Primers and methods for distinguishing between field and vaccine strains of Eimeria virulenta

By designing highly specific primer pairs and PCR technology, combined with high-resolution melting curve technology, a detection kit for identifying wild strains and vaccine strains of toxic Eimeria was developed, which solved the problem of difficulty in distinction and detection in existing technologies and achieved efficient and accurate identification effects.

CN117512160BActive Publication Date: 2025-09-19INST OF ANIMAL HEALTH GUANGDONG ACADEMY OF AGRI SCI +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202311681335.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-12-08
Publication Date
2025-09-19
Estimated Expiration
2043-12-08

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively distinguish and detect wild strains and vaccine strains of virulent Eimeria, resulting in safety risks and interference with test results during the use of live vaccines.

Method used

Primer pairs with strong specificity and good stability are designed, and combined with PCR technology and high-resolution melting curve technology, a detection kit for identifying wild strains and vaccine strains of toxic Eimeria is developed, and identification is performed through PCR amplification and electrophoresis or sequencing.

Benefits of technology

The accurate identification of wild strains and vaccine strains of virulent Eimeria is achieved with simple operation, high repeatability and strong specificity, avoiding the safety hazards of live vaccine use and interference with test results.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The present application relates to primers and methods for distinguishing between wild-type and vaccine strains of Eimeria necrotica. The primers include an upstream primer and a downstream primer. The nucleotide sequence of the upstream primer is shown in SEQ ID NO. 1; the nucleotide sequence of the downstream primer is shown in SEQ ID NO. 2. The primers are used to distinguish between wild-type and vaccine strains of Eimeria necrotica, with simple operation, high reproducibility, and strong specificity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present application relates to the field of molecular biological detection technology, and in particular to a primer and method for identifying wild strains and vaccine strains of Eimeria toxicans. Background Art

[0002] Coccidiosis is a protozoan disease that parasitizes the intestinal epithelial cells of chickens. Eimeria tenella, Eimeria maxima, Eimeria acervulina, and Eimeria necatrix are the most serious pathogens. Eimeria necatrix is ​​primarily transmitted through oocysts and colonizes the small intestine, primarily in the middle third of the small intestine. Clinically, animals infected with Eimeria necatrix, particularly chicks, often exhibit depression, diarrhea, and even bloody stools. This disease also significantly reduces production performance and severely impacts market yields. Consequently, this disease causes significant economic losses to the poultry industry worldwide.

[0003] Since the 1940s, the primary approach to combating Eimeria nematophila has been the development and use of anticoccidial drugs such as monensin, maduramycin, and hainanmycin. However, since the 1970s, the emergence of drug-resistant Eimeria nematophila has outpaced the development of new drugs. Furthermore, drug use inevitably leads to increased drug residues in poultry meat, raising public health concerns. Consequently, live vaccines are currently increasingly used for Eimeria nematophila control. However, live vaccines can colonize in intestinal tissues, potentially affecting molecular detection of Eimeria nematophila in clinical samples. Furthermore, vaccine administration poses the safety risk of virulence reversion. Therefore, considering the effectiveness and safety of live vaccines against Eimeria nematophila, it is imperative to develop a method for distinguishing vaccine and field strains of Eimeria nematophila. Furthermore, such a method would facilitate accurate monitoring of field infection in chickens following live vaccine immunization, providing a valuable resource for coccidia disease prevention and control in chickens. Summary of the Invention

[0004] Based on this, it is necessary to provide a primer and a kit for identifying the wild strains and vaccine strains of Eimeria toxicans in the embodiments of the present application.

[0005] The specific technical solutions are as follows:

[0006] In the first aspect, the present application provides a primer pair for identifying wild strains and vaccine strains of Eimeria toxicum, the primer pair comprising an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer being shown in SEQ ID NO.1; the nucleotide sequence of the downstream primer being shown in SEQ ID NO.2.

[0007] In a second aspect, the present application provides a detection kit for identifying wild strains and vaccine strains of virulent Eimeria, wherein the kit comprises the primer pair.

[0008] In one embodiment, the kit includes the use of PCR technology and / or high-resolution melting curve technology to identify the virulent Eimeria wild strains and vaccine strains.

[0009] In one embodiment, the kit further comprises one or more of a PCR reaction solution, a DNA polymerase, a fluorescent dye, a positive quality control standard, and a negative quality control standard.

[0010] In one embodiment, the positive quality control standard includes the whole genome of the wild strain and vaccine strain of Eimeria toxicans, or a recombinant plasmid containing the nucleotide fragments shown in SEQ ID NO.3 and SEQ ID NO.4.

[0011] In a third aspect, the present application provides a method for identifying a field strain and a vaccine strain of Eimeria virulentiscus, the method comprising the following steps:

[0012] Extracting genomic DNA from the sample to be tested;

[0013] Using the DNA as a template, PCR amplification is performed using the primer pair or the kit;

[0014] The obtained PCR amplification products are analyzed, and based on the obtained analysis results, the sample to be tested is identified as a wild strain of Eimeria toxicans, a vaccine strain of Eimeria toxicans, or a sample containing both a wild strain and a vaccine strain of Eimeria toxicans.

[0015] Optionally, the PCR amplification products are analyzed by agarose gel electrophoresis and / or sequencing.

[0016] In one embodiment, the electrophoresis result shows an electrophoretic band of 140 bp to 150 bp in size, and / or the sequencing peak diagram shows a single peak, and the sequence obtained by sequencing is identical to SEQ ID NO. 3, and it is determined that the sample to be tested belongs to a wild strain of Eimeria toxicophila.

[0017] In one embodiment, the electrophoresis result shows an electrophoretic band of 170 bp to 180 bp, and / or the sequencing peak diagram shows a single peak, and the sequence obtained by sequencing is identical to SEQ ID NO. 4, and the sample to be tested is determined to be a vaccine strain of Eimeria toxicophila.

[0018] In one embodiment, the electrophoresis results show an electrophoretic band of 170bp~180bp and an electrophoretic band of 140bp~150bp, and / or the sequences obtained by sequencing are identical to the nucleotide sequences shown in SEQ ID NO.3 and SEQ ID NO.4, respectively, and it is determined that the test sample contains both the vaccine strain and the wild strain of toxic Eimeria.

[0019] In one embodiment, the PCR amplification system includes the primers, amplification buffer, dNTP mixture, DNA polymerase, Mg 2+ and one or more of fluorescent dyes.

[0020] In one embodiment, the working concentration of the primer is 0.1 μM to 0.6 μM.

[0021] In one embodiment, the PCR amplification conditions include 93°C~95°C for 4~5 min; 93°C~94°C for 30s~35s, 50°C~65°C for 30s~40s, 70°C~72°C for 20s~30s, 30~35 cycles; 70°C~72°C for 8min~10min.

[0022] Compared with traditional technologies, this application has the following beneficial effects:

[0023] The present application provides a primer that can be used to distinguish between wild strains and vaccine strains of Eimeria toxicans. The primer and a kit containing the primer are used to distinguish between wild strains and vaccine strains of Eimeria toxicans, with simple operation, high repeatability and strong specificity. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 The electrophoresis results of PCR amplification products of Eimeria necroticus ENHZ vaccine strain and Eimeria necroticus GD test strain are shown. Lanes 1 and 2 show the PCR amplification products of Eimeria necroticus GD test strain, with a band size of approximately 146 bp. Lanes 3 and 4 show the amplification products of Eimeria necroticus ENHZ vaccine strain, with a band size of approximately 178 bp. M stands for DL500 marker.

[0025] Figure 2 This is a peak diagram of the differential sites of PCR products of Eimeria virulentis ENHZ vaccine strain and Eimeria virulentis GD test strain;

[0026] Figure 3The results of kit-specific detection are as follows; lanes 1 and 2 are the amplification products of the test and vaccine strains of Eimeria acervulina, lanes 3 and 4 are the amplification products of the test and vaccine strains of Eimeria maxima, lanes 5 and 6 are the amplification products of the test and vaccine strains of Eimeria tenella, lanes 7 and 8 are the amplification products of the wild-type and precocious strains of Eimeria brucei, lanes 9-10 and 11-12 are the amplification products of the test and vaccine strains of Eimeria toxicophila, and lane 13 is the negative control; M is DL500 Marker. DETAILED DESCRIPTION

[0027] To make the above-mentioned objects, features, and advantages of the present application more clearly understood, the specific embodiments of the present application are described in detail below. The following description sets forth many specific details to facilitate a full understanding of the present application. However, the present application can be implemented in many other ways than those described herein, and those skilled in the art can make similar modifications without violating the scope of the present application. Therefore, the present application is not limited to the specific embodiments disclosed below.

[0028] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which this application pertains. The terms used herein in the specification of this application are for the purpose of describing specific embodiments only and are not intended to limit this application.

[0029] In this application, the terms "first," "second," and "third" in "a first aspect," "a second aspect," and "a third aspect" are used for descriptive purposes only and should not be understood as indicating or implying relative importance or quantity, nor as implicitly indicating the importance or quantity of the technical features indicated. Furthermore, "first," "second," and "third" serve only as non-exhaustive enumeration and description and should not constitute a closed-ended limitation on quantity.

[0030] In this application, the selection scope of "and / or" includes any one of two or more related listed items, and also includes any and all combinations of the related listed items, and the said any and all combinations include any two related listed items, any more related listed items, or the combination of all related listed items. For example, "A and / or B" includes three parallel solutions of A, B and A+B. For another example, the technical solution of "A, B, C, and / or, D" includes any one of A, B, C, and D, and also includes any and all combinations of A, B, C, and D, that is, the combination of any two or any three of A, B, C, and D, and also includes the four-item combination of A, B, C, and D.

[0031] In this application, "plurality", "multiple", "multiple times", "multiple groups", etc., unless otherwise specified, refer to a quantity greater than or equal to 2. For example, "one or more" means one or more than or equal to two.

[0032] In this application, the terms "optionally," "optional," and "optional" are optional, meaning they are either present or absent, i.e., they refer to either option being selected from the two parallel options of "with" or "without." If multiple "options" appear in a technical solution, unless otherwise specified and there are no contradictions or mutual constraints, each "optional" is independent of the other. In this application, "further" and the like are used for descriptive purposes to indicate differences in content, but should not be construed as limiting the scope of protection of this application.

[0033] In the present application, open technical features or technical solutions described with words such as "include" and "comprising" do not exclude additional members other than the listed members unless otherwise specified. It can be regarded as providing both closed features or solutions consisting of the listed members and open features or solutions including additional members other than the listed members.

[0034] " scope " disclosed in the present application can be limited in the form of lower limit and upper limit, and given range is limited by selecting a lower limit and an upper limit, and the selected lower limit and upper limit define the boundary of special range. The scope limited in this way can be to include end value or not include end value, and any end value can be included or not included independently, and can be arbitrarily combined, that is, any lower limit can form a scope with any upper limit combination. For example, if the scope of 60-120 and 80-110 is listed for specific parameters, it is understood that the scope of 60-110 and 80-120 is also expected. In addition, if the minimum range value 1 and 2 listed, and if the maximum range value 3,4 and 5 are also listed, then the following scope can all be expected: 1-3, 1-4, 1-5, 2-3, 2-4 and 2-5. In the present application, unless otherwise specified, the numerical range " ab " represents the abbreviation of any real number combination between a and b, wherein a and b are all real numbers. For example, the numerical range "0-5" indicates that all real numbers between "0-5" are listed herein, and "0-5" is merely an abbreviation for these numerical combinations. Furthermore, when a parameter is expressed as an integer ≥ 2, this is equivalent to listing the parameter as, for example, the integers 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, and so on. For example, when a parameter is expressed as an integer selected from "2-10", this is equivalent to listing the integers 2, 3, 4, 5, 6, 7, 8, 9, and 10.

[0035] This application performs a large amount of resequencing on wild strains and vaccine strains of virulent Eimeria, and conducts comparative analysis to find multiple differential target sequences. Multiple sets of primers are designed based on different target sequences. Through PCR and first-generation sequencing, primer pairs with strong specificity and good stability are screened out, which can be used to identify wild strains and vaccine strains of virulent Eimeria.

[0036] One embodiment of the present application provides a primer for distinguishing between a wild-type strain of Eimeria toxicum and a vaccine strain, the primer comprising an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer being shown in SEQ ID NO. 1; the nucleotide sequence of the downstream primer being shown in SEQ ID NO. 2. The primer has good specificity and strong stability.

[0037] One embodiment of the present application also provides a detection kit for distinguishing between wild strains and vaccine strains of Eimeria virulenta, the kit comprising the above-mentioned primers.

[0038] In a specific example, the kit further includes one or more of a PCR reaction solution, a positive quality control standard, and a negative quality control standard.

[0039] In a specific example, the PCR reaction solution includes amplification buffer, dNTP mixture, DNA polymerase, Mg 2+ and one or more of fluorescent dyes.

[0040] In a specific example, the kit includes using PCR technology and / or high-resolution melting curve technology to identify the field strains and vaccine strains of virulent Eimeria.

[0041] PCR, short for polymerase chain reaction, is a molecular biology technique used to amplify specific DNA fragments in vitro. PCR techniques include standard PCR and real-time fluorescence quantitative PCR.

[0042] Conventional PCR, also known as first-generation PCR, uses a common PCR amplifier to amplify the target gene and conducts qualitative analysis of the product by agarose gel electrophoresis.

[0043] Real-time PCR (Quantitative Real-time PCR) is a method that uses fluorescent chemicals to measure the total amount of product after each polymerase chain reaction (PCR) cycle during a DNA amplification reaction. It allows for the quantitative analysis of specific DNA sequences in a sample using internal or external references.

[0044] Real-time fluorescence quantitative PCR includes DNA-binding dye methods such as SYBR Green I dye method and probe-based chemical methods such as TaqMan probes.

[0045] SYBR Green I is the most commonly used fluorescent dye in fluorescent quantitative PCR. It is a non-saturated fluorescent dye that binds to all double-stranded DNA. When SYBR Green I is added to the PCR reaction system, it will bind to double-stranded DNA during the process, generating a fluorescent signal.

[0046] The TaqMan probe was the first quantitative method used and remains the most commonly used in clinical testing. During PCR amplification, a specific fluorescent probe is added simultaneously with a pair of primers. This probe is an oligonucleotide labeled with a fluorescent reporter (R) at the 5' end and a quencher (Q) at the 3' end. When the probe is intact, the fluorescent signal emitted by the reporter is absorbed by the quencher, rendering it undetectable. During PCR amplification (during the extension phase), the probe is cleaved and degraded by the 5'→3' exonuclease activity of the Taq enzyme, separating the reporter and quencher groups. The fluorescence emitted by the reporter is no longer absorbed, allowing the fluorescent signal to be detected by the fluorescence monitoring system.

[0047] High-resolution melting (HRM) technology is a genetic analysis technology that forms different melting curves based on the different melting temperatures of single nucleotides. It has extremely high sensitivity and can detect differences in single bases. It is low-cost, high-throughput, fast, accurate, and not limited by the detection site, realizing a true closed-tube operation.

[0048] HRM technology combines PCR amplification with melting curve analysis, relying on a high-resolution temperature-detecting PCR instrument and novel saturated fluorescent dyes to analyze gene sequences. The principle is to run a high-resolution melting procedure directly on the PCR amplification product after PCR is complete. The instrument then detects changes in the fluorescence intensity of the saturated fluorescent dye in the amplicon to obtain a characteristic melting curve. Finally, sequence variation is determined based on the position and morphological changes of the melting curve, enabling the distinction of single base sequence differences. The shape and position of the melting curve are primarily related to the length and GC content of the amplified product. Different nucleic acid molecules have varying GC content and distribution, resulting in different Tm values ​​for double-stranded DNA molecules during thermal denaturation, resulting in a unique melting curve shape and position.

[0049] HRM technology uses saturating fluorescent dyes for detection. Saturating fluorescent dyes, such as Eva Green, LC Green, and SYTO9, not only have strong DNA binding affinity but also exhibit low inhibition. These characteristics ensure that the dyes are saturatedly incorporated into the DNA duplex, while also preventing the fluorescent dye released during dissolution from continuing to bind to the DNA duplex.

[0050] In a specific example, the positive quality control standard includes the whole genome of the wild strain and the vaccine strain or a recombinant plasmid containing the nucleotide fragments shown as SEQ ID NO.3 and SEQ ID NO.4.

[0051] One embodiment of the present application also provides a method for identifying a virulent Eimeria wild strain and a vaccine strain, the method comprising the following steps (1) to (3):

[0052] Step (1), extracting genomic DNA from the sample to be tested.

[0053] Step (2) uses the DNA obtained in step (1) as a template and uses the above primer pair or the above kit to perform PCR amplification.

[0054] Step (3) is to analyze the PCR product obtained in step (2) and identify the Eimeria toxicophilus wild strain and vaccine strain based on the analysis results.

[0055] In a specific example, the obtained PCR products are subjected to agarose gel electrophoresis and / or sequencing, and the test samples are identified as wild-type strains and vaccine strains of Eimeria toxicophila based on the electrophoresis results and / or sequencing results.

[0056] In a specific example, the electrophoresis result shows a 146bp electrophoretic band, and / or the sequencing peak diagram is a single peak, and the sequence obtained by sequencing completely matches the nucleotide sequence shown in SEQ ID NO.3 after alignment, then the sample to be tested belongs to the wild strain of Eimeria toxicophila.

[0057] In a specific example, the electrophoresis result shows a 178bp electrophoretic band, and / or the sequencing peak diagram is a single peak, and the sequence obtained by sequencing completely matches the nucleotide sequence shown in SEQ ID NO.4 after alignment, then the sample to be tested is the Eimeria toxicophila vaccine strain.

[0058] In a specific example, the electrophoresis results show an electrophoretic band of 178 bp and an electrophoretic band of 146 bp, and / or the sequence obtained by sequencing completely matches the nucleotide sequences shown in SEQ ID NO.3 and SEQ ID NO.4, respectively. Then, the sample to be tested is a mixture of the toxic Eimeria vaccine strain and the wild strain.

[0059] In a specific example, the PCR amplification conditions include 93°C~95°C for 4~5 min; 93°C~94°C for 30s~35s, 50°C~65°C for 30s~40s, 70°C~72°C for 20s~30s, 30~35 cycles; 70°C~72°C for 8min~10min.

[0060] In a specific example, the PCR amplification conditions include 95° C. for 5 min; 94° C. for 30 s, 60° C. for 30 s, and 72° C. for 30 s, for 30 cycles; and 72° C. for 10 min.

[0061] In a specific example, the working concentration of the primer is 0.1 μM to 0.6 μM. It is understood that the working concentration of the primer is 0.1 μM, 0.2 μM, 0.3 μM, 0.4 μM, 0.5 μM or 0.6 μM.

[0062] In a specific example, each 50 μL of PCR amplification system includes 25 μL of 2×Premix Taq DNA mix, 2 μL~3 μL of 10 μM upstream primer, 2 μL~3 μL of 10 μM downstream primer, 100 ng~500 ng of the sample DNA to be tested, and double-distilled water to make up to 50 μL.

[0063] The embodiments of the present application will be described in detail below with reference to the examples. It should be understood that these examples are intended to illustrate the present application only and are not intended to limit the scope of the present application. The experimental methods for which specific conditions are not specified in the following examples are preferably referred to the guidance provided in the present application, and can also be based on the experimental manuals or conventional conditions in this area, or according to the conditions recommended by the manufacturer, or with reference to experimental methods known in the art.

[0064] In the following specific examples, the measured parameters of raw material components may have slight deviations within the range of weighing accuracy unless otherwise specified. For temperature and time parameters, acceptable deviations caused by instrument testing accuracy or operational accuracy are allowed.

[0065] Example 1 Assembly of a PCR Detection Kit for Identifying Field and Vaccine Strains of Eimeria virulenta

[0066] This kit consists of Premix Taq DNA mix (TAKARA Co. Ltd.), specific primer pairs for wild-type and vaccine strains of Eimeria necroticus, negative control standards, positive quality control standards, and ultrapure water.

[0067] The specific composition of each reaction system is shown in Table 1 below.

[0068] Table 1

[0069]

[0070] The kit uses Premix Taq DNA mix (Cat No. RP901A) purchased from TaKaRa. The concentrations of both upstream and downstream primer stock solutions are 10 μM. The nucleotide sequence of the upstream primer is GATGCTGGGCTTGGCGGTCTC, SEQ ID NO. 1; the nucleotide sequence of the downstream primer is GGTGCCTTGTCGGAAGCTTAGAA, SEQ ID NO. 2.

[0071] In addition, the negative control standard is reverse osmosis water with a purity of not less than 18.25 MΩ·CM, and the positive control standard is the genomic DNA of the Eimeria necroticus GD test strain and the Eimeria necroticus ENHZ vaccine strain or the recombinant plasmid composed of the nucleotide fragments shown in SEQ ID NO.3 and SEQ ID NO.4 and cloning vectors such as pMD18T.

[0072] The nucleotide sequence of SEQ ID NO.3 is as follows:

[0073] GATGCTGGGCTTGGCGGTCTCCTGCTGGCCAACGTATACGTTTGGCGTCAAGCTTGGTGAGCGGGGCCAGCAGTCACATCGGATCAGGAAGACGACCAGTATGTGGCGTGCAGTCCCACTGCATTCTAAGCTTCCGACAAGGCACC.

[0074] The nucleotide sequence of SEQ ID NO.4 is as follows:

[0075] GATGCTGGGCTTGGCGGTCTCCTGCTGGCCAACGTATACGTTTGGCGTCAAGCTTGGTGAGCGGGGCCAGCAGTCACATCGGATCAGGAAGACGACCAGCATGTGGCGTGGGTTTCTCGTCTCCTGAGCGACCTGTACCGCGCAGTCCCACTGCATTCTAAGCTTCCGACAAGGCACC.

[0076] Example 2 Using a kit to identify wild strains and vaccine strains of Eimeria virulenta

[0077] (1) Use a rapid DNA extraction kit to extract genomic DNA from the purified Eimeria virulentis ENHZ vaccine strain and Eimeria virulentis GD test strain.

[0078] (2) The kit assembled in Example 1 was used to identify the wild-type and vaccine strains of Eimeria toxicans: PCR amplification was performed using the extracted sample genomic DNA as a template and specific primer pairs for the wild-type and vaccine strains of Eimeria toxicans. The specific PCR reaction system components were Premix Taq DNA mix: 25 μL, 10 μM upstream primer: 2 μL, 10 μM downstream primer: 2 μL, and the sample DNA to be tested: 1 μL. Finally, double-distilled water (ddH2O) was added to make up to 50 μL. The PCR reaction conditions were: 95°C for 5 min; 94°C for 30 sec, 60°C for 30 sec, 72°C for 30 sec, 30 cycles; 72°C for 10 min.

[0079] (3) After the reaction is completed, take 5 μL of PCR product and perform electrophoresis on 3% agarose gel to observe whether the 146 bp electrophoresis band appears in the PCR product corresponding to the Eimeria GD test strain and the 178 bp electrophoresis band appears in the PCR product corresponding to the Eimeria ENHZ vaccine strain. Figure 1 As shown, the electrophoretic band of the test strain of Eimeria virulentis appeared as a 146 bp band, and the electrophoretic band of the vaccine strain of Eimeria virulentis appeared as a 178 bp band.

[0080] To further verify the above results, the PCR product was constructed into a cloning vector using pMD18T and sent to a sequencing company for sequencing. The sequencing result of the 146 bp band should be a single peak that fully matches SEQ ID NO. 3 after alignment; the sequencing result of the 178 bp band should be a single peak that fully matches SEQ ID NO. 4 after alignment. This indicates that the detection results of this application kit are accurate.

[0081] When SEQ ID NO.3 and SEQ ID NO.4 are aligned, the sequence "GGTTTCTCGTCTCCTGAGCGACCTGTACCGCG" is inserted. Figure 2 shown.

[0082] Example 3 Kit Specificity Test

[0083] The PCR kit of the present application was used to perform PCR amplification on the genomic DNA of vaccine strains and test strains of Eimeria maxima (Em), Eimeria tenella (Et), Eimeria acervulina (Ea), and Eimeria necatrix (En), as well as the wild strain and precocious strain of Eimeria brunette (Eb).

[0084] The PCR reaction system consists of 25 µL of Premix Taq DNA mix, 2 µL of 10 µM upstream primer, 2 µL of 10 µM downstream primer, and 1 µL of test sample DNA. Double-distilled water (ddH₂O) is added to make up to 50 µL. The nucleotide sequence of the upstream primer is shown in SEQ ID NO. 1, and the nucleotide sequence of the downstream primer is shown in SEQ ID NO. 2.

[0085] PCR reaction conditions were: 95°C for 5 min; 94°C for 30 sec, 60°C for 30 sec, 72°C for 30 sec, 30 cycles; 72°C for 10 min.

[0086] After the PCR reaction is completed, take 5 μL of PCR product and perform electrophoresis on 3% agarose gel to observe whether the PCR product corresponding to the toxic Eimeria test strain has an electrophoretic band of 146 bp, whether the PCR product corresponding to the toxic Eimeria vaccine strain has an electrophoretic band of 178 bp, and whether other strains have bands.

[0087] The results are as follows Figure 3 As shown, only the vaccine strain and the test strain samples of Eimeria virulentiscus each showed a corresponding specific band, while other insect strains did not expand to specific bands, indicating that the primers and kit of the present application have good specificity.

[0088] The technical features of the above-mentioned embodiments can be combined arbitrarily. In order to make the description concise, not all possible combinations of the technical features in the above-mentioned embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

[0089] The above-described embodiments merely represent several implementation methods of the present application. While the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the present invention. It should be noted that a person skilled in the art could make various modifications and improvements without departing from the spirit of the present application, all of which fall within the scope of protection of the present application. Therefore, the scope of protection of the present patent application shall be determined by the appended claims, and the specification may be used to interpret the content of the claims.

Claims

1. A primer pair for distinguishing between a wild strain and a vaccine strain of Eimeria virulenta, characterized in that: The primer pair includes an upstream primer and a downstream primer, the nucleotide sequence of the upstream primer is shown in SEQ ID NO.1; the nucleotide sequence of the downstream primer is shown in SEQ ID NO.2; The wild strain is the GD test strain of Eimeria toxicans; The vaccine strain is the Eimeria virulentis ENHZ vaccine strain.

2. A detection kit for distinguishing wild strains and vaccine strains of Eimeria toxicans, characterized in that: The kit comprises the primer pair according to claim 1; The wild strain is the GD test strain of Eimeria toxicans; The vaccine strain is the Eimeria virulentis ENHZ vaccine strain.

3. The kit according to claim 2, wherein The kit comprises a method for identifying wild strains and vaccine strains of Eimeria virulentis by using PCR technology and / or high-resolution melting curve technology.

4. The kit according to claim 3, wherein The kit further comprises one or more of a PCR reaction solution, a positive quality control standard and a negative quality control standard.

5. The kit according to claim 4, characterized in that The PCR reaction solution includes amplification buffer, dNTP mixture, DNA polymerase, Mg 2+ and one or more of fluorescent dyes.

6. The kit according to claim 5, characterized in that The positive quality control standard includes the whole genome of the wild strain and vaccine strain of Eimeria toxicans, or a recombinant plasmid containing the nucleotide fragments shown as SEQ ID NO.3 and SEQ ID NO.

4.

7. A method for distinguishing between a field strain and a vaccine strain of Eimeria virulenta, characterized in that: The method is based on non-diagnostic purposes, which means it is not used for clinical testing; the wild strain is the GD test strain of Eimeria toxicans; the vaccine strain is the ENHZ vaccine strain of Eimeria toxicans; The method comprises the following steps: Extracting genomic DNA from the sample to be tested; Using the DNA as a template, PCR amplification is performed using the primer pair according to claim 1 or the kit according to any one of claims 2 to 6; The obtained PCR amplification products are analyzed, and the sample to be tested is identified as a wild strain or a vaccine strain of Eimeria virulentis based on the obtained analysis results.

8. The method according to claim 7, characterized in that The PCR amplification products are analyzed by agarose gel electrophoresis and / or sequencing.

9. The method according to claim 7, characterized in that Identifying the sample to be tested as a field strain or vaccine strain of Eimeria toxicans based on the obtained analysis results includes: The electrophoresis results showed a 140 bp to 150 bp electrophoretic band, the sequencing peak diagram showed a single peak, and the sequence obtained by sequencing was identical to SEQ ID NO. 3, indicating that the test sample belonged to the wild strain of Eimeria toxicophila; The electrophoresis results showed a 170 bp to 180 bp electrophoretic band, the sequencing peak diagram showed a single peak, and the sequence obtained by sequencing was identical to SEQ ID NO. 4, indicating that the test sample was a vaccine strain of Eimeria toxicophila; The electrophoresis results showed an electrophoretic band of 170bp to 180bp and an electrophoretic band of 140bp to 150bp. The sequences obtained by sequencing were identical to SEQ ID NO.3 and SEQ ID NO.4, respectively, and it was determined that the test sample included both the vaccine strain and the wild strain of Eimeria toxicans.

10. The method according to any one of claims 7 to 9, characterized in that The PCR amplification system includes the primers, amplification buffer, dNTP mixture, DNA polymerase, Mg 2+ and one or more of fluorescent dyes.

11. The method according to any one of claims 7 to 9, characterized in that The working concentration of the primers is 0.1 μM to 0.6 μM.

12. The method according to any one of claims 7 to 9, characterized in that: The conditions for PCR amplification include 93°C to 95°C for 4 to 5 minutes; 93°C to 94°C for 30 seconds to 35 seconds, 50°C to 65°C for 30 seconds to 40 seconds, and 70°C to 72°C for 20 seconds to 30 seconds, for 30 to 35 cycles; and 70°C to 72°C for 8 minutes to 10 minutes.

Citation Information

Patent Citations

  • Specific primer SP2908 and PCR detection method of chicken eimeria necatrix oocysts

    CN110157826A

  • Specific primer pair, identification product and method for identifying wild virus strain and vaccine strain of Eimeria maxima

    CN116064880A