA versus FCR).

[0077] Figure 4The results of qRT-PCR assays (n=3) show the inhibition of fluconazole resistance target genes and related genes by the bitter melon protein MAP30. Figure A shows FAS2 mRNA expression; B shows BGL2 mRNA expression; C shows ALS3 mRNA expression; D shows ALS1 mRNA expression; E shows YWP1 mRNA expression; F shows HWP1 mRNA expression; G shows MP65 mRNA expression; H shows ERG11 mRNA expression; I shows DBP6 mRNA expression; and J shows ALS6 mRNA expression. Statistical differences or ranges refer to... p The value is calculated using the t-test method. p ≥0.05 indicates no significance (NS). p <0.05 (#: FCR) versus FCS; *: MAP30-FCR versus FCR indicates a difference. p ≤0.01 indicates a significant difference (##: FCR) versus FCS; **: MAP30-FCR versus FCR). p ≤0.001 indicates an extremely significant difference (###: FCR) versus FCS; ***: MAP30-FCR versus FCR).

[0078] Figure 5 The minimum inhibitory concentration (MIC50, mg / L) of fluconazole against different phenotypes of Candida albicans is given. Statistical differences or ranges refer to... p The value was calculated using the t-test method. p A value >0.05 indicates no significance (NS). p ≤0.05 (*: MAP30-FCR) versus FCR; MSTRG.3070 siRNA versus FCR; MSTRG.4532 siRNA versus FCR; MSTRG.4530 siRNA versus FCR; MAP30-MSTRG.4530 siRNA versus MSTRG.4530 siRNA), indicating a difference. p ≤0.01 (##: FCR) versus FCR indicates significant differences.

[0079] SEQUENCE LISTING

[0080] SEQ ID NO.1: LncRNA1 (MSTRG.3070, sequence length 312 nt)

[0081] … a)319686 ATTTTTGTTGAAAAAGATACCGGGGCGTTTACTAAGCCAAATAGCATGACTATCCAATGGAAACTTCCGAATGAGGTGTGAATAGCTCGTTTTCAAATCAATCCGAAGGACTTAGTGTCTGACAGAATTGGAATTTCATTTTGAAATTACTTTCAAA TCCATGATCGACGAGATCTGGTAACACGACTAACAGATTTATGATTTATATTATAATAGGAATGAAATTGAATATACTAAAATCAATTTGTATATTCTTTATTTTTTTTTTTTGTATTATTTAAAAGTAATATTATATGTTTTAAAGATAGTTTAT 319997a) …

[0082] Note: a) The sequence number indicates the genome-wide sequence location. MSTRG.3070 is located in the chromosomal region Ca22chr4A_C_albicans_SC5314 (sequence location: from 319686 to 319997, length 312 nt). There is one open reading frame (ORF) of 84 bp.

[0083] SEQ ID NO.2: LncRNA2 (MSTRG.4530, sequence length 1530 nt)

[0084] … a)118328119857a) …

[0085] Note: a) The sequence number indicates its location within the whole genome. Sequence MSTRG.4532 is located in the chromosomal region Ca22chr7A_C_albicans_SC5314 (sequence location: from 118328 to 119857, length 1530 nt). It has 7 open reading frames (ORFs), with the longest ORF being 153 bp.

[0086] SEQ ID NO.3: LncRNA3 (MSTRG.4532, sequence length 380 nt)

[0087] … a)122235 ACTTCTTCTTTTTCTTTTTTTGATATCAACTGTCTGAAATCCTTGGATTACACATCTTGATTTAAAGTTGTTCCCTTTCTGTCATTTGACTTTGAAGGTGTGAACCCAAGCTGGGATTATTTTTTCTCCTAACGGAGGAATATTATCACCTCAACAAATCCTTTTTTTAAAAAAGGTAAATTAATCCTAC TAATTAACTTATCCCGGTCCTTTTTTTTCCTTCTTTCTACGTATCAATTACGAATAATTGAGAAAGTATGGCCAATGAAAGAAGAAGAAAAAAGAGATCAATTTAGTAATTATAATCATTTCGACTGTCAAACAAGGTTGAAATGGTTCCTTATTTTAAAATATGTTTATGAATATATGAATTATT 122614a) …

[0088] Note: a) The sequence number indicates the genome-wide sequence location. MSTRG.4530 is located in the chromosomal region Ca22chr7A_C_albicans_SC5314 (sequence location: from 122235 to 122614, length 380 nt). There is one open reading frame (ORF) of 111 bp.

Claims

1. A Candida albicans long non-coding RNA that epigenetically regulates fluconazole resistance, characterized in that, The nucleotide sequence of the lncRNA is shown in SEQ ID NO.1-3.