STS molecular markers in Pennisetum and their application

Abstract

The present invention specifically relates to a Pennisetum STS molecular marker and its application, wherein the molecular marker has forward and reverse primers corresponding to 17 sites, as shown in SEQ ID No: 1-34. The STS marker screened by the present invention is amplified in American Pennisetum, elephant grass, hybrid Pennisetum, native Pennisetum, East African Pennisetum and multi-spike Pennisetum germplasm within the Pennisetum genus, and is a universal marker within the Pennisetum genus, breaking the current situation of interspecific incompatibility of molecular marker types of predecessors, and providing a new basis for identifying new interspecific hybridization germplasm. The actual MAF values ​​of the 17 STS markers screened by the present invention in 136 germplasm resources are all>10%, and the polymorphism is high. The fragment differences of the 17 STS markers screened by the present invention between the Pennisetum germplasm resources are all>50bp, which is significantly beneficial to agarose electrophoresis separation, shortens the experimental cycle, and is simple and easy to operate, highly operable, economical and practical.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular markers, and in particular relates to a Pennisetum STS molecular marker and application thereof. Background Art

[0002] Pennisetum spp. has been continuously planted in the north and south of my country due to its advantages of good feeding quality, high yield, high resistance to stress and disease, and strong cultivation adaptability. It is currently one of the highest-yielding forage grasses in the world. Currently, there are 17 Pennisetum spp. varieties approved by the National Grass Variety Approval Committee and 6 Pennisetum spp. varieties approved by the Grass Variety Approval Committee of the State Forestry and Grassland Administration. In the past 20 years, the planting area has exceeded 38 million mu, accounting for about 28.4% of the reserved grass planting area in southern my country and 22.3% of the newly added grass planting area. The coverage rate of high-quality varieties of mowing Pennisetum has reached more than 70%. Therefore, it is crucial to improve the supporting variety identification technical procedures, especially the molecular marker identification technical procedures.

[0003] The molecular identification technology of plant varieties is an important auxiliary means of DUS testing and one of the quick ways to enforce variety rights. At present, whether it is American Pennisetum, elephant grass or native Pennisetum and other germplasm resources and their hybrids, the identification still relies on molecular markers such as SSR or RAPD. However, due to the large differences in chromosome numbers and complex genetic colinearity among different species in the genus Pennisetum, the above molecular marker types are only applicable to a specific species in the genus Pennisetum and are almost difficult to amplify in other species in the genus. The current SSR and other molecular marker types are difficult to be compatible with the current situation of different species in the genus Pennisetum, which restricts the accuracy of identification of new varieties among Pennisetum species. Therefore, it is urgent to develop universal molecular markers for the genus Pennisetum.

[0004] The whole genome sequencing and assembly of diploid Pennisetum glaucum was completed in 2018. In 2023, the Chinese scientific research team took the lead in completing the pan-genome analysis of Pennisetum glaucum and published it in the authoritative journal Nature Genetics. At the same time, the Chinese scientific research team has recently taken the lead in completing the genome sequencing and assembly of tetraploid elephant grass Pennisetum purpureum and giant fungus grass Cenchrus fungigraminus. At present, the applicant has not only independently completed the 100× deep sequencing, genome assembly and annotation of Pennisetum glaucum (diploid, 9 chromosomes, 1.92Gbp), elephant grass (allotetraploid, 14 chromosomes, 2.02Gbp), and native Pennisetum (diploid, 9 chromosomes, 846Mbp), but also completed the pan-genome analysis of 17 reference genomes including those published by predecessors, and found that there are a total of 6689 homologous gene families among Pennisetum species, and there are a large number of SV variation sites. Therefore, the homologous sequence variation sites among Pennisetum species discovered using modern molecular genetic techniques provide the possibility for the design and development of universal STS markers.

[0005] The polymorphism of STS loci within the genus Pennisetum is stable and the variation frequency is high, which is suitable for the rapid and accurate identification of new intra- and inter-specific strains. In addition, different species within the genus Pennisetum have obvious differences in different important agronomic traits. Among them, the perennial characteristics of native Pennisetum and other wild Pennisetum that can withstand low temperatures of -30℃ have become important genetic parents in improving the cold resistance of American Pennisetum and elephant grass. New inter-specific seed sources will become the mainstream of new varieties reported in the genus Pennisetum. Therefore, the development of universal molecular markers that can accurately reflect inter-specific differences will provide a guarantee for the accurate identification of unknown new strains.

[0006] Pennisetum has been listed as a key variety in the improved variety breeding system, and the genome sequencing of American Pennisetum, Elephant Grass, and Native Pennisetum has been completed, but the molecular marker identification technical procedures have not yet been formed in the variety identification, which has restricted the rapid identification of new varieties of the genus Pennisetum to a certain extent. This project relies on the latest pan-genome and resequencing data of the genus Pennisetum to find STS sites, develop, design and screen STS markers including American Pennisetum, Elephant Grass, Native Pennisetum, East African Pennisetum and Multi-spike Pennisetum, providing new basis for molecular identification of Pennisetum varieties and variety rights protection. Summary of the invention

[0007] In view of the shortcomings of the prior art, the first object of the present invention is to provide 17 STS marker primers and chromosome physical locations;

[0008] The second object of the present invention is to provide the application of the 17 STS markers mentioned above in Pennisetum germplasm;

[0009] The purpose of the present invention can be achieved through the following technical solutions:

[0010] In the first aspect, the present invention also protects a Pennisetum STS molecular marker, comprising forward and reverse primers corresponding to the following 17 loci, each of which is located on the chromosome as follows: Figure 1 shown.

[0011] WP01 site: Chromosome 01 at 222.17Mbp;

[0012] Upstream primer F: CCCTGTTTGGAGGGTGACTAAA, as shown in SEQ ID No: 1;

[0013] Downstream primer R: AGTCGGTTACAAGGCAGGAGTC, as shown in SEQ ID No:2.

[0014] WP02 site: Chromosome 01 at 227.28Mbp;

[0015] Upstream primer F: GCATATCACAAGCACACGTAGGTATT, as shown in SEQ ID No: 3;

[0016] Downstream primer R: AACTTGAGCAGCATCGTCACCAT, as shown in SEQ ID No:4.

[0017] WP03 site: Chromosome 02, 77.09 Mbp;

[0018] Upstream primer F: ATGCGTGCGAACCTTGGAGC, as shown in SEQ ID No: 5;

[0019] Downstream primer R: ACAGAAGTCGGATGAATCGGTCAAC, as shown in SEQ ID No:6.

[0020] WP04 site: Chromosome 03 at 276.68Mbp;

[0021] Upstream primer F: ATATAGAAGTCTGACACCGAGGTAACC, as shown in SEQ ID No: 7;

[0022] Downstream primer R: GTTGTTCCAAGAATTGCCGCTGTT, as shown in SEQ ID No:8.

[0023] WP05 site: Chromosome 03 at 326.11Mbp;

[0024] Upstream primer F: AGGAGGAGCGTTTGGAGAGG, as shown in SEQ ID No: 9;

[0025] Downstream primer R: CCACATGGGTTTATAGTATCTGCGATT, as shown in SEQ ID No:10.

[0026] WP06 locus: Chromosome 04 at 127.43Mbp;

[0027] Upstream primer F: CTATCTACGCACTGGTGCTGTTACTT, as shown in SEQ ID No: 11;

[0028] Downstream primer R: GGCTTCTTCTGGGAACCTTCATCA, as shown in SEQ ID No:12.

[0029] WP07 site: Chromosome 04 at 128.20Mbp;

[0030] Upstream primer F: CCAGAACAGAAACTTTCAGCATCATTACTC, as shown in SEQ ID No: 13; downstream primer R: AAGGCCGTTCTAGTGGCTTCGAT, as shown in SEQ ID No: 14.

[0031] WP08 locus: Chromosome 04 at 139.16Mbp;

[0032] Upstream primer F: GTTGAAGGTTAGGGTGATGAACTTGG, as shown in SEQ ID No: 15;

[0033] Downstream primer R: CATCAACAGGGCACATGGTTCTTAA, as shown in SEQ ID No:16.

[0034] WP09 locus: Chromosome 05 at 11.094Mbp;

[0035] Upstream primer F: CCATCGGTTCTCTGCTCCTCTATCT, as shown in SEQ ID No: 17;

[0036] Downstream primer R: CACTTGGCGTGGAAAGCAAAGC, as shown in SEQ ID No:18.

[0037] WP10 locus: Chromosome 05 at 36.13Mbp;

[0038] Upstream primer F: AAGATGCCACAGTGAACAAGAGACAA, as shown in SEQ ID No: 19;

[0039] Downstream primer R: CGCTCAGACTTCCTAACACTCATTCC, as shown in SEQ ID No: 20.

[0040] WP11 locus: Chromosome 05 at 42.64Mbp;

[0041] Upstream primer F: TTCCGCTTCAACGACGCCATG, as shown in SEQ ID No: 21;

[0042] Downstream primer R: GGTCCAGATCCAACCACCATATCTACTA, as shown in SEQ ID No: 22.

[0043] WP12 locus: Chromosome 05, 161.90 Mbp;

[0044] The upstream primer F is GCGAAGAAAGTCATATAAATTACCTCCAGG, as shown in SEQ ID No: 23; the downstream primer R is CTTGCACGAAGTCAGTCACCTTACT, as shown in SEQ ID No: 24.

[0045] WP13 locus: Chromosome 06, 5.11 Mbp;

[0046] Upstream primer F: TGCTTCGAGGCAACATGATTCTGAA, as shown in SEQ ID No: 25;

[0047] Downstream primer R: GATGCTTGGAGAGTGGAATGCTACA, as shown in SEQ ID No: 26.

[0048] WP14 locus: Chromosome 06, 177.33 Mbp;

[0049] Upstream primer F: TCACAGTAATGCTCGGATTAACTTGAGG, as shown in SEQ ID No: 27; downstream primer R: GTGAATGAATGGTAAGTGTGGTGGTAGTA, as shown in SEQ ID No: 28.

[0050] WP15 locus: Chromosome 06, 254.17 Mbp;

[0051] Upstream primer F: GGTGCCGCTCCTCCTGAAAT, as shown in SEQ ID No: 29;

[0052] Downstream primer R: GCTCTATTTAACCACAATGTAACTGGG, as shown in SEQ ID No:30.

[0053] WP16 locus: Chromosome 07 at 17.45Mbp;

[0054] Upstream primer F: TCGGCTGCCGGACACTGAAT, as shown in SEQ ID No: 31;

[0055] Downstream primer R: TTGGAGGTACTGCTGAGGAGGATG, as shown in SEQ ID No:32.

[0056] WP17 locus: Chromosome 07 at 254.99 Mbp;

[0057] Upstream primer F: TGGCTATCAAATGGCACAACGAATT, as shown in SEQ ID No: 33;

[0058] Downstream primer R: TGCTAAACAACCTCCACAAACAGAAG, as shown in SEQ ID No:34.

[0059] In a second aspect, the present invention also protects the use of the Pennisetum STS molecular marker described above or a substance for detecting the Pennisetum STS molecular marker described above in the following (A1)-(A6):

[0060] (A1) Application in the study of genetic diversity in Pennisetum germplasm;

[0061] (A2) Application in the construction of genetic linkage map of Pennisetum;

[0062] (A3) Application in hybrid / purity identification of Pennisetum;

[0063] (A4) Application in the localization of genes associated with important agronomic traits in Pennisetum;

[0064] (A5) Application in breeding or assisting breeding of Pennisetum;

[0065] (A6) Application in breeding or assisted breeding.

[0066] In a specific embodiment, the substance is selected from the following (B1) or (B2);

[0067] (B1) primers for detecting the Pennisetum STS molecular marker, wherein the primers are shown in SEQ ID Nos: 1 to 34;

[0068] (B2) a detection reagent containing the primers in (B1);

[0069] (B3) A kit comprising the primer described in (B1) or the reagent described in (B2).

[0070] In a third aspect, the present invention also protects the primers described above, and reagents or kits containing the primers described above.

[0071] In a fourth aspect, the present invention also protects the primers described above, and the use of reagents or kits containing the primers described above in the study of genetic diversity in Pennisetum germplasm.

[0072] The differences in the bands of 17 STS markers among 12 representative Pennisetum accessions are shown in Figure 2. Figure 2 The differences in fragments between different germplasms were all >50 bp, which was significantly beneficial for agarose electrophoresis separation. The genetic diversity of 136 Pennisetum germplasms was analyzed using 17 markers, and the obtained genetic matrix was subjected to PCO analysis, as shown in Figure 1. Figure 3 Different Pennisetum germplasm resources were significantly separated in PCO.

[0073] In the fifth aspect, the present invention also protects the primers described above, reagents or kits containing the primers described above, their use in the construction of a genetic linkage map of the genus Pennisetum, their use in hybrid / purity identification of the genus Pennisetum, and their use in the localization of genes related to important agronomic traits of the genus Pennisetum and molecular-assisted selection breeding.

[0074] In the sixth aspect, the present invention protects a method for identification or auxiliary identification among species of the genus Pennisetum, which uses the primers described above to perform PCR amplification on the Pennisetum DNA to be tested, uses agarose electrophoresis to distinguish the differences in allele fragments, and obtains an allele matrix constructed with 17 primer sets, which can quickly and accurately distinguish the genetic differences between and within species within the genus Pennisetum.

[0075] In the seventh aspect, the present invention protects a method for breeding or assisting in breeding Pennisetum, which uses the primer set described above to perform PCR amplification on the Pennisetum DNA to be tested, uses agarose electrophoresis to distinguish the differences in allele fragments, and obtains an allele matrix constructed with 17 primer sets, which can quickly and accurately distinguish the genetic differences between and within species within the Pennisetum genus.

[0076] In an eighth aspect, the present invention protects a method for studying genetic diversity in Pennisetum germplasm, using the primers described above to perform PCR amplification on the Pennisetum DNA to be tested, using agarose electrophoresis to distinguish differences in allele fragments, and obtaining an allele matrix constructed with 17 primer sets, which can quickly and accurately distinguish genetic differences between and within species within the Pennisetum genus.

[0077] In the ninth aspect, the present invention protects a method for molecular breeding or molecular-assisted breeding of Pennisetum, which uses the primers described above to perform PCR amplification on the Pennisetum DNA to be tested, uses agarose electrophoresis to distinguish the differences in allele fragments, and obtains an allele matrix constructed with 17 primer sets, which can quickly and accurately distinguish the genetic differences between and within species within the Pennisetum genus.

[0078] Beneficial Effects

[0079] The STS marker screened by the present invention was amplified in American Pennisetum, elephant grass, hybrid Pennisetum, native Pennisetum, East African Pennisetum and multi-spike Pennisetum germplasm within the Pennisetum genus, and is a universal marker within the Pennisetum genus, breaking the current situation of interspecies incompatibility of previous molecular marker types, and especially providing a new basis for identifying new interspecies hybridization germplasm.

[0080] The actual MAF values ​​of the 17 STS markers screened by the present invention in 136 germplasm resources were all greater than 10%, and the polymorphism was high.

[0081] The fragment differences of the 17 STS markers screened by the present invention among Pennisetum germplasm resources are all greater than 50 bp, which is significantly beneficial to agarose electrophoresis separation, shortens the experimental cycle, is simple and easy to operate, has strong operability, and is economical and practical. BRIEF DESCRIPTION OF THE DRAWINGS

[0082] Figure 1 This is the distribution position of 17 high-frequency STS markers of Pennisetum on chromosomes.

[0083] Figure 2 The results of electrophoresis of 17 high-frequency STS markers of Pennisetum are shown in Figure 1. The Pennisetum germplasms are American Pennisetum 'Ningza 4', American Pennisetum 'Late-maturing Pennisetum', hybrid Pennisetum 'Tift23A×N51', hybrid Pennisetum 'Sumu 4', elephant grass 'N51', elephant grass 'Sumu 2', native Pennisetum 'Lingshan', native Pennisetum 'Liqiu', East African Pennisetum 'Whittet' and multi-spike Pennisetum. Among them, hybrid Pennisetum 'Sumu 4' and elephant grass 'Sumu 2' were replaced with 'Minmu 6' and 'Guiminyinxiangcao' in the WP05 marker electrophoresis.

[0084] Figure 3The genetic diversity of 136 accessions of Pennisetum was analyzed using 17 high-frequency STS markers. The PCO analysis results of the genetic matrix included American Pennisetum, elephant grass, hybrid Pennisetum, native Pennisetum, East African Pennisetum and multi-spike Pennisetum accessions. DETAILED DESCRIPTION

[0085] The present invention is further described in detail below with reference to the examples. The reagents or instruments used without indicating the manufacturer are all regarded as conventional products that can be purchased on the market.

[0086] (1) Extraction of DNA from Pennisetum germplasm

[0087] The young leaves of 136 Pennisetum accessions at the six-leaf stage were chopped and transferred into a 2.0 mL centrifuge tube. Three zirconium oxide grinding beads and 500 μL of extraction solution [2 M NaCl, 20 mM EDTA, 100 mM Tris-HCl (pH = 8.0)] were added. The sample was ground at 80 Hz for 2 min. After grinding three times, CTAB lysis solution [6% CTAB, 2 M NaCl, 20 mM EDTA, 100 mM Tris-HCl (pH = 8.0)], fully mixed and placed in a 65 ° C water bath for 1h, cooled to room temperature, added 1ml chloroform and inverted to mix, centrifuged at 10000r / min for 10min at room temperature, took 800μL of supernatant and transferred it to a 1.5ml centrifuge tube, added 1ml pre-cooled anhydrous ethanol, stood at -20 ° C overnight, centrifuged at 12000r / min for 10min, discarded the supernatant, washed the DNA precipitate 3 times with 75% ethanol, and washed the DNA precipitate once with anhydrous ethanol. Dry at room temperature, add an appropriate amount of TE solution or ddH2O, and use NanoDrop (Eppendorf) to determine the DNA concentration and quantify after fully dissolving, and store at -20 ° C.

[0088] (2) Preparation of DNA from a mixed pool of Pennisetum germplasm

[0089] After taking equal volumes of single germplasm DNA with a mother solution concentration of 200 ng / μL, 12 germplasm DNAs were randomly mixed in a centrifuge tube to form a mixed pool DNA sample. A total of 12 mixed pool DNA samples were obtained from 136 germplasms and stored at -20°C.

[0090] (3) Design of STS markers for Pennisetum genome

[0091] Based on the pan-genome PAV differences of 10 Pennisetum fasciatum (http: / / milletdb.novogene.com / reseq / variation / ), 681 high-frequency SV sites with CDS sequence variation sizes ranging from 100 to 2000 bp with MAF>0.4 were screened, and 350 pairs of STS marker primers were designed using Primer Premier 6.0 software. Primer design conditions: PCR amplification product length of 150-500 bp; denaturation temperature (Tm) between 57-63℃, with 60℃ as the best; primer length of 18-30 bp, with 20 bp as the best. The 350 markers covering 7 chromosomes of Pennisetum fasciatum were screened for polymorphism analysis in 12 mixed pools of DNA.

[0092] (4) Screening of high-frequency STS markers

[0093] PCR was performed on 12 pooled DNA samples using the synthesized primers. The PCR amplification reaction system was 20 μL, which contained 2.0 μL genomic DNA (20 ng / μL), 8.6 μL 2×Rapid Taq Master Mix (Novozyme, P222-AA), 8.6 μL sterile water, 0.4 μL forward primer (10 μM), and 0.4 μL reverse primer (10 μM). The PCR amplification program was as follows: 95°C pre-denaturation for 3 min; 95°C denaturation for 15 sec, Tm annealing at 60°C for 15 sec, each cycle of 0.5°C down to 50°C, 72°C extension for 20 sec, 95°C denaturation for 15 sec, Tm annealing at 50°C for 15 sec, 72°C extension for 20 sec for 40 cycles; 72°C extension for 5 min, and storage at 4°C. The PCR products of the 12 pooled DNAs were mixed into a centrifuge tube. Weigh 4g agarose (Toroivd), add 100mL 1×TAE electrophoresis buffer [12.2g Tris, 2.85mL glacial acetic acid, 10mL 0.25mol / L EDTA (PH 8.0)], heat and dissolve to make 100mL of 4.0% agarose gel. Add 3μL nucleic acid dye (Warbio, M0754) and mix well; install the electrophoresis tank and sample comb, pour the gel, wait for the gel to cool and solidify, and pour 1×TAE electrophoresis buffer into the electrophoresis tank. Take 6μL of PCR mixed product and spot it into the spotting hole. Use an electrophoresis instrument (Beijing Liuyi, DYY-6C model) to connect the electrodes and perform electrophoresis at a constant voltage of 60V until the amplified DNA band is fully developed. PCR verification shows that there are 17 pairs of STS primers with MAF>10%, and the primer sequences are shown in the sequence table SEQ ID NO: 1-SEQID NO: 34.

[0094] (5) Analysis of genetic diversity of Pennisetum germplasm using high-frequency STS markers

[0095] The 17 high-frequency STS markers screened above were used to perform PCR analysis on the DNA of 136 germplasms one by one. The bands in the agarose electrophoresis results were read, and all the bands of each STS primer site were numbered in order from small to large amplified fragments, and described with a two-digit code. The allelic variation data of the homozygous site was recorded as X / X, where X is the code of the band at the site; the allelic variation data of the heterozygous site was recorded as X / Y, where X and Y are two different bands at the site. The small fragment is in front and the large fragment is in the back. Invalid allelic variation is recorded as 0 / 0. The MAF value of each marker was calculated, as shown in Table 1. The genetic matrix of the above germplasms was analyzed using GenAlEx software and PCO analysis was performed, as shown in Table 1. Figure 3 Different Pennisetum germplasm resources were significantly separated in PCO.

[0096] Table 1. MAF values ​​of Pennisetum STS markers in 136 germplasm resources.

[0097] serial number MAF serial number MAF serial number MAF WP01 22.8％ WP07 28.7％ WP13 11.8％ WP02 14.0％ WP08 19.1％ WP14 25.0％ WP03 46.3％ WP09 10.3％ WP15 10.3％ WP04 16.9％ WP10 10.3％ WP16 18.4％ WP05 10.3％ WP11 16.2％ WP17 11.8％ WP06 14.0％ WP12 15.4％

[0098] The protection content of the present invention is not limited to the above embodiments. Without departing from the spirit and scope of the inventive concept, changes and advantages that can be thought of by those skilled in the art are included in the present invention and are protected by the attached claims.

Claims

1. A Pennisetum STS molecular marker primer set, characterized in that: The primer set has forward and reverse primers corresponding to the following 17 sites: WP01 locus: Chromosome 01 at 222.17 Mbp; Upstream primer F: CCCTGTTTGGAGGGTGACTAAA, as shown in SEQ ID No: 1; Downstream primer R: AGTCGGTTACAAGGCAGGAGTC, as shown in SEQ ID No: 2; WP02 locus: Chromosome 01 at 227.28 Mbp; Upstream primer F: GCATATCACAAGCACACGTAGGTATT, as shown in SEQ ID No: 3; Downstream primer R: AACTTGAGCAGCATCGTCACCAT, as shown in SEQ ID No: 4; WP03 locus: Chromosome 02 at 77.09 Mbp; Upstream primer F: ATGCGTGCGAACCTTGGAGC, as shown in SEQ ID No: 5; Downstream primer R: ACAGAAGTCGGATGAATCGGTCAAC, as shown in SEQ ID No: 6; WP04 locus: Chromosome 03 at 276.68 Mbp; Upstream primer F: ATATAGAAGTCTGACACCGAGGTAACC, as shown in SEQ ID No: 7; Downstream primer R: GTTGTTCCAAGAATTGCCGCTGTT, as shown in SEQ ID No: 8; WP05 locus: Chromosome 03 at 326.11 Mbp; Upstream primer F: AGGAGGAGCGTTTGGAGAGG, as shown in SEQ ID No: 9; Downstream primer R: CCACATGGGTTTATAGTATCTGCGATT, as shown in SEQ ID No: 10; WP06 locus: Chromosome 04 at 127.43 Mbp; Upstream primer F: CTATCTACGCACTGGTGCTGTTACTT, as shown in SEQ ID No: 11; Downstream primer R: GGCTTCTTCTGGGAACCTTCATCA, as shown in SEQ ID No: 12; WP07 locus: Chromosome 04 at 128.20 Mbp; Upstream primer F: CCAGAACAGAAACTTTCAGCATCATTACTC, as shown in SEQ ID No: 13; Downstream primer R: AAGGCCGTTCTAGTGGCTTCGAT, as shown in SEQ ID No: 14; WP08 locus: Chromosome 04 at 139.16 Mbp; Upstream primer F: GTTGAAGGTTAGGGTGATGAACTTGG, as shown in SEQ ID No: 15; Downstream primer R: CATCAACAGGGCACATGGTTCTTAA, as shown in SEQ ID No: 16; WP09 locus: Chromosome 05 at 11.094 Mbp; Upstream primer F: CCATCGGTTCTCTGCTCCTCTATCT, as shown in SEQ ID No: 17; Downstream primer R: CACTTGGCGTGGAAAGCAAAGC, as shown in SEQ ID No: 18; WP10 locus: Chromosome 05 at 36.13 Mbp; Upstream primer F: AAGATGCCACAGTGAACAAGAGACAA, as shown in SEQ ID No: 19; Downstream primer R: CGCTCAGACTTCCTAACACTCATTCC, as shown in SEQ ID No: 20; WP11 locus: Chromosome 05 at 42.64 Mbp; Upstream primer F: TTCCGCTTCAACGACGCCATG, as shown in SEQ ID No: 21; Downstream primer R: GGTCCAGATCCAACCACCATATCTACTA, as shown in SEQ ID No: 22; WP12 locus: Chromosome 05 at 161.90 Mbp; Upstream primer F: GCGAAGAAAGTCATATAAATTACCTCCAGG, as shown in SEQ ID No: 23; Downstream primer R: CTTGCACGAAGTCAGTCACCTTACT, as shown in SEQ ID No: 24; WP13 locus: Chromosome 06, 5.11 Mbp; Upstream primer F: TGCTTCGAGGCAACATGATTCTGAA, as shown in SEQ ID No: 25; Downstream primer R: GATGCTTGGAGAGTGGAATGCTACA, as shown in SEQ ID No: 26; WP14 locus: Chromosome 06 at 177.33 Mbp; Upstream primer F: TCACAGTAATGCTCGGATTAACTTGAGG, as shown in SEQ ID No: 27; Downstream primer R: GTGAATGAATGGTAAGTGTGGTGGTGGTAGTA, as shown in SEQ ID No: 28; WP15 locus: Chromosome 06 at 254.17 Mbp; Upstream primer F: GGTGCCGCTCCTCCTGAAAT, as shown in SEQ ID No: 29; Downstream primer R: GCTCTATTTAACCACAATGTAACTGGG, as shown in SEQ ID No: 30; WP16 locus: Chromosome 07 at 17.45 Mbp; Upstream primer F: TCGGCTGCCGGACACTGAAT, as shown in SEQ ID No: 31; Downstream primer R: TTGGAGGTACTGCTGAGGAGGATG, as shown in SEQ ID No: 32; WP17 locus: Chromosome 07 at 254.99 Mbp; Upstream primer F: TGGCTATCAAATGGCACAACGAATT, as shown in SEQ ID No: 33; Downstream primer R: TGCTAAACAACCTCCACAAACAGAAG, as shown in SEQ ID No:

34.

2. A reagent comprising the primer set according to claim 1.

3. A kit comprising the primer set according to claim 1 or the reagent according to claim 2.

4. Application of the substance for detecting the STS molecular marker of Pennisetum in the following (A1)-(A3): (A1) Application in the construction of genetic linkage map of Pennisetum; (A2) Application in identification or auxiliary identification of Pennisetum species; (A3) Application in molecular breeding or molecular-assisted breeding of Pennisetum; The substance for detecting Pennisetum STS molecular markers contains the primer set according to claim 1.

5. The use according to claim 4, characterized in that: The substance is selected from the following (B1) or (B2); (B1) a detection reagent comprising the primer set according to claim 1; (B2) A kit comprising the primer set according to claim 1 or the reagent according to (B1).

6. A method for identification or auxiliary identification among Pennisetum species, characterized in that: The primer set described in claim 1 is used to perform PCR amplification on the Pennisetum DNA to be tested, and agarose electrophoresis is used to distinguish the differences in allele fragments, so as to obtain an allele matrix constructed by 17 primer sets, and the genetic differences between and within species within the Pennisetum genus are quickly and accurately distinguished.

7. A method for molecular breeding or molecular-assisted breeding of Pennisetum, characterized in that: The primer set described in claim 1 is used to perform PCR amplification on the Pennisetum DNA to be tested, and agarose electrophoresis is used to distinguish the differences in allele fragments, so as to obtain an allele matrix constructed by 17 primer sets, and the genetic differences between and within species within the Pennisetum genus are quickly and accurately distinguished.

Images