Method for detecting gene mutations based on digital PCR
Through digital PCR combined with stem loop structure beacon probe and fluorescence quenching mechanism, the low sensitivity and complex operation of FLT3-ITD mutation detection are solved, and efficient and rapid mutation detection is achieved, suitable for FLT3-ITD mutation detection in clinical AML patients.
Patent Information
- Application Number
- CN202311369663.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-10-20
- Publication Date
- 2025-08-26
- Estimated Expiration
- 2043-10-20
AI Technical Summary
The existing FLT3-ITD mutation detection methods have problems such as low sensitivity, complex operation, long detection time, high cost and strict sample requirements, which are difficult to meet the rapid, sensitive and efficient detection needs of clinical AML patients.
Using a digital PCR-based method, multiple beacon probes are used to design beacon probes with stem-loop structures. Some of the beacon probes contain anti-interference sequences, which improve detection sensitivity through fluorescence quenching mechanism, and use the effects of 5`-3` exonuclease and DNA polymerase to achieve specific fluorescence detection of the target sequence.
It improves the sensitivity of FLT3-ITD mutation detection, simplifies the operation process, reduces detection costs, solves the freshness requirements of samples, can detect unknown and uncertain point mutations of diversity, reduces fluorescence signal interference, and improves the accuracy and efficiency of detection.
Smart Images

Figure CN117467748B_ABST
Abstract
Description
Technical Field
[0001] The present application relates to the field of gene detection technology, and in particular to a method for detecting gene mutations based on digital PCR for non-diagnostic purposes. Background Art
[0002] The FLT3 gene, short for FMS-like tyrosine kinase 3, encodes a membrane-bound receptor tyrosine kinase (RTK) belonging to the RTK subclass III family, along with KIT, CSF1R, PDGFRA, and PDGFRB. The FLT3 protein consists of an Ig-like extracellular domain, a transmembrane domain (TMD), a juxtamembrane domain (JMD), and a tyrosine kinase domain (TKD). The human FLT3 gene is located on chromosome 13q12.2 and consists of 24 exons. It is a proto-oncogene that plays a critical role in the proliferation, differentiation, and survival of hematopoietic cells. In recent years, FLT3 has become an important marker for various hematologic malignancies, particularly in acute myeloid leukemia (AML), where FLT3 mutations are associated with clinical prognosis, treatment, and survival.
[0003] AML (acute myelocytic leukemia) is a highly heterogeneous hematopoietic stem and progenitor cell tumor. The annual incidence in China is approximately 1.6 to 2.3 per 100,000, with 24,000 new patients each year, including approximately 8,000 elderly patients over 60 years old. At present, the main molecular markers found to be associated with AML include FLT3, NPM1, CEBPA, etc. In 1996, the internal tandem duplication (FLT3-ITD) of the JM domain of the FLT3 gene was first discovered in AML cells. Subsequently, people discovered the D835 point mutation and deletion and insertion mutations of other codons near D835 in the TK domain. In 2022, the NCCN guidelines emphasized that the FLT3 gene can be used as a molecular marker to clarify the prognosis classification of AML, especially for patients with normal karyotype. FLT3 mutations account for approximately 30% of adult AML cases; the primary mutation is an internal tandem duplication (FLT3-ITD) in the juxtamembrane domain (exons 14 and 15, separated by an intron), accounting for approximately 25%. A smaller proportion is a point mutation (FLT3-TKD) or deletion in the tyrosine kinase domain (exon 20), accounting for approximately 5%. FLT3-ITD mutations can cause FLT3 to dimerize and continuously autophosphorylate in the absence of ligand binding, enhancing tyrosine kinase activity and persistently activating downstream signaling pathways (RAS / MAPK, PI3K / AKT, etc.), leading to dysregulated cell proliferation and accelerating AML relapse. Compared with patients without FLT3 mutations, AML patients with FLT3-ITD mutations have a shorter CR duration, a higher relapse rate, and a shorter overall survival. FLT3-ITD indicates increased disease risk and a poorer prognosis. Currently, FLT3-ITD mutations are an important indicator for routine AML testing. Among newly diagnosed AML patients, approximately 30% harbor FLT3 mutations. Compared with patients without FLT3 mutations, AML patients with FLT3-ITD mutations have shorter CR duration, higher relapse rates, and shorter overall survival. Regardless of cytogenetic classification, the presence of FLT3-ITD indicates a significantly increased risk of disease relapse and a poor overall prognosis for patients. Therefore, FLT3-ITD mutations have become an important indicator for routine AML testing. Methods that can be used to detect FLT3 gene mutations include PCR capillary electrophoresis, next-generation sequencing, whole-genome sequencing, and whole-exome sequencing. PCR-gene scanning is a generally recognized detection method due to its rapidity, simplicity, and low cost. NGS is also one of the most widely used detection methods.
[0004] The insertion sites and sequences of FLT3-ITD mutations vary, with lengths generally ranging from 3 to 400 bp. They always appear in multiples of 3, preserving the transcript's reading frame (ORF). This diversity of tandem repeat mutations increases the difficulty of detection. Currently, the main methods for detecting FLT3-ITD mutations in AML include direct sequencing, fluorescence quantitative PCR, capillary electrophoresis, and flow cytometry. Direct sequencing has the disadvantages of long detection time and high cost. There are also many reports that if the primer specificity is poor, it will lead to high background peaks in the sequencing peak graph, affecting the judgment of the mutation. Fluorescence quantitative PCR has the disadvantage of only being able to design primer probes for site-directed mutations, which may cause fluorescence signal interference in the case of multiple probes. Capillary electrophoresis has the disadvantages of complex operation, low detection throughput, and sensitivity of 0.5%-10%. Flow cytometry has the disadvantages of very stringent sample requirements and the need for fresh samples to be sent in a timely manner.
[0005] In summary, there is an urgent need to develop a highly sensitive, rapid, easy-to-operate, and comprehensive detection method for the detection of FLT3-ITD in clinical AML patients. Summary of the Invention
[0006] Based on this, it is necessary to provide a method for detecting gene mutations based on digital PCR for non-diagnostic purposes with high sensitivity and relatively simple operation. Of course, the method of the present application is not limited to the FLT3 gene, and can also be used to detect deletions or insertions in other genes.
[0007] The present application provides a method for detecting gene mutations based on digital PCR for non-diagnostic purposes, comprising the following steps:
[0008] A PCR reaction system for detecting a sample is prepared using a kit and the sample is added; wherein the kit includes a plurality of beacon probes, at least some of which have a stem-loop structure, the beacon probes having the stem-loop structure including a connected stem portion and a loop portion, the loop portion including a connected target pairing sequence and an anti-interference sequence, wherein the anti-interference sequence of one beacon probe is at least partially paired with the anti-interference sequence of another beacon probe, so that the beacon probe cannot return to the stem-loop structure during renaturation;
[0009] Loading the PCR reaction system into the digital PCR chip;
[0010] placing the digital PCR chip into a digital PCR instrument for PCR amplification to obtain an amplification result;
[0011] The digital PCR chip having obtained the amplification result is placed in a chip scanner for fluorescence signal scanning, and the mutation result is interpreted according to the fluorescence signal.
[0012] In one embodiment, the digital PCR is Naica digital PCR.
[0013] In one embodiment, the 5' end of each probe is connected to a fluorescent reporter group, and the 3' end is connected to a fluorescent quencher group.
[0014] The above-mentioned method for detecting gene mutations based on digital PCR adopts a kit including multiple new label probes. The new label probe is provided with an anti-interference sequence. The interference sequence can be designed according to the temperature characteristics of DNA to at least partially pair with the anti-interference sequence in the process of fluorescence detection experiment. The beacon probe that is not paired with the template chain can overcome the problem of fluorescent labeling caused by the limited existing fluorescent labels. When the target sequence has no variation, the target pairing sequence is paired with the target sequence, but under the action of the 5'-3' exonuclease, at least one sequence in the stem pairing sequence-the anti-interference sequence after cutting is paired and bound to each other, and the fluorescent label and quenching label on the paired side of each beacon probe are close to each other to quench the fluorescence. When there is a mutation in the target sequence, the target pairing sequence cannot be paired with the target sequence, the beacon probe cannot be hydrolyzed, and the template chain is paired and bound with the adapter sequence hydrolyzed from other beacon probes. Under the action of DNA polymerase and 5'-3' exonuclease, DNA extension is initiated, thereby degrading the anti-interference sequence bound to the 5' end of the template strand beacon probe, which emits fluorescence during detection. This facilitates the detection of specific fluorescence intensities or fluorescence of fluorescent markers, thereby improving detection sensitivity. This overcomes the problem of fluorescence signal interference caused by the limited number of existing fluorescent markers during detection, resulting in high sensitivity and relatively simple operation.
[0015] In one embodiment, the anti-interference sequence is 4-10 bp in length. Preferably, the anti-interference sequence is 6 bp in length. Preferably, the anti-interference sequence comprises at least one of the following sequences: CTAGCT, AGTTCC, CACGAT, TCGAAG, GTAGAG, GTTTCG, TGACAC, AGTCAA, AGCTAG, GGAACT, ATCGTG, CTTCGA, CTCTAC, CGAAAC, TTGACT, GTGTCA.
[0016] In one embodiment, after the anti-interference sequence of one beacon probe is at least partially paired with the anti-interference sequence of another beacon probe, the fluorescent label and the quenching label on the paired sides of the two beacon probes are brought closer to quench the fluorescence.
[0017] In one embodiment, the beacon probe includes a first stem pairing sequence-a first anti-interference sequence-a target pairing sequence-a second anti-interference sequence-a second stem pairing sequence, wherein the first stem pairing sequence and the second stem pairing sequence are used to maintain the stem-loop structure of the beacon probe; wherein the first stem pairing sequence and the second stem pairing sequence are used to maintain the stem-loop structure of the beacon probe, and at least one sequence in the first anti-interference sequence-first stem pairing sequence of one of the beacon probes is partially paired with at least one sequence in the second anti-interference sequence-second stem pairing sequence of another beacon probe, so that the beacon probe cannot be restored to the stem-loop structure during renaturation; after at least one sequence in the first anti-interference sequence-first stem pairing sequence of one of the beacon probes is partially paired with at least one sequence in the second anti-interference sequence-second stem pairing sequence of another beacon probe, the fluorescent label and the quenching label on the paired side of each beacon probe are brought close to quench the fluorescence.
[0018] In one embodiment, the length of the first anti-interference sequence and / or the second anti-interference sequence is 4-10bp. In one embodiment, the length of the first anti-interference sequence and / or the second anti-interference sequence is 6bp, and the first anti-interference sequence and / or the second anti-interference sequence include but are not limited to at least one of the following sequences: CTAGCT, AGTTCC, CACGAT, TCGAAG, GTAGAG, GTTTCG, TGACAC, AGTCAA, AGCTAG, GGAACT, ATCGTG, CTTCGA, CTCTAC, CGAAAC, TTGACT, GTGTCA, etc. Of course, the first anti-interference sequence and / or the second anti-interference sequence include but are not limited to the above-mentioned length and specific sequence. According to the concept of the present invention, other similar sequences that can play an anti-interference function can also be used.
[0019] In one embodiment, among a plurality of beacon probes, at least some of the beacon probes include a first stem pairing sequence-a first anti-interference sequence-a target pairing sequence-a second anti-interference sequence-a second stem pairing sequence, wherein the first stem pairing sequence and the second stem pairing sequence are used to maintain the stem-loop structure of the beacon probe, and at least one sequence in the first anti-interference sequence and the first stem pairing sequence of one of the beacon probes and at least one sequence in the second anti-interference sequence and the second stem pairing sequence of another beacon probe are at least partially paired so that the beacon probe cannot be restored to the stem-loop structure during renaturation. In this way, after the target sequence is paired with the corresponding template sequence, the corresponding operation method based on the 5`-3` exonuclease and DNA polymerase is used to perform fluorescence quenching on the anti-interference sequence, thereby facilitating the detection of a specific fluorescence intensity or the fluorescence of the fluorescent label, thereby improving the detection sensitivity. Specifically, for example:
[0020] When there is an insertion mutation in the template, at 60 degrees, during the PCR process, the beacon probe (such as one labeled with a red fluorescent group) cannot pair with the template, while other beacon probes (such as one labeled with a green fluorescent group) can bind to the template, thereby undergoing hydrolysis, cutting the linker sequences at the 5' and 3' ends, and emitting fluorescence (such as green fluorescence).
[0021] At 55 degrees, beacon probes that are not bound to the template can pair with sequences hydrolyzed from other beacon probes. When the temperature is further lowered, the stem-loop structure of the beacon probe can also remain open and emit fluorescence (such as red fluorescence).
[0022] At 30 degrees, the two end adapter sequences that were previously cleaved by hydrolysis are reattached, thus achieving fluorescence quenching. At this time, only the red fluorescence of the beacon probe remains, thus identifying the insertion mutation.
[0023] In one embodiment, the first anti-interference sequence of one of the beacon probes and the second anti-interference sequence of another beacon probe are at least partially paired, and the two beacon probes are labeled with different fluorescent labels.
[0024] In one embodiment, after the target pairing sequence in the beacon probe is paired with the template chain, the target pairing sequence in the middle of the beacon probe is hydrolyzed under the activity of 5'-3' exonuclease to release the stem pairing sequences at the opposite ends of the target pairing sequence - the anti-interference sequence.
[0025] In one embodiment, after the two beacon probes are at least partially paired, the stem sequence - the anti-interference sequence, under the action of DNA polymerase, uses the other beacon probe as a template chain to trigger DNA extension, thereby degrading the anti-interference sequence bound to the 5' end of the other beacon probe and emitting fluorescence during detection.
[0026] In one embodiment, at least one sequence in the first anti-interference sequence-first stem pairing sequence of each beacon probe can be paired with at least a portion of at least one sequence in the second anti-interference sequence-second stem pairing sequence of another beacon probe, so as to bring the fluorescent label and quenching label of the paired sides closer to quench the fluorescence.
[0027] In one embodiment, the molar concentrations of the paired beacon probes are equal.
[0028] In one of them, the anti-interference sequences of two described beacon probes can not be paired with each other, and described test kit also includes anti-interference reagent, and described beacon probe includes the first stem paired sequence-the first anti-interference sequence-target paired sequence-the second anti-interference sequence-the second stem paired sequence, and at least one of described stem paired sequence and the first anti-interference sequence is paired with described anti-interference sequence reagent at least in part, so that described beacon probe can't be restored to described stem-loop structure when renaturation.In the present embodiment, instead of using other probe sequences to resist interference sequence and carry out fluorescence quenching, the present embodiment adopts other anti-interference sequence reagent to complete fluorescence quenching, certainly also need to combine the corresponding operation method of 5`-3` exonuclease and DNA polymerase, carry out fluorescence quenching for anti-interference sequence, and then be convenient to detect specific fluorescence intensity or fluorescent-labeled fluorescence, thereby can improve detection sensitivity.
[0029] In one embodiment, the kit includes a forward primer, a reverse primer, and a plurality of the beacon probes.
[0030] In one embodiment, the method is used to detect insertion, deletion or overexpression of gene fragments at random points in a region.
[0031] In one embodiment, the method is used to detect FLT3-ITD gene mutations.
[0032] In one embodiment, the sequence of the forward primer is: 5'-tgcagaactgcctattccta-3'; the sequence of the reverse primer is: 5'-ctggattgagactcctgtt-3'; the multiple probe sequences include at least one of JMB-1, JMB-2, JMs, JmZ, HR1, B1-S, NBL and B2-S, wherein:
[0033] The sequence of JMB-1 is:
[0034] 5`-cggcgcCTAGCTtctgaagCAATTTAGGTATGAAAGCCAAGTCAAgcgccg-3`;
[0035] The sequence of JMB-2 is:
[0036] 5`-cggcgcAGTTCCAGCCAGCTACAGATGGTACAGGTAGCTAGgcgccg-3`;
[0037] The sequence of JMs is:
[0038] 5`-cggcgcCACGATCAGGTGACCGGCTCCTCAGATACGAAACgcgccg-3`;
[0039] The sequence of JmZ is:
[0040] 5`-cggcgcTCGAAGAGATAATGAGTACTTCTACGTTGATGGAACTgcgccg-3`;
[0041] The sequence of HR1 is:
[0042] 5`-cggcgcGTAGAGCAAATGGGAGTTTCCAAGAGAAAATcttcgagcgccg-3`;
[0043] The sequence of B1-S is:
[0044] 5`-cggcgcGTTTCGGAAAATTTAGAGTTTGgtaagaatgATCGTGgcgccg-3`;
[0045] The sequence of NBL is:
[0046] 5`-cggcgcTGACACgtctttgcagGGAAGGTACTAGGATCCTCTACgcgccg-3`;
[0047] The sequence of B2-S is:
[0048] 5`-cggcgcTTGACTAGGATCAGGTGCTTTTGGAAAAGGTGTCAgcgccg-3`.
[0049] In one embodiment, the kit further includes controls, which include a positive control and a negative control, wherein the negative control is nuclease-free water, and the positive control is a fragmented plasmid standard, wherein the fragmented plasmid standard includes at least one of the following: 7-3 (JMB1) plasmid, B2S plasmid, 6b-1 (JMB2) plasmid, 586 (JMs) plasmid, 3b (JmZ) plasmid, 612 (HR) plasmid, B1S plasmid, NBL1 plasmid; preferably, the sample of the kit is selected from a plasma specimen or a paraffin specimen; preferably, the PCR is an asymmetric PCR method; preferably, the kit further includes PerfectaMultiplex ToughMix digital PCR premix and fluorescein sodium salt, and the premix includes dNTPs, Taq enzyme and PCR buffer.
[0050] In one embodiment, the PCR reaction system is 25 μL.
[0051] In one embodiment, the PCR reaction procedure corresponding to the PCR chip is as follows:
[0052] Droplet generation step: temperature 40°C;
[0053] Enzyme digestion step: temperature 37°C, time 5 minutes;
[0054] Pre-denaturation step: temperature 95°C, time 3 minutes;
[0055] PCR reaction steps: deformation temperature 95 ° C for 15 seconds, annealing temperature 60 ° C for 1 minute, wherein the PCR reaction steps are repeated multiple times;
[0056] Probe binding step: 5 minutes at 55°C, 10 minutes at 30°C;
[0057] Pressure release step: temperature 25°C.
[0058] In one embodiment, the PCR chip is a Sapphire chip.
[0059] In one embodiment, the fluorescent label of JMB-1 is FAM-BHQ1; the fluorescent label of JMB-2 is VIC-BHQ1; the fluorescent label of JMs is CY5-BHQ3; the fluorescent label of JmZ is FAM-BHQ1; the fluorescent label of HR1 is VIC-BHQ1; the fluorescent label of B1-S is CY5-BHQ3; the fluorescent label of NBL is FAM-BHQ1; and the fluorescent label of B2-S is VIC-BHQ1.
[0060] In the present application, the detection method is applied to the detection of FLT3-ITD gene mutations, which has the following advantages: First, the clinical sample detected by the present invention is DNA, which solves the problem of not being able to deliver samples in time when fresh samples are required in the flow cytometry detection method; Second, FLT3-ITD mainly occurs in exon 14. The present invention adopts a multi-probe tiling method to solve the disadvantage that traditional PCR detection can only detect FLT3-ITD site mutations, and can detect a variety of unknown indefinite mutations; Third, the present invention adopts digital PCR detection, which has stronger fluorescence signal anti-interference ability than fluorescent quantitative PCR when using multiple probes for detection. Since each probe uses a different fluorescent label and a stem-loop structure probe, the fluorescence interference between probes is relatively small and the sensitivity is relatively high. BRIEF DESCRIPTION OF THE DRAWINGS
[0061] Figure 1 This is a scanning diagram of the fluorescence signal of the Blue-Red channel when the Blue probe is not bound in one embodiment; Figure 2 This is a scanning diagram of the fluorescence signal of the Blue-Green channel when the green probe is not bound in one embodiment; Figure 3 This is a scanning diagram of the fluorescence signal of the Blue-Red channel when the red probe is not bound in one embodiment; Figure 4a This is a fluorescence detection result diagram of the B1S plasmid in Example 1; Figure 4b This is a graph showing the fluorescence detection results of the wild-type cell line genomic DNA in Example 1; Figure 5a This is a fluorescence detection result diagram of the B1S plasmid in Example 2;
[0062] Figure 5b This is the fluorescence detection result of genomic DNA of wild-type cell line; Figure 6a This is a fluorescence detection result diagram of the 3b(JmZ) plasmid of Example 3; Figure 6b This is a graph showing the fluorescence detection results of the wild-type cell line genomic DNA in Example 3; Figure 7a This is a fluorescence detection result diagram of the 3b(JmZ) plasmid of Example 4; Figure 7b This is a graph showing the fluorescence detection results of the wild-type cell line genomic DNA in Example 4; Figure 8a This is a fluorescence detection result diagram of the B1S plasmid in Example 5; Figure 8b This is a graph showing the fluorescence detection results of the wild-type cell line genomic DNA in Example 5; Figure 9a This is a graph showing the fluorescence detection results of the 3b(JmZ) plasmid in reaction procedure 1 of Example 6;
[0063] Figure 9b This is a graph showing the fluorescence detection results of the 3b(JmZ) plasmid in reaction procedure 2 of Example 6; Figure 10a This is a graph showing the fluorescence detection results of the wild-type cell line genomic DNA in reaction procedure 1 of Example 6; Figure 10b This is a graph showing the fluorescence detection results of the wild-type cell line genomic DNA in reaction procedure 2 of Example 6; Figure 11a This is the fluorescence detection result of 0.05% concentration in well A1 in Example 7; Figure 11b This is the fluorescence detection result of 0.05% concentration in well B1 in Example 7; Figure 12a This is the fluorescence detection result of 0.1% concentration in well C1 in Example 7; Figure 12b This is the fluorescence detection result of 0.1% concentration in well D1 in Example 7;
[0064] Figure 13a This is the fluorescence detection result of 0.2% concentration in well A2 in Example 7; Figure 13b This is the fluorescence detection result of 0.2% concentration in well B2 in Example 7; Figure 14a This is the fluorescence detection result of 0.3% concentration in well C2 in Example 7; Figure 14b This is the fluorescence detection result of 0.3% concentration in well D2 in Example 7; Figure 15a This is the fluorescence detection result of 0.5% concentration in well A3 in Example 7; Figure 15bThis is the fluorescence detection result of 0.5% concentration in well B3 in Example 7; Figure 16 This is a graph showing the fluorescence detection results of the wild-type cell line genomic DNA in well C3 in Example 7. DETAILED DESCRIPTION
[0065] In order to facilitate the understanding of the present application, in order to make the above-mentioned objects, features and advantages of the present application more obvious and easy to understand, the specific embodiments of the present application are described in detail below with reference to the accompanying drawings. In the following description, many specific details are set forth to facilitate a full understanding of the present application, and the accompanying drawings provide preferred embodiments of the present application. However, the present application can be implemented in many different forms and is not limited to the embodiments described herein. On the contrary, the purpose of providing these embodiments is to make the disclosure of the present application more thoroughly and comprehensively understood. The present application can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without violating the connotation of the present application, so the present application is not limited to the specific embodiments disclosed below. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which the present application belongs. The terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the present application.
[0066] This application uses the detection of FLT3-ITD gene mutations as an example to illustrate this application. Of course, it should be understood that the beacon probe design concept of this application is not limited to the detection of FLT3-ITD gene mutations, but can also be used to detect other gene variations or gene expression, or is suitable for gene detection using traditional beacon probes.
[0067] Specifically, a variety of tiling probe sequences were designed for FLT3-ITD gene mutations, including JMB-1, JMB-2, JMs, JmZ, HR1, B1-S, NBL and B2-S.
[0068] The sequence of JMB-1 is:
[0069] 5`-cggcgcCTAGCTtctgaagcaatttaggtatgaaagccaAGTCAAgcgccg-3`;
[0070] The sequence of JMB-2 is:
[0071] 5`-cggcgcAGTTCCagccagctacagatggtacaggtAGCTAGgcgccg-3`;
[0072] The sequence of JMs is:
[0073] 5`-cggcgcCACGATcaggtgaccggctcctcagataCGAAACgcgccg-3`;
[0074] The sequence of JmZ is:
[0075] 5`-cggcgcTCGAAGagataatgagtacttctacgttgatGGAACTgcgccg-3`;
[0076] The sequence of HR1 is:
[0077] 5`-cggcgcGTAGAGcaaatgggagtttccaagagaaaatCTTCGAgcgccg-3`;
[0078] The sequence of B1-S is:
[0079] 5`-cggcgcGTTTCGgaaaatttagagtttggtaagaatgATCGTGgcgccg-3`;
[0080] The sequence of NBL is:
[0081] 5`-cggcgcTGACACgtctttgcagggaaggtactaggatcCTCTACgcgccg-3`;
[0082] The sequence of B2-S is:
[0083] 5`-cggcgcTTGACTaggatcaggtgcttttggaaaagGTGTCAgcgccg-3`.
[0084] It should be noted that the above-mentioned sequence capitalization is for the purpose of better illustrating the example of the first stem paired sequence-the first anti-interference sequence-target paired sequence-the second anti-interference sequence-the second stem paired sequence of the present embodiment, taking the JMB-1 sequence as an example, the first stem paired sequence is cggcgc, the first anti-interference sequence is CTAGCT, and the target paired sequence is tctgaagcaatttaggtatgaaagcca, and the second anti-interference sequence is AGTCAA, the second stem paired sequence gcgccg. Subsequent other sequences are by that analogy.
[0085] Furthermore, the fluorescent label of JMB-1 is FAM-BHQ1; the fluorescent label of JMB-2 is VIC-BHQ1; the fluorescent label of JMs is CY5-BHQ3; the fluorescent label of JmZ is FAM-BHQ1; the fluorescent label of HR1 is VIC-BHQ1; the fluorescent label of B1-S is CY5-BHQ3; the fluorescent label of NBL is FAM-BHQ1; and the fluorescent label of B2-S is VIC-BHQ1.
[0086] Specifically, the sequence of the forward primer is: 5`-tgcagaactgcctattccta-3`; the sequence of the reverse primer is: 5`-ctggattgagactcctgtt-3`.
[0087] In this example, fluorescent markers with different reporter intensities are used. Different probes produce different fluorescence signal intensities when excited within the droplet, resulting in distinct fluorescent signal clusters on the 2D result graph. During analysis, insertion variants can be identified based on these distinct signal clusters, further reducing the likelihood of missed detections.
[0088] The negative control in this example is nuclease-free water, and the positive control is a fragmented plasmid standard, which includes at least one of the following: 7-3 (JMB1) plasmid, B2S plasmid, 6b-1 (JMB2) plasmid, 586 (JMs) plasmid, 3b (JmZ) plasmid, 612 (HR) plasmid, B1S plasmid, and NBL1 plasmid.
[0089] To further illustrate the above plasmid:
[0090] Among them, the 7-3 (JMB1) plasmid sequence is:
[0091] TGAGAGATTATAATGAGTTGTCCACTATTTATAATGTCACACAGGAATTCTGTTTCATCGCTGAGTGACACTCTTTTGTTGCAGGCCCCTTCCCTTTCATCCAAGACAACATCTCATTCTATGCAACAATTGGTGTTTGTCTCCTCTTCATTGTCGTTTTAACCCTGCTAATTTGTCACAAGTACAAAAAGGTAAAAGCAAAGGTAAAAATTCATTATTCTTTCCTCTATCTGCAGAACTGCCTATTCCTAACTGACTCATCATTTCATCTCTGAAGCAGGGTGGGGAGAAAACGTATTTAGGTATGAAAGCCAGCTACAGATGGTACAGGTGACCGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGAATATGATCTCAAATGGGAGTTTCCAAGAGAAAATTTAGAGTTTGGTAAGAATGGAATGTGCCAAATGTTTCTGCAGCATTTCTTTTCCATTGGAAAATCTTTAAAATGCACGTACTCACCATTTGTCTTTGCAGGGAAGGTACTAGGATCAGGTGCTTTTGGAAAAGTGATGAACGCAACAGCTTATGGAATTAGCAAAACAGGAGTCTCAATCCAGGTTGCCGTCAAAATGCTGAAAG。
[0092] Among them, the plasmid sequence of 6b-1 (JMB2) is as follows:
[0093] GGGGAGTAGAGTATATGTAGAGTGGTTGTTAGGACTGAAAATGATTATTACTGAAACAGGATGTGAGAGATTATAATGAGTTGTCCACTATTTATAATGTCACACAGGAATTCTGTTTCATCGCTGAGTGACACTCTTTTGTTGCAGGCCCCTTCCCTTTCATCCAAGACAACATCTCATTCTATGCAACAATTGGTGTTTGTCTCCTCTTCATTGTCGTTTTAACCCTGCTAATTTGTCACAAGTACAAAAAGGTAAAAGCAAAGGTAAAAATTCATTATTCTTTCCTCTATCTGCAGAACTGCCTATTCCTAACTGACTCATCATTTCATCTCTGAAGCAATTTAGGTATGAAAGCCAGGGAGAGAGAGAGATAATGATAATGAGTACTTCTACGTTGATATGCTACAGATGGTACAGGTGACCGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGAATATGATCTCAAATGGGAGTTTCCAAGAGAAAATTTAGAGTTTGGTAAGAATGGAATGTGCCAAATGTTTCTGCAGCATTTCTTTTCCATTGGAAAATCTTTAAAATGCACGTACTCACCATTTGTCTTTGCAGGGAAGGTACTAGGATCAGGTGCTTTTGGAAAAGTGATGAACGCAACAGCTTATGGAATTAGCAAAACAGGAGTCTCAATCCAGGTTGCCGTCAAAATGCTGAAAG。
[0094] Among them, the plasmid sequence of 586 (JMs) is as follows: <0000TAATGTCACACAGGAATTCTGTTTCATCGCTGAGTGACACTCTTTTGTTGCAGGCCCCTTCCCTTTCATCCAAGACAACATCTCATTCTATGCAACAATTGGTGTTTGTCTCCTCTTCATTGTCGTTTTAACCCTGCTAATTTGTCACAAGTACAAAAAGGTAAAAGCAAAGGTAAAAATTCATTATTCTTTCCTCTATCTGCAGAACTGCCTATTCCTAACTGACTCATCATTTCATCTCTGAAGCAATTTAGGTATGAAAGCCAGCTACAGATGGTACAGGTGACCTGCCATGTCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGAATATGATCTCAAATGGGAGTTTCCAAGAGAAAATTTAGAGTTTGGTAAGAATGGAATGTGCCAAATGTTTCTGCAGCATTTCTTTTCCATTGGAAAATCTTTAAAATGCACGTACTCACCATTTGTCTTTGCAGGGAAGGTACTAGGATCAGGTGCTTTTGGAAAAGTGATGAACGCAACAGCTTATGGAATTAGCAAAACAGGAGTCTCAATCCAGGTTGCCGTCAAAATGCTGAAAGGTACAGTATAGTGGAAGGACAGCAACAAAGATGCACAAAAATGGGAGGCACAGTTTCCCACCCATGCCTTCTTCTCTTTTCCATCCTTTTAATGGTTAC。
[0096] Among them, the plasmid sequence of 3b(JmZ) is as follows:
[0097] GTAAAAGCAAAGGTAAAAATTCATTATTCTTTCCTCTATCTGCAGAACTGCCTATTCCTAACTGACTCATCATTTCATCTCTGAAGCAATTTAGGTATGAAAGCCAGCTACAGATGGTACAGGTGACCGGCTCCTCAGATAATGAGTACTCTCAAATGGGAGTCTACGTTGATTTCAGAGAATATGAATATGATCTCAAATGGGAGTTTCCAAGAGAAAATTTAGAGTTTGGTAAGAATGGAATGTGCCAAATGTTTCTGCAGCATTTCTTTTCCATTGGAAAATCTTTAAAATGCACGTACTCACCATTTGTCTTTGCAGGGAAGGTACTAGGATCAGGTGCTTTTGGAAAAGTGATGAACGCAACAGCTTATGGAATTAGCAAAACAGGAGTCTCAATCCAGGTTGCCGTCAAAATGCTGAAAG。
[0098] Among them, the 612 (HR) plasmid sequence is:
[0099] CACAAGTACAAAAAGGTAAAAGCAAAGGTAAAAATTCATTATTCTTTCCTCTATCTGCAGAACTGCCTATTCCTAACTGACTCATCATTTCATCTCTGAAGCAATTTAGGTATGAAAGCCAGCTACAGATGGTACAGGTGACCGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGAATATGATCTCAAATGGGAGAGCCTCTTTCCAAGAGAAAATTTAGAGTTTGGTAAGAATGGAATGTGCCAAATGTTTCTGCAGCATTTCTTTTCCATTGGAAAATCTTTAAAATGCACGTACTCACCATTTGTCTTTGCAGGGAAGGTACTAGGATCAGGTGCTTTTGGAAAAGTGATGAACGCAACAGCTTATGGAATTAGCAAAACAGGAGTCTCAATCCAGGTTGCCGTCAAAATGCTGAAAGGTA。
[0100] Among them, the B1S plasmid sequence is:
[0101] GTAAAAGCAAAGGTAAAAATTCATTATTCTTTCCTCTATCTGCAGAACTGCCTATTCCTAACTGACTCATCATTTCATCTCTGAAGCAATTTAGGTATGAAAGCCAGCTACAGATGGTACAGGTGACCGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGAATATGATCTCAAATGGGAGTTTCCAAGAGAAAATGTACAGCATGTTTTAGAGTTTGGTAAGAATGGAATGTGCCAAATGTTTCTGCAGCATTTCTTTTCCATTGGAAAATCTTTAAAATGCACGTACTCACCATTTGTCTTTGCAGGGAAGGTACTAGGATCAGGTGCTTTTGGAAAAGTGATGAACGCAACAGCTTATGGAATTAGCAAAACAGGAGTCTCAATCCAGGTTGCCGTCAAAATGCTGAAAG。
[0102] Among them, the NBL1 plasmid sequence is:
[0103] GTAAAAGCAAAGGTAAAAATTCATTATTCTTTCCTCTATCTGCAGAACTGCCTATTCCTAACTGACTCATCATTTCATCTCTGAAGCAATTTAGGTATGAAAGCCAGCTACAGATGGTACAGGTGACCGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGAATATGATCTCAAATGGGAGTTTCCAAGAGAAAATTTAGAGTTTGGTAAGAATGGAATGTGCCAAATGTTTCTGCAGCATTTCTTTTCCATTGGAAAATCTTTAAAATGCACGTACTCACCATTTGTCTTTGTTCTAATGGACAATCCAGGGAAGGTACTAGGATCAGGTGCTTTTGGAAAAGTGATGAACGCAACAGCTTATGGAATTAGCAAAACAGGAGTCTCAATCCAGGTTGCCGTCAAAATGCTGAAAG。
[0104] Among them, the B2S plasmid sequence is:
[0105] GTAAAAGCAAAGGTAAAAATTCATTATTCTTTCCTCTATCTGCAGAACTGCCTATTCCTAACTGACTCATCATTTCATCTCTGAAGCAATTTAGGTATGAAAGCCAGCTACAGATGGTACAGGTGACCGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGAATATGATCTCAAATGGGAGTTTCCAAGAGAAAATTTAGAG TTTGGTAAGAATGGAATGTGCCAAATGTTTCTGCAGCATTTCTTTTCCATTGGAAAATCTTTAAAATGCACGTACTCACCATTTGTCTTTGCAGGGAAGGTACTAGGATCAGGTGCTTTTGGAAAATTCTCGATACTAGACGTGATGAACGCAACAGCTTATGGAATTAGCAAAACAGGAGTCTCAATCCAGGTTGCCGTCAAAATGCTGAAAG.
[0106] Specifically, the sample of the kit is selected from plasma specimens or paraffin specimens. Preferably, it can only target DNA sequences. Specifically, the PCR method is asymmetric PCR.
[0107] Specifically, the kit further includes Perfecta Multiplex ToughMix digital PCR premix and fluorescein sodium salt, and the premix includes dNTPs, Taq enzyme and PCR buffer.
[0108] In specific applications, the forward primer, reverse primer, and probe are first diluted to 100 μM. The forward primer, reverse primer, and probe are then mixed and diluted to final concentrations of 5 μM, 10 μM, and 5 μM, respectively. The PCR reaction system is as follows:
[0109] Table 1 PCR reaction system
[0110] Reagent name Single reaction volume (μL) Perfecta Multiplex ToughMix_5X 5 Fluorescein sodium salt 2.5 Forward primer mix (5 μM each) 1 Reverse primer mix (10 μM each) 1 Probe mixture (5 μM each) 1 Sample 1 Total volume 25
[0111] The balance of the system is nuclease-free water.
[0112] Specifically, PCR adopts asymmetric PCR method, and the reaction procedure is as follows:
[0113] Table 2 PCR reaction procedure
[0114]
[0115]
[0116] Specifically:
[0117] Loading the PCR reaction system into the digital PCR chip;
[0118] placing the digital PCR chip into a digital PCR instrument for PCR amplification to obtain an amplification result;
[0119] The digital PCR chip having obtained the amplification result is placed in a chip scanner for fluorescence signal scanning, and the mutation result is interpreted according to the fluorescence signal.
[0120] Specific experimental process:
[0121] Primer and probe dilution: Forward primer, reverse primer, and probe are first diluted to 100 μM. The forward primer, reverse primer, and probe are mixed and diluted to final concentrations of 5 μM, 10 μM, and 5 μM, respectively. According to Table 3:
[0122] Table 3 PCR reaction system
[0123] Reagent name Single reaction volume (μL) Perfecta Multiplex ToughMix_5X 5 Fluorescein sodium salt 2.5 Forward primer mix (5 μM each) 1 Reverse primer mix (10 μM each) 1 Probe mixture (5 μM each) 1 Sample 1 Total volume 25
[0124] The balance of the system is nuclease-free water.
[0125] Plasmid dilution: Plasmid powder was first diluted to 40 ng / μL, and then graded diluted to 10-6 using ddH2O.
[0126] Digital PCR was performed using the Naica Crystal Digital PCR System (Stilla).
[0127] PCR used asymmetric PCR method, and the reaction procedure was as follows:
[0128] Table 4 PCR reaction program
[0129]
[0130]
[0131] The yin and yang quality control material is genomic DNA from a wild-type cell line, cultured and extracted by our company. Of course, commercially available products can also be used or purchased from a genetics company based on the sequence provided in this application.
[0132] In a specific experimental example, when the Blue probe does not bind, the result is as follows Figure 1 When the green probe does not bind, the result is as follows. Figure 2 When the red probe does not bind, the result is as follows. Figure 3 As shown. Figures 1 to 3 It can be seen that the PCR amplification reagent, kit and method for detecting FLT3-ITD gene mutations of the present application can better distinguish FLT3-ITD gene mutations.
[0133] The present application has at least the following advantages: First, the clinical sample detected by the present invention is DNA, which solves the problem of not being able to deliver fresh samples in time when the flow cytometry detection method requires fresh samples; Second, FLT3-ITD mainly occurs in exon 14. The present invention adopts a multi-probe tiling method to solve the disadvantage that traditional PCR detection can only detect FLT3-ITD site mutations, and can detect a variety of unknown non-site insertion mutations; Third, the present invention adopts digital PCR detection, which has stronger fluorescence signal anti-interference ability than fluorescent quantitative PCR when using multiple probes for detection. Since each probe uses a different fluorescent label and a stem-loop structure probe, the fluorescence interference between probes is relatively small and the sensitivity is relatively high.
[0134] The present application is described below with reference to specific embodiments.
[0135] Example 1
[0136] The B1S plasmid was detected using the B1-S probe (red) in singleplex, while the wild-type cell line genomic DNA was detected as a control.
[0137] Sample information: 1 μL of 10-6 dilution of B1S plasmid and 1 μL of wild-type cell line genomic DNA were loaded.
[0138] The system settings are as follows:
[0139]
[0140]
[0141] The sample layout is as follows:
[0142] chip sample A hole B1S plasmid Hole B Wild-type cell line genomic DNA
[0143] Reaction program: Set the digital PCR reaction program corresponding to the Sapphire chip and perform PCR amplification. Set it as shown in the table below:
[0144]
[0145] Test results: The B1-S probe is a wild-type sequence designed for the B1S locus of the FLT3 gene. The expected result is that the B1S plasmid is undetectable. However, in the PCR reaction, the beacon probe can bind to the template, causing the probe to hydrolyze and emit fluorescence. However, during the pressure release process, the previously hydrolyzed probe reattaches, resulting in fluorescence quenching. Therefore, the results show no signal in the CY5 channel for the B1S plasmid and the wild-type cell line genomic DNA, which is consistent with expectations. The test results are as follows:
[0146] Copy number concentration test results
[0147]
[0148]
[0149] Attachment Figure 4a The fluorescence detection results of B1S plasmid are shown in Figure 1. Figure 4b This is the fluorescence detection result of genomic DNA of wild-type cell line.
[0150] Example 2
[0151] The HR1 probe (green) and the B1-S probe (red) were used to detect the B1S plasmid and genomic DNA of the wild-type cell line. The anti-interference sequences and stem sequences of the HR1 and B1-S probes are mismatched.
[0152] Sample information: 1 μL of 10-6 dilution of B1S plasmid and 1 μL of wild-type cell line genomic DNA were loaded.
[0153] The system settings are as follows:
[0154] Reagent name Single reaction volume (μL) Perfecta Multiplex ToughMix_5X 5 Fluorescein sodium salt 2.5 Forward primer mix (5 μM each) 1 Reverse primer mix (10 μM each) 1 Probe mixture (5 μM each) 1 Sample 1 BsrB I restriction endonuclease 0.5 Total volume Total added to 25
[0155] The sample layout is as follows:
[0156] chip sample A hole B1S plasmid Hole B Wild-type cell line genomic DNA
[0157] Reaction program: Set up the digital PCR reaction program corresponding to the Sapphire chip and perform PCR amplification. The settings are as follows:
[0158]
[0159] Test results: The HR1 and B1-S probes are wild-type sequences designed for the 612 (HR) and B1S sites of the FLT3 gene, and the anti-interference sequences and stem sequences of the HR1 and B1-S probes are not paired. The result should be that the HR1 probe binds to the B1S plasmid in the early stage and hydrolyzes to emit light, but the hydrolyzed head and tail re-bind when the pressure is released and the fluorescence is quenched. For the wild-type cell line genomic DNA, both the HR1 and B1-S probes can bind to it and hydrolyze to emit light, and re-bind when the pressure is released and the fluorescence is quenched. Therefore, the result is that there is no signal for both the B1S plasmid and the wild-type cell line genomic DNA, which is in line with expectations. The test results are as follows:
[0160] Copy number concentration test results
[0161]
[0162] Attachment Figure 5a The fluorescence detection results of B1S plasmid are shown in Figure 1. Figure 5b This is the fluorescence detection result of genomic DNA of wild-type cell line.
[0163] Example 3
[0164] The JmZ probe (blue) pairs its first stem-pairing sequence, the first anti-interference sequence, with the HR1 probe (green) pairs its second anti-interference sequence, the second stem-pairing sequence. Equal molar concentrations of the JmZ and HR1 probes were used to simultaneously detect the 3b(JmZ) plasmid and genomic DNA from a wild-type cell line.
[0165] Sample information: 1 μL of 10-6 dilution of 3b(JmZ) plasmid and 1 μL of wild-type cell line genomic DNA were loaded.
[0166] The system settings are as follows:
[0167]
[0168]
[0169] The sample layout is as follows:
[0170] chip sample A hole 3b(JmZ) plasmid Hole B Wild-type cell line genomic DNA
[0171] Reaction program: Set the digital PCR reaction program corresponding to the Sapphire chip and perform PCR amplification. Set it as shown in the table below:
[0172]
[0173] Test results: The JmZ and HR1 probes are wild-type sequences designed for the 3b (JmZ) and 612 (HR) sites of the FLT3 gene, and the first stem pairing sequence of JmZ - the first anti-interference sequence is paired with the second anti-interference sequence of the HR1 probe - the second stem pairing sequence. The result should be that for the 3b (JmZ) plasmid, the HR1 probe can bind to it and hydrolyze to emit light, and the second anti-interference sequence of the HR1 probe binds to the first anti-interference sequence of JmZ. When the pressure is released, the first stem pairing sequence of HR1 binds to the second stem pairing sequence of JmZ, quenching the hydrolyzed HR1 probe. The genomic DNA of the wild-type cell line hydrolyzes and emits light because both the JmZ and HR1 probes can bind to it, and then rebind when the pressure is released and the fluorescence is quenched. Therefore, the result is that there is no signal in the JmZ and HR1 channels for the 3b (JmZ) plasmid and the genomic DNA of the wild-type cell line, which is in line with expectations. The test results are as follows:
[0174] Copy number concentration test results
[0175]
[0176]
[0177] Attachment Figure 6a The fluorescence detection results of 3b(JmZ) plasmid are shown in Figure 1. Figure 6b This is the fluorescence detection result of genomic DNA of wild-type cell line.
[0178] Example 4
[0179] The JMB-2 probe (green) pairs the first anti-interference sequence (first stem pair) with the JmZ probe (blue) pairing the second anti-interference sequence (second stem pair). Equal molar concentrations of JmZ and JMB-2 probes were used to simultaneously detect 3b (JmZ) plasmid and wild-type cell line genomic DNA samples.
[0180] Sample information: 1 μL of 10-6 dilution of 3b(JmZ) plasmid and 1 μL of wild-type cell line genomic DNA were loaded.
[0181] The system settings are as follows:
[0182]
[0183] The sample layout is as follows:
[0184] chip sample A hole 3b(JmZ) plasmid Hole B Wild-type cell line genomic DNA
[0185] Reaction program: Set the digital PCR reaction program corresponding to the Sapphire chip and perform PCR amplification. The settings are as follows:
[0186]
[0187]
[0188] Detection results: JmZ and JMB-2 probes are wild-type sequences designed for the 3b (JmZ) and 6b-1 (JMB2) sites of the FLT3 gene, and the first stem pairing sequence of JMB-2 - the first anti-interference sequence is paired with the second anti-interference sequence of the JmZ probe - the second stem pairing sequence. The result should be that for the 3b (JmZ) plasmid, JMB-2 can bind to it and hydrolyze and emit light. When the temperature is lowered, the stem-loop structure of the JmZ probe opens, and the hydrolyzed head of the JMB-2 probe can bind to and extend with the second anti-interference sequence of the JmZ probe, making it impossible for the second stem pairing sequence of JMB-2 to bind to the second stem pairing sequence of the JmZ probe and emit light in the FAM channel. The genomic DNA of the wild-type cell line can be hydrolyzed and emit light because both JmZ and JMB-2 probes can bind to it, and then rebind when the pressure is released and the fluorescence is quenched. Therefore, the result is that the 3b (JmZ) plasmid has a signal in the JmZ channel but no signal in the JMB-2 channel, while the wild-type cell line genomic DNA has no signal in both the JmZ channel and the JMB-2 channel, which is in line with expectations. The test results are as follows:
[0189] Copy number concentration test results
[0190]
[0191] Attachment Figure 7a The fluorescence detection results of 3b(JmZ) plasmid are shown in Figure 1. Figure 7b This is the fluorescence detection result of genomic DNA of wild-type cell line.
[0192] Example 5
[0193] The first stem-pairing sequence (first anti-interference sequence) of the B1-S probe (red) and the second anti-interference sequence (second stem-pairing sequence) of the JMs probe (red) are paired with each other. Equal molar concentrations of the B1-S and JMs probes were used to simultaneously detect the B1S plasmid and genomic DNA of the wild-type cell line.
[0194] Sample information: 1 μL of 10-6 dilution of B1S plasmid and 1 μL of wild-type cell line genomic DNA were loaded.
[0195] The system settings are as follows:
[0196] Reagent name Single reaction volume (μL) Perfecta Multiplex ToughMix_5X 5 Fluorescein sodium salt 2.5 Forward primer mix (5 μM each) 1 Reverse primer mix (10 μM each) 1 Probe mixture (5 μM each) 1 Sample 1 BsrB I restriction endonuclease 0.5 Total volume Total added to 25
[0197] The sample layout is as follows:
[0198] chip sample A hole B1S plasmid Hole B Wild-type cell line genomic DNA
[0199] Reaction program: Set the digital PCR reaction program corresponding to the Sapphire chip and perform PCR amplification. Set it according to the following table:
[0200]
[0201] Test results: The B1-S and JMs beacon probes are wild-type sequences designed for the B1S and 586 (JMs) sites of the FLT3 gene, and the first stem pairing sequence - the first anti-interference sequence and the second anti-interference sequence - the second stem pairing sequence of the two beacon probes are paired with each other. The result should be that the B1S plasmid is detected in the B1-S channel but not in the wild-type cell line genomic DNA. Therefore, the result is that the B1S plasmid has a signal only in the CY5 channel, while the wild-type cell line genomic DNA has no signal in all channels, which is in line with expectations. The test results are as follows:
[0202] Copy number concentration test results
[0203]
[0204] Attachment Figure 8a The fluorescence detection results of B1S plasmid are shown in Figure 1. Figure 8b This is the fluorescence detection result of genomic DNA of wild-type cell line.
[0205] Example 6
[0206] Different reaction protocols were used to detect the first anti-interference sequence (first stem pair) of the JMB-2 probe (green) and the second anti-interference sequence (second stem pair) of the JmZ probe (blue). Equal molar concentrations of JmZ and JMB-2 probes were used to simultaneously detect 3b (JmZ) plasmid and wild-type cell line genomic DNA samples.
[0207] Sample information: 1 μL of 10-6 dilution of 3b(JmZ) plasmid and 1 μL of wild-type cell line genomic DNA were loaded.
[0208] The system settings are as follows:
[0209] Reagent name Single reaction volume (μL) Perfecta Multiplex ToughMix_5X 5 Fluorescein sodium salt 2.5 Forward primer mix (5 μM each) 1 Reverse primer mix (10 μM each) 1 Probe mixture (5 μM each) 1 Sample 1 BsrB I restriction endonuclease 0.5 Total volume Total added to 25
[0210] The sample layout is set up according to the following table:
[0211] chip sample A1 hole 3b(JmZ) plasmid B1 hole Wild-type cell line genomic DNA A2 hole 3b(JmZ) plasmid B2 hole Wild-type cell line genomic DNA
[0212] Reaction program: Set the digital PCR reaction program corresponding to different Sapphire chips and perform PCR amplification.
[0213] PCR reaction program 1 is set as follows:
[0214]
[0215] PCR reaction program 2 is set as follows:
[0216]
[0217] Test results: The JmZ and JMB-2 probes are wild-type sequences designed for the 3b (JmZ) and 6b-1 (JMB2) loci of the FLT3 gene, and the first stem-pairing sequence of the JMB-2 probe, the first anti-interference sequence, is paired with the second anti-interference sequence of the JmZ probe, the second stem-pairing sequence. The results show that when using reaction procedure 1, the JMB-2 probe can bind to the 3b (JmZ) plasmid during amplification and hydrolyze to emit light. When the temperature is lowered, the stem-loop structure of the JmZ probe opens, and the hydrolyzed head of the JMB-2 probe can bind and extend with the second anti-interference sequence of the JmZ probe, preventing the second stem-pairing sequence of JMB-2 from binding to the second stem-pairing sequence of the JmZ probe, resulting in fluorescence in the FAM channel. The genomic DNA of the wild-type cell line can be hydrolyzed to emit light because both the JmZ and JMB-2 probes can bind to it. When the pressure is released, the DNA rebinds and the fluorescence is quenched. When using reaction procedure 2, the lack of a binding procedure results in insufficient binding between the hydrolyzed head of the JMB-2 probe and the second anti-interference sequence of the JmZ probe, resulting in a decrease in positive droplets in the FAM channel. Therefore, the result shows that the 3b(JmZ) plasmid only has a signal in the JmZ channel, and the number of positive droplets in the FAM channel is reduced when using reaction procedure 2 compared to reaction procedure 1, while the wild-type cell line genomic DNA has no signal in both the JmZ channel and the JMB-2 channel, which is in line with expectations. The test results are as follows:
[0218] Copy number concentration test results
[0219]
[0220] Attachment Figure 9a The fluorescence detection results of 3b(JmZ) plasmid in reaction procedure 1 are shown in Figure 1. Figure 9b This is the fluorescence detection result of 3b(JmZ) plasmid in reaction procedure 2.
[0221] Attachment Figure 10a The fluorescence detection results of wild-type cell line genomic DNA in reaction procedure 1 are shown in Figure 1. Figure 10b This is the fluorescence detection result of wild-type cell line genomic DNA in reaction procedure 2.
[0222] Example 7
[0223] Sensitivity testing was performed using wild-type cell line genomic DNA to prepare B1S plasmid samples with varying mutation concentrations (0.05%, 0.1%, 0.2%, 0.3%, and 0.5%). The first stem-pairing sequence (first anti-interference sequence) of the B1-S probe (red) and the second anti-interference sequence (second stem-pairing sequence) of the JMs probe (red) were paired with each other. Equal molar concentrations of the B1-S and JMs probes were used to test the different concentrations of B1S plasmid in two replicates. Wild-type cell line genomic DNA was also tested as a control.
[0224] Sample information: 1 μL of B1S plasmid samples with different mutation concentrations (0.05%, 0.1%, 0.2%, 0.3%, 0.5%) was loaded, and 1 μL of wild-type cell line genomic DNA was loaded.
[0225] The system settings are as follows:
[0226]
[0227]
[0228] The sample layout is as follows:
[0229]
[0230] Reaction program: Set up the digital PCR reaction program corresponding to different Sapphire chips and perform PCR amplification. The specific settings are as follows:
[0231]
[0232] Test results: B1-S was tested using different concentration gradients. The results showed that the B1S plasmid only had a signal in the B1-S channel, while the wild-type cell line genomic DNA had no signal in all channels, which was in line with expectations. It was also detected under 0.05% B1S conditions. The test results are as follows:
[0233] Copy number concentration test results
[0234]
[0235]
[0236] Attachment Figure 11a The fluorescence detection results of the A1 well are shown in the figure with a concentration of 0.05%. Figure 11b The fluorescence detection result diagram of the concentration of 0.05% in well B1;
[0237] Attachment Figure 12a The fluorescence detection results of the 0.1% concentration in C1 well are shown in the figure. Figure 12bThe fluorescence detection result diagram of the D1 well is 0.1% concentration;
[0238] Attachment Figure 13a The fluorescence detection results of the A2 well are shown in the figure with a concentration of 0.2%. Figure 13b The fluorescence detection result diagram of the concentration of 0.2% in well B2;
[0239] Attachment Figure 14a The fluorescence detection results of the C2 well are shown in the figure with a concentration of 0.3%. Figure 14b The fluorescence detection result diagram of the D2 well is 0.3% concentration;
[0240] Attachment Figure 15a The fluorescence detection results of the A3 well are shown in the figure with a concentration of 0.5%. Figure 15b The fluorescence detection result diagram of the concentration of 0.5% in well B3;
[0241] Attachment Figure 16 This is the fluorescence detection result of wild-type cell line genomic DNA in C3 well.
[0242] The present application has at least the following advantages: First, the clinical sample detected by the present invention is DNA, which solves the problem of not being able to deliver fresh samples in time when the flow cytometry detection method requires fresh samples; Second, FLT3-ITD mainly occurs in exon 14. The present invention adopts a multi-probe tiling method to solve the disadvantage that traditional PCR detection can only detect FLT3-ITD site mutations, and can detect diverse tandem mutations; Third, the present invention adopts digital PCR detection, which has stronger fluorescence signal anti-interference ability than fluorescent quantitative PCR when using multiple probes for detection. Since each probe uses a different fluorescent label and a stem-loop structure probe is used, the fluorescence interference between probes is relatively small and the sensitivity is relatively high.
[0243] It should be understood that although the present application specifically designs a beacon probe for FLT3-ITD, those skilled in the art will know that, based on the beacon probe for FLT3-ITD of the present application, the target pairing sequence can be adjusted accordingly. At the same time, the design concept based on the beacon probe of the present application is not limited to the corresponding
[0244] The various technical features of the above-mentioned embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the various technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification. It should be noted that "in one embodiment", "for example", "for example", etc. in this application are intended to illustrate this application, rather than to limit this application. The above-mentioned embodiments only express several implementation methods of this application, and their descriptions are relatively specific and detailed, but they cannot be understood as limiting the scope of the patent application. It should be pointed out that for ordinary technicians in this field, without departing from the concept of this application, several variations and improvements can be made, which all fall within the scope of protection of this application. Therefore, the scope of protection of the patent application of this application shall be based on the attached claims.
Claims
1. A method for detecting FLT3-ITD gene mutation based on digital PCR for non-diagnostic purposes, characterized in that: The steps include: A PCR reaction system for detecting a sample is prepared using a kit and the sample is added; wherein the kit includes a forward primer, a reverse primer, and a plurality of beacon probes, the sequence of the forward primer is: 5'-tgcagaactgcctattccta-3'; the sequence of the reverse primer is: 5`-ctggattgagactcctgtt-3`; multiple beacon probes including JMB-1, JMB-2, JMs, JmZ, HR1, B1-S, NBL and B2-S, among which: The sequence of JMB-1 is: 5`-cggcgcCTAGCTtctgaagCAATTTAGGTATGAAAGCCAAGTCAAgcgccg-3`; The sequence of JMB-2 is: 5`-cggcgcAGTTCCAGCCAGCTACAGATGGTACAGGTAGCTAGgcgccg-3`; The sequence of JMs is: 5`-cggcgcCACGATCAGGTGACCGGCTCCTCAGATACGAAACgcgccg-3`; The sequence of JmZ is: 5`-cggcgcTCGAAGAGATAATGAGTACTTCTACGTTGATGGAACTgcgccg-3`; The sequence of HR1 is: 5`-cggcgcGTAGAGCAAATGGGAGTTTCCAAGAGAAAATcttcgagcgccg-3`; The sequence of B1-S is: 5`-cggcgcGTTTCGGAAAATTTAGAGTTTGgtaagaatgATCGTGgcgccg-3`; The sequence of NBL is: 5`-cggcgcTGACACgtctttgcagGGAAGGTACTAGGATCCTCTACgcgccg-3`; The sequence of B2-S is: 5`-cggcgcTTGACTAGGATCAGGTGCTTTTGGAAAAGGTGTCAgcgccg-3`; Loading the PCR reaction system into the digital PCR chip; placing the digital PCR chip into a digital PCR instrument for PCR amplification to obtain an amplification result; The digital PCR chip having obtained the amplification result is placed in a chip scanner for fluorescence signal scanning, and the mutation result is interpreted according to the fluorescence signal.
2. The method according to claim 1, characterized in that The digital PCR is Naica digital PCR.
3. The method according to claim 1, characterized in that The kit also includes controls, including a positive control and a negative control, wherein the negative control is nuclease-free water, and the positive control is a fragmented plasmid standard, wherein the fragmented plasmid standard includes: 7-3 (JMB1) plasmid, B2S plasmid, 6b-1 (JMB2) plasmid, 586 (JMs) plasmid, 3b (JmZ) plasmid, 612 (HR) plasmid, B1 S plasmid, and NBL1 plasmid; Among them, the 7-3 (JMB1) plasmid sequence is: TGAGAGATTATAATGAGTTGTCCACTATTTATAATGTCACACAGGAATTCTGTTTCATCGCTGAGTGACACTCTTTTGTTGCAGGCCCCTTCCCTTTCATCCAAGACAACATCTCATTCTATGCAACAATTGGTGTTTGTCTCCTCTTCATTGTCGTTTTAACCCTGCTAATTTGTCACAAGTACAAAAAGGTAAAAGCAAAGGTAAAAATTCATTATTCTTTCCTCTATCTGCAGAACTGCCTATTCCTAACTGACTCATCATTTCATCTCTGAAGCAGGGTGGGGAGAAAACGTATTTAGGTATGAAAGCCAGCTACAGATGGTACAGGTGACCGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGAATATGATCTCAAATGGGAGTTTCCAAGAGAAAATTTAGAGTTTGGTAAGAATGGAATGTGCCAAATGTTTCTGCAGCATTTCTTTTCCATTGGAAAATCTTTAAAATGCACGTACTCACCATTTGTCTTTGCAGGGAAGGTACTAGGATCAGGTGCTTTTGGAAAAGTGATGAACGCAACAGCTTATGGAATTAGCAAAACAGGAGTCTCAATCCAGGTTGCCGTCAAAATGCTGAAAG; Among them, the plasmid sequence of 6b-1 (JMB2) is: GGGGAGTAGAGTATATGTAGAGTGGTTGTTAGGACTGAAAATGATTATTACTGAAACAGGATGTGAGAGATTATAATGAGTTGTCCACTATTTATAATGTCACACAGGAATTCTGTTTCATCGCTGAGTGACACTCTTTTGTTGCAGGCCCCTTCCCTTTCATCCAAGACAACATCTCATTCTATGCAACAATTGGTGTTTGTCTCCTCTTCATTGTCGTTTTAACCCTGCTAATTTGTCACAAGTACAAAAAGGTAAAAGCAAAGGTAAAAATTCATTATTCTTTCCTCTATCTGCAGAACTGCCTATTCCTAACTGACTCATCATTTCATCTCTGAAGCAATTTAGGTATGAAAGCCAGGGAGAGAGAGAGATAATGATAATGAGTACTTCTACGTTGATATGCTACAGATGGTACAGGTGACCGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGAATATGATCTCAAATGGGAGTTTCCAAGAGAAAATTTAGAGTTTGGTAAGAATGGAATGTGCCAAATGTTTCTGCAGCATTTCTTTTCCATTGGAAAATCTTTAAAATGCACGTACTCACCATTTGTCTTTGCAGGGAAGGTACTAGGATCAGGTGCTTTTGGAAAAGTGATGAACGCAACAGCTTATGGAATTAGCAAAACAGGAGTCTCAATCCAGGTTGCCGTCAAAATGCTGAAAG; Among them, the plasmid sequence of 586 (JMs) is: TAATGTCACACAGGAATTCTGTTTCATCGCTGAGTGACACTCTTTTGTTGCAGGCCCCTTCCCTTTCATCCAAGACAACATCTCATTCTATGCAACAATTGGTGTTTGTCTCCTCTTCATTGTCGTTTTAACCCTGCTAATTTGTCACAAGTACAAAAAGGTAAAAGCAAAGGTAAAAATTCATTATTCTTTCCTCTATCTGCAGAACTGCCTATTCCTAACTGACTCATCATTTCATCTCTGAAGCAATTTAGGTATGAAAGCCAGCTACAGATGGTACAGGTGACCTGCCATGTCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGAATATGATCTCAAATGGGAGTTTCCAAGAGAAAATTTAGAGTTTGGTAAGAATGGAATGTGCCAAATGTTTCTGCAGCATTTCTTTTCCATTGGAAAATCTTTAAAATGCACGTACTCACCATTTGTCTTTGCAGGGAAGGTACTAGGATCAGGTGCTTTTGGAAAAGTGATGAACGCAACAGCTTATGGAATTAGCAAAACAGGAGTCTCAATCCAGGTTGCCGTCAAAATGCTGAAAGGTACAGTATAGTGGAAGGACAGCAACAAAGATGCACAAAAATGGGAGGCACAGTTTCCCACCCATGCCTTCTTCTCTTTTCCATCCTTTTAATGGTTAC; Among them, the plasmid sequence of 3b (JmZ) is: GTAAAAGCAAAGGTAAAAATTCATTATTCTTTCCTCTATCTGCAGAACTGCCTATTCCTAACTGACTCATCATTTCATCTCTGAAGCAATTTAGGTATGAAAGCCAGCTACAGATGGTACAGGTGACCGGCTCCTCAGATAATGAGTACTCTCAAATGGGAGTCTACGTTGATTTCAGAGAATATGAATATGATCTCAAATGGGAGTTTCCAAGAGAAAATTTAGAGTTTGGTAAGAATGGAATGTGCCAAATGTTTCTGCAGCATTTCTTTTCCATTGGAAAATCTTTAAAATGCACGTACTCACCATTTGTCTTTGCAGGGAAGGTACTAGGATCAGGTGCTTTTGGAAAAGTGATGAACGCAACAGCTTATGGAATTAGCAAAACAGGAGTCTCAATCCAGGTTGCCGTCAAAATGCTGAAAG; Among them, the 612 (HR) plasmid sequence is: CACAAGTACAAAAAGGTAAAAGCAAAGGTAAAAATTCATTATTCTTTCCTCTATCTGCAGAACTGCCTATTCCTAACTGACTCATCATTTCATCTCTGAAGCAATTTAGGTATGAAAGCCAGCTACAGATGGTACAGGTGACCGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGAATATGATCTCAAATGGGAGAGCCTCTTTCCAAGAGAAAATTTAGAGTTTGGTAAGAATGGAATGTGCCAAATGTTTCTGCAGCATTTCTTTTCCATTGGAAAATCTTTAAAATGCACGTACTCACCATTTGTCTTTGCAGGGAAGGTACTAGGATCAGGTGCTTTTGGAAAAGTGATGAACGCAACAGCTTATGGAATTAGCAAAACAGGAGTCTCAATCCAGGTTGCCGTCAAAATGCTGAAAGGTA; Among them, the B1 S plasmid sequence is: GTAAAAGCAAAGGTAAAAATTCATTATTCTTTCCTCTATCTGCAGAACTGCCTATTCCTAACTGACTCATCATTTCATCTCTGAAGCAATTTAGGTATGAAAGCCAGCTACAGATGGTACAGGTGACCGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGAATATGATCTCAAATGGGAGTTTCCAAGAGAAAATGTACAGCATGTTTTAGAGTTTGGTAAGAATGGAATGTGCCAAATGTTTCTGCAGCATTTCTTTTCCATTGGAAAATCTTTAAAATGCACGTACTCACCATTTGTCTTTGCAGGGAAGGTACTAGGATCAGGTGCTTTTGGAAAAGTGATGAACGCAACAGCTTATGGAATTAGCAAAACAGGAGTCTCAATCCAGGTTGCCGTCAAAATGCTGAAAG; Among them, the NBL1 plasmid sequence is: GTAAAAGCAAAGGTAAAAATTCATTATTCTTTCCTCTATCTGCAGAACTGCCTATTCCTAACTGACTCATCATTTCATCTCTGAAGCAATTTAGGTATGAAAGCCAGCTACAGATGGTACAGGTGACCGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGAATATGATCTCAAATGGGAGTTTCCAAGAGAAAATTTAGAGTTTGGTAAGAATGGAATGTGCCAAATGTTTCTGCAGCATTTCTTTTCCATTGGAAAATCTTTAAAATGCACGTACTCACCATTTGTCTTTGTTCTAATGGACAATCCAGGGAAGGTACTAGGATCAGGTGCTTTTGGAAAAGTGATGAACGCAACAGCTTATGGAATTAGCAAAACAGGAGTCTCAATCCAGGTTGCCGTCAAAATGCTGAAAG; Among them, the B2S plasmid sequence is: 0105.GTAAAAGCAAAGGTAAAAATTCATTATTCTTTCCTCTATCTGCAGAACTGCCTATTCCT AACTGACTCATCATTTCATCTCTGAAGCAATTTAGGTATGAAAGCCAGCTACAGATGGTACAGGTGACCGGCTCCTCAGATAATGAGTACTTCTACGTTGATTTCAGAGAATATGAATATGATCTCAAATGGGAGTTTCCAAGAGAAAATTTAGAGTTTGGTAAGAATGGAATGTGCCAAATGTT TCTGCAGCATTTCTTTTCCATTGGAAAATCTTTAAAATGCACGTACTCACCATTTGTCTTTGCAGGGAAGGTACTAGGATCAGGTGCTTTTGGAAAATTCTCGATACTAGACGTGATGAACGCAACAGCTTATGGAATTAGCAAAACAGGAGTCTCAATCCAGGTTGCCGTCAAAATGCTGAAAG.
4. The method according to claim 3, characterized in that The sample of the kit is selected from plasma specimens or paraffin specimens.
5. The method according to claim 3, characterized in that The PCR is an asymmetric PCR method.
6. The method according to claim 3, characterized in that The kit also includes Perfecta MultiplexToughMix digital PCR premix and fluorescein sodium salt, and the premix includes dNTPs, Taq enzyme and PCR buffer.
7. The method according to claim 3, characterized in that The PCR reaction system is 25 μL, and / or the PCR reaction procedure corresponding to the PCR chip is as follows: Droplet generation step: temperature 40°C; Enzyme digestion step: temperature 37°C, time 5 minutes; Pre-denaturation step: temperature 95°C, time 3 minutes; PCR reaction steps: deformation temperature 95 ° C for 15 seconds, annealing temperature 60 ° C for 1 minute, wherein the PCR reaction steps are repeated multiple times; Probe binding step: 5 minutes at 55°C, 10 minutes at 30°C; Pressure release step: temperature 25°C.
8. The method according to claim 3, characterized in that The PCR chip is a Sapphire chip; and / or, the fluorescent label of JMB-1 is FAM-BHQ1; the fluorescent label of JMB-2 is VIC-BHQ1; the fluorescent label of JMs is CY5-BHQ3; the fluorescent label of JmZ is FAM-BHQ1; the fluorescent label of HR1 is VIC-BHQ1; the fluorescent label of B1-S is CY5-BHQ3; the fluorescent label of NBL is FAM-BHQ1; and the fluorescent label of B2-S is VIC-BHQ1.
Citation Information
Patent Citations
Fluorescent probe for fluorescent quantitative PCR reactions
CN104404142A
Kit utilizing stem loop primers to detect PIK3CA gene mutation sites
CN110029171A