A method for accurate quantitative detection of bovine, porcine, chicken and duck-derived components in meat products based on real-time fluorescent PCR and application

By utilizing real-time fluorescence PCR technology and the application of single-copy nuclear genome genes, the problem of quantitative detection of beef, pork, chicken, and duck-derived components in meat products has been solved. This has enabled highly specific and accurate absolute quantitative detection, identifying adulteration in commercial meat products and promoting the healthy development of the meat product industry.

CN117604117BActive Publication Date: 2025-11-11INST OF REMOTE SENSING APPL SICHUAN ACAD OF AGRI SCI
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202311380109.8
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-10-23
Publication Date
2025-11-11
Estimated Expiration
2043-10-23

AI Technical Summary

Technical Problem

Existing technologies cannot accurately and quickly quantify the source components of beef, pork, chicken, and duck in meat products, making it difficult to detect adulterated meat, distinguish between malicious adulteration and unintentional contamination, and affecting the healthy development of the meat product industry.

Method used

Using real-time fluorescence PCR technology, specific primers and probes were designed and combined with single-copy genes from the nuclear genome to establish an absolute quantitative detection method. The percentage content of animal-derived components in the test sample was calculated by real-time fluorescence PCR amplification and Ct value analysis.

Benefits of technology

It enables precise quantitative detection of components derived from cattle, pigs, chickens, and ducks, with high specificity and accuracy. The limits of quantification and detection reach 0.1%, which meets the EU standard ENGL. It can identify adulteration in commercial meat products and promote the healthy development of the industry.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117604117B_ABST
    Figure CN117604117B_ABST
Patent Text Reader

Abstract

The application discloses a method for accurately quantitatively detecting bovine, porcine, chicken and duck-derived components in meat food based on real-time fluorescent PCR and application, and comprises the following steps: (1) designing upstream primers, downstream primers and probes of bovine, porcine, chicken and duck marker genes; (2) extracting DNA of bovine, porcine, chicken and duck standard substances and test samples respectively; (3) gradient diluting bovine, porcine, chicken and duck standard substance DNA extracted in the step (2), drawing bovine, porcine, chicken and duck standard curves, and fitting standard curve equations y=ax+b; (4) taking DNA of the test sample extracted in the step (2) as a template to perform real-time fluorescent PCR amplification; calculating the copy number of each animal-derived marker gene according to the standard curve equation in the step (3); and (5) calculating the percentage content of the animal-derived components according to the formula:
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of testing and inspection technology, specifically to a method and application for the precise quantitative detection of beef, pork, chicken, and duck-derived components in meat products. More specifically, this application provides a method and application for the precise quantitative detection of pork, chicken, and duck-derived components in beef products based on real-time fluorescence PCR. Background Technology

[0002] As people's living standards continue to improve and they pursue healthy eating, the structure of human meat consumption is gradually changing, with a significant increase in the consumption of beef and mutton, which are high in protein, low in fat, and low in cholesterol.

[0003] Currently, the detection standards for adulteration in the meat industry only include qualitative methods, which cannot distinguish between malicious adulteration and unintentional contamination. During the production, transportation, and storage of meat products, different types of meat come into contact with each other, share processing tools, and share production lines. Contaminated meat products are defined as "adulterated meat." No methods have been reported for simultaneously quantitatively detecting pork, chicken, and duck-derived components in beef products. Therefore, there is an urgent need to establish a stable, accurate, and rapid quantitative detection method that can precisely quantify the content of pork, chicken, and duck-derived components in beef products. This would provide law enforcement agencies with more accurate test results, ensuring no false positives or omissions, and promoting the healthy development of the meat product industry. Summary of the Invention

[0004] The purpose of this invention is to provide a real-time fluorescence PCR quantitative detection method and its application for beef, pork, chicken, and duck-derived components in meat products. This method can quantify the content of pork, chicken, and duck-derived components in beef products, distinguish between malicious adulteration and unintentional contamination, combat meat adulteration, and promote the healthy development of the meat product industry.

[0005] To achieve the above objectives, the present invention adopts the following technical solution:

[0006] A method for accurate quantitative detection of beef, pork, chicken, and duck-derived components in meat products using real-time fluorescence PCR, characterized by comprising the following steps:

[0007] (1) Design upstream primers, downstream primers and probes for marker genes in cattle, pigs, chickens and ducks.

[0008] (2) Extract DNA from standard substances and test samples from cattle, pigs, chickens, and ducks respectively;

[0009] (3) Dilute the standard DNA extracted in step (2) and prepare a series of standard solutions with copy number concentration gradients. Use the standard solutions as templates for real-time fluorescence PCR amplification, measure the Ct value of each standard solution, and plot the standard curves for cattle, pigs, chickens and ducks: y = ax + b, where y is the Ct value of the test sample, a is the slope of the standard curve, x is the logarithm of the template copy number to the base 10, and b is the intercept of the standard curve.

[0010] (4) Using the DNA extracted from the test sample in step (2) as a template, perform real-time fluorescent PCR amplification; obtain the Ct value of the test sample, and calculate the copy number of bovine, pig, chicken and duck marker genes in the test sample according to the standard curve drawn in step (3);

[0011] (5) According to the formula Calculate the percentage content of animal-derived components in the test sample, where C is the percentage content of the animal component to be tested in the test sample, Nd is the copy number of the animal marker gene to be tested in the test sample, and Nz is the sum of the copy numbers of all animal marker genes in the test sample.

[0012] In one embodiment, in steps (3) and (4), the amplification primers and probes for the real-time fluorescent PCR are:

[0013] Bos upstream primer Bos-F: CCCTCGCCCGCATTG;

[0014] Bos downstream primer Bos-R: AGCGACAGGTCAAGGGAGTCA;

[0015] Bovine probe Bos-P: VIC-CAGCTCAACTCTTAGCC-BHQ1;

[0016] The upstream primer for pigs, Sus-F: GCAAGGCCAGGGATCGA;

[0017] Downstream primer for pigs, Sus-R: AGCAGAAACCAGCCATGGATT;

[0018] The probe for pigs, Sus-P: FAM-CCGCGTCCTCATGG-BHQ1;

[0019] Chicken upstream primer Gal-F: CGTCCCTCACTTCCATATTGATG;

[0020] Chicken downstream primer Gal-R: ATCTTCACTGTCAATGCCTTCACA;

[0021] Chicken probe Gal-P: Cy5-CCTCTTTGTGGATCCTGT-BHQ3;

[0022] The upstream primer for ducks, Ana-F: CAGTCCCCCCTGCCTAGGA;

[0023] Downstream primer for duck, Ana-R: TCAGTGTACAGGTAGCCCCTCTCT;

[0024] The duck probe Ana-P: Texas-AAGTGCCAGTATGCGGG-BHQ2.

[0025] Preferably, in steps (3) and (4), the real-time fluorescence PCR reaction system of the bovine is: 12.5 μL of qPCR TaqManProbe Master Mix, 1.0 μL each of Bos-F and Bos-R primers, 0.6 μL of Bos-P probe, 2 μL of DNA template, and ddH2O to make up to 25 μL.

[0026] Preferably, in steps (3) and (4), the real-time fluorescence PCR reaction system for pigs is: 12.5 μL of qPCR TaqManProbe Master Mix, 1.0 μL each of Sus-F and Sus-R primers, 0.6 μL of Sus-P probe, 2 μL of DNA template, and ddH2O to make up to 25 μL.

[0027] Preferably, in steps (3) and (4), the real-time fluorescence PCR reaction system for chicken is: 12.5 μL of qPCR TaqManProbe Master Mix, 1.0 μL each of Gal-F and Gal-R primers, 0.6 μL of Gal-P probe, 2 μL of DNA template, and ddH2O to make up to 25 μL.

[0028] Preferably, in steps (3) and (4), the real-time fluorescence PCR reaction system for the duck is: 12.5 μL of qPCR TaqManProbe Master Mix, 1.0 μL each of Ana-F and Ana-R primers, 0.6 μL of Ana-P probe, 2 μL of DNA template, and ddH2O to make up to 25 μL.

[0029] Preferably, in steps (3) and (4), the real-time fluorescence PCR reaction conditions are: first stage 95℃, 5min; second stage 95℃, 10s, 62℃, 30s, with a cycle number of 40; fluorescence signal is collected during the annealing extension period of the second stage.

[0030] In one embodiment, the present invention provides an application of a real-time fluorescence PCR quantitative detection method for beef, pork, chicken, and duck-derived components in meat products.

[0031] In one embodiment, the present invention provides a kit, characterized in that the kit comprises primers and probes.

[0032] In one embodiment, the primers and probes are used in the preparation of a kit for real-time fluorescence PCR quantitative detection of beef, pork, chicken, and duck-derived components in meat products.

[0033] In summary, this invention establishes a highly specific, accurate, and sensitive method for the quantitative detection of beef, pork, chicken, and duck-derived components in meat products using single-copy nuclear genome marker genes. The limits of quantification (LOQ) for beef, pork, chicken, and duck are all 0.1%, and the limits of detection (LODs) are 5, 5, 5, and 10 copies, respectively. Applying this method to the quantitative detection of meat components in 34 commercial meat products, and comparing the results with label information, it was found that some qualitatively labeled beef products contained extremely low or no beef content, and unlabeled meat components were detected; a very small number of quantitatively labeled beef products did not reach the labeled beef content.

[0034] Compared with the prior art, the present invention has the following beneficial effects:

[0035] 1. The marker genes of this invention are single-copy genes from the bovine, porcine, chicken, and duck nuclear genomes: tumor necrosis factor receptor superfamily member 10A (TNFRSF10A), prion protein (PRNP), transforming growth factor beta 3 (TF-GB3), and beta-actin. These single-copy nuclear genome genes exist singly in the animal cell nucleus, and the copy number of the marker genes can represent the number of animal cells. Most existing technologies use mitochondrial genes as marker genes. However, the number of mitochondria varies greatly in animal cells, and quantitative detection methods established using mitochondrial genes as marker genes have poor accuracy.

[0036] 2. The real-time fluorescence PCR method for precise quantitative detection of beef, pork, chicken and duck-derived components in meat products established in this invention is based on Taqman probes, which have higher specificity than dye methods.

[0037] 3. The real-time fluorescence PCR method for precise quantitative detection of beef, pork, chicken, and duck-derived components in meat products established in this invention is an absolute quantitative method, while most existing technologies are relative quantitative methods. The absolute quantitative method does not rely on internal reference genes; it performs absolute quantification of the copy number of meat-derived marker genes in each animal being tested, enabling precise detection in foods with either single or complex meat components.

[0038] 4. Compared with existing technologies, this invention has undergone specificity, accuracy, limit of quantitation, and limit of detection tests according to EU standard ENGL, 2015. The test results show that this invention has high specificity, high accuracy, and high sensitivity. Quantitative detection of commercial meat products demonstrates that the method of this invention can quantify the content of pork, chicken, and duck-derived components in beef products, providing technical support for the healthy development of the meat product industry. Attached Figure Description

[0039] The present invention will be described by way of example and with reference to the accompanying drawings, wherein:

[0040] Figure 1 This is a diagram showing the specificity test results of the primers and probes in Example 1.

[0041] Figure 2 The standard curve and amplification graph are shown in Example 1. Detailed Implementation

[0042] All features disclosed in this specification, or all steps in all disclosed methods or processes, may be combined in any way, except for mutually exclusive features and / or steps.

[0043] Any feature disclosed in this specification, unless otherwise stated, may be replaced by other equivalent or similar features. That is, unless otherwise stated, each feature is merely one example of a series of equivalent or similar features.

[0044] (I) Implementation Examples

[0045] 1. Example Experimental Materials

[0046] 1.1 Standard Reference Materials

[0047] Cows, pigs, sheep, chickens, ducks, horses, dogs, donkeys, and sika deer.

[0048] 1.2 Commercial Meat Products

[0049] Cats, geese, deer, minks, pigeons, quails, carp, prawns, eels, bullfrogs, steaks, braised beef, beef balls, beef rolls, ham sausages, luncheon meat, bacon, chicken thighs, chicken breasts, chicken sausages, duck wings, duck necks, and duck legs.

[0050] 1.3 Laboratory Preparation

[0051] Twenty-six reference samples were prepared by mixing plant mixtures, microbial mixtures, and standard DNA from beef, pork, chicken, and duck meat in the following copy number ratios: A1 (50% beef, 50% pork), A2 (90% beef, 10% pork), A3 (95% beef, 5% pork), A4 (99% beef, 1% pork), A5 (99.5% beef, 0.5% pork), A6 (99.9% beef, 0.1% pork), A7 (50% beef, 50% chicken), A8 (90% beef, 10% chicken), A9 (95% beef, 5% chicken), A10 (99% beef, 1% chicken), A1... A11 (99.5% beef, 0.5% chicken), A12 (99.9% beef, 0.1% chicken), A13 (50% beef, 50% duck), A14 (90% beef, 10% duck), A15 (95% beef, 5% duck), A16 (99% beef, 1% duck), A17 (99.5% beef, 0.5% duck), A18 (99.9% beef, 0.1% duck), A19 (40% beef, 30% pork, chicken) A20 (beef 25%, pork 25%, chicken 25%, duck 25%), A21 (pork 40%, chicken 30%, duck 30%), A22 (chicken 50%, duck 50%), Q1 (beef 0.1%, pork 39.9%, chicken 10%, duck 50%), Q2 (pork 0.1%, beef 99.9%), Q3 (chicken 0.1%, beef 99.9%), Q4 (duck 0.1%, beef 99.9%). Four reference samples were prepared from standard DNA reference materials of beef, pork, chicken, and duck, according to copy number concentration: D1 (20 copies / μL for beef, 20 copies / μL for pork, 20 copies / μL for chicken, and 20 copies / μL for duck), D2 (10 copies / μL for beef, 10 copies / μL for pork, 10 copies / μL for chicken, and 10 copies / μL for duck), D3 (5 copies / μL for beef, 5 copies / μL for pork, 5 copies / μL for chicken, and 5 copies / μL for duck), and D4 (1 copy / μL for beef, 1 copy / μL for pork, 1 copy / μL for chicken, and 1 copy / μL for duck).

[0052] 2. Example Experimental Method

[0053] 2.1 DNA Extraction and Purification

[0054] 2.1.1 Animal DNA Extraction and Purification

[0055] Genomic DNA was extracted from animals using a rapid whole blood tissue cell genomic DNA extraction kit (from Beijing Adley Biotechnology Co., Ltd.). The specific steps were performed according to the kit instructions with slight modifications, as follows:

[0056] (1) Take 20-50 mg of animal tissue, grind it into powder with liquid nitrogen, transfer it into a centrifuge tube containing 360 μL of tissue lysis buffer TL, and mix thoroughly.

[0057] (2) Add 40 μL of proteinase K solution (20 mg / mL) and vortex to mix.

[0058] (3) Place the centrifuge tubes in a 55°C water bath until the tissue is completely digested, and gently shake them once every 1 hour during the water bath.

[0059] (4) Add 400 μL of binding solution CB, vortex to mix, and then place in a 70°C water bath for 10 min.

[0060] (5) After cooling, add 200 μL of isopropanol and vortex to mix. At this time, flocculent precipitate may appear.

[0061] (6) Transfer the mixture into the adsorption column AC, centrifuge at 13000 rpm for 60 s, and discard the waste liquid in the collection tube.

[0062] (7) Add 500 μL of inhibitor removal solution IR, centrifuge at 12000 rpm for 30 s, and discard the waste liquid in the collection tube;

[0063] (8) Rinse twice, adding 600 μL of rinsing solution WB each time, centrifuge at 12000 rpm for 30 s, and discard the waste liquid in the collection tube.

[0064] (9) Place the adsorption column AC into an empty collection tube and centrifuge at 13000 rpm for 2 min to remove as much of the washing solution as possible.

[0065] (10) Take out the adsorption column AC and put it into a clean centrifuge tube. Add 120 μL of elution buffer EB to the middle part of the adsorption column, place at room temperature for 3-5 min, and centrifuge at 12000 rpm for 1 min.

[0066] 2.1.2 Plant DNA Extraction and Purification

[0067] According to the plant genomic DNA purification kit ( The product manual from Tiangen Biotech (Beijing) Co., Ltd. describes the separation and purification of genomic DNA.

[0068] 2.1.3 Microbial DNA Extraction and Purification

[0069] According to the microbial genomic DNA purification kit ( The product manual from Tiangen Biotech (Beijing) Co., Ltd. describes the separation and purification of genomic DNA.

[0070] 2.1.4 DNA Concentration and Purity Determination

[0071] The concentration and purity of the extracted DNA were measured using an ultra-micro UV spectrophotometer. The DNA purity requirements were: 1.8 ≤ 260 / 280 ≤ 2.0 and 260 / 230 ≥ 2. Based on the measured DNA concentration values, the DNA was diluted to a working concentration of 50 ng / μL for later use.

[0072] 2.1.5 Real-time fluorescence PCR reaction system and reaction conditions

[0073] The real-time fluorescence PCR reaction system is shown in Table 1. The real-time fluorescence PCR reaction conditions were: first stage 95℃, 5 min; second stage 95℃, 10 s, 62℃, 30 s, with a cycle number of 40. Fluorescence signals were collected during the annealing extension period of the second stage.

[0074] Table 1 Real-time quantitative PCR reaction system

[0075]

[0076]

[0077] In Table 1, the notes are as follows: 1. The reaction system may be adjusted appropriately according to instrument requirements. "-" indicates that the volume is uncertain. Determine the volume based on the final concentration of the TaqMan reaction solution and adjust the volume of ddH2O accordingly to achieve a total reaction volume of 25.0 μL. 2. If using a real-time fluorescence PCR kit, prepare the reaction system according to the recommended dosage of the kit, but follow the dosage of primers and probes as shown in Table 1. 3. The reaction amplification system may be adjusted proportionally according to the actual use of the instrument and consumables.

[0078] (II) Method Testing

[0079] 1.1 Specificity test of the method

[0080] Using DNA from 19 animal, plant, and microbial mixtures as templates, real-time fluorescent PCR reaction systems for cattle, pigs, chickens, and ducks were prepared for amplification. Experimental results showed that fluorescent signals were only observed in the samples from cattle, pigs, chickens, and ducks; no fluorescent amplification signals were observed in other non-target organisms and the blank control. Figure 1 This indicates that the primers and probes designed in this patent have good specificity.

[0081] Figure 1 The specificity test plots of the method are given; among them, Figure 1 A represents the amplification map of bovine-derived components. Figure 1 B represents the amplification profile of porcine components. Figure 1 C represents the amplification map of chicken-derived components. Figure 1 D represents the amplification map of duck-derived components.

[0082] 1.2 Plotting the Standard Curve

[0083] Standard DNA was extracted from cattle, pigs, chickens, and ducks. The DNA concentration was accurately measured and converted to copy number concentration. Then, the DNA was serially diluted 5-fold according to the following copy number concentration: (1) Cattle: 35700, 7140, 1428, 286, 57; (2) Pigs: 33700, 6740, 1348, 270, 54; (3) Chickens: 51450, 10290, 2058, 412, 82; (4) Ducks: 49170, 9834, 1967, 393, 79. Real-time fluorescent PCR amplification was performed at the above concentrations, and the standard curve was fitted (see [link to standard curve]). Figure 2 The parameters of the standard curve must meet the requirements of relevant standards, which is crucial for establishing a real-time quantitative PCR method. According to the ENGL standard, the slope of the standard curve should be between -3.1 and -3.6, the amplification efficiency should be between 90% and 110%, and the correlation coefficient R² ≥ 0.98. Figure 2 As can be seen, all parameters meet the requirements of the ENGL standard, indicating that the standard curve has a good linear relationship and high amplification efficiency, and a real-time fluorescence quantitative PCR detection method for cattle, pigs, chickens and ducks has been successfully established.

[0084] Figure 2 The standard curve and amplification plot are given; among them, Figure 2 A is the amplification map of the bovine standard curve. Figure 2 B is the standard curve for cattle. Figure 2 C represents the amplification pattern of the pig standard curve. Figure 2 D is the standard curve for pigs. Figure 2 E represents the amplification pattern of the chicken standard curve. Figure 2 F is the standard curve for chickens. Figure 2 G represents the amplification spectrum of the duck standard curve. Figure 2 H represents the duck standard curve.

[0085] 1.3 Accuracy Testing of the Method

[0086] To test the accuracy of the method, the method established in this invention was used to quantitatively detect reference samples A1-A22. Each sample was tested in triplicate, and the experimental results are shown in Table 2. Based on the standard curve, the copy number of each animal-derived component was calculated, and then the percentage content of each component was calculated based on the copy number. To confirm the accuracy of the results, the bias and relative standard deviation (RSD) of the measurement results for all samples were calculated. The bias and RSD of all samples were less than or equal to 25%, meeting the requirements of the ENGL standard, indicating that the method established in this invention has high accuracy.

[0087]

[0088]

[0089]

[0090] Note: B represents the deviation (calculated using the formula: R is the relative standard deviation (calculated using the formula: ).

[0091] 1.4 Limit of Quantitation Test of the Method

[0092] To test the limit of quantitation (LOQ) of the method, the method established in this invention was used to quantitatively detect reference samples Q1-Q4. Each sample was tested in 15 replicates, and the experimental results are shown in Table 3. The average values ​​for real-time fluorescence quantitative detection were 0.09, 0.09, 0.11, and 0.12, respectively, with deviations of 10.00%, 10.00%, 10.00%, and 20.00%, and relative standard deviations of 22.22%, 22.22%, 18.18%, and 16.67%, respectively, all less than or equal to 25%. Therefore, the LQ for real-time fluorescence PCR quantitative detection of bovine, porcine, chicken, and duck-derived components was determined to be 0.1%.

[0093]

[0094] 1.5 Detection Limit Test of the Method

[0095] To test the detection limit of the method, the method established in this invention was used to perform qualitative detection on reference samples D1-D4, with 60 replicates for each sample. According to the ENGL standard's LOD 95% principle, i.e., the ratio of positive replicates to total replicates must be greater than 95%, Table 4 shows that the detection limits for cattle, pigs, chickens, and ducks are 5, 5, 5, and 10 copies, respectively.

[0096] Table 4 shows the detection limit test of the method.

[0097]

[0098] Example 2 (Method Application)

[0099] The method of this invention is used for quantitative detection of commercial meat products.

[0100] To verify the feasibility of the method, DNA was extracted from common commercial meat products, and the percentage content of beef, pork, chicken, and duck-derived components in the meat products was quantitatively determined. The experimental results showed that the label information of some beef products was inconsistent with the test results (as shown in Table 5 below). Specifically, the label of beef balls S12 indicated beef >55%, with a beef content of 36.83%; beef balls S14 showed no bovine-derived components but detected pork, chicken, and duck-derived components, with chicken accounting for 97.86%; beef rolls S16 indicated only beef, with 0.32% chicken-derived components detected; beef rolls S22 indicated both beef and pork, with a beef content of only 10.54%, mostly pork filler; beef balls S24 indicated both beef and chicken, with no bovine-derived components detected, entirely chicken filler; beef rolls S30 indicated only beef, with 94.32% duck meat detected; and beef balls S47 and S48 indicated beef, pork, chicken, and duck, with beef contents of 9.52% and 0.24%, respectively. The quantitative test results show that: some qualitatively labeled beef products contain very low levels of beef or even no beef at all, and unlabeled meat components were detected; a few quantitatively labeled beef products do not contain the labeled beef content; and a few commercial meat products are contaminated, such as S16 beef rolls which contain 0.32% chicken-derived components and S48 beef balls which contain 0.24% bovine-derived components. Due to the low meat content, these can be identified as cross-contamination during the production process.

[0101]

[0102]

[0103] This invention is not limited to the specific embodiments described above. The invention extends to any new feature or combination disclosed in this specification, as well as any new method or process step or combination disclosed herein.

[0104] The present invention has been described in detail above with general descriptions and specific embodiments. However, modifications or improvements can be made to the present invention, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A method for accurate quantitative detection of beef, pork, chicken, and duck-derived components in meat products using real-time fluorescence PCR, characterized in that, Includes the following steps: (1) Design upstream primers, downstream primers and probes for marker genes in cattle, pigs, chickens and ducks; (2) Extract DNA from standard substances and test samples from cattle, pigs, chickens, and ducks respectively; (3) Dilute the standard DNA extracted in step (2) and prepare a series of standard solutions with copy number concentration gradients. Use the standard solutions as templates for real-time fluorescence PCR amplification, measure the Ct value of each standard solution, and plot the standard curves for cattle, pigs, chickens and ducks: y = ax + b, where y is the Ct value of the test sample, a is the slope of the standard curve, x is the logarithm of the template copy number to the base 10, and b is the intercept of the standard curve. (4) Using the DNA extracted from the test sample in step (2) as a template, perform real-time fluorescent PCR amplification; obtain the Ct value of the test sample, and calculate the copy number of bovine, pig, chicken and duck marker genes in the test sample according to the standard curve drawn in step (3); (5) According to the formula Calculate the percentage content of animal-derived components in the test sample, where C is the percentage content of the animal component to be tested in the test sample, Nd is the copy number of the animal marker gene to be tested in the test sample, and Nz is the sum of the copy numbers of all animal marker genes in the test sample. In steps (3) and (4), the amplification primers and probes for the real-time fluorescence PCR are: Bos upstream primer Bos-F: CCCTCGCCCGCATTG; Bos downstream primer Bos-R: AGCGACAGGTCAAGGGAGTCA; Bovine probe Bos-P: VIC-CAGCTCAACTCTTAGCC-BHQ1; The upstream primer for pigs, Sus-F: GCAAGGCCAGGGATCGA; Downstream primer for pigs, Sus-R: AGCAGAAACCAGCCATGGATT; The probe for pigs, Sus-P: FAM-CCGCGTCCTCATGG-BHQ1; Chicken upstream primer Gal-F: CGTCCCTCACTTCCATATTGATG; Chicken downstream primer Gal-R: ATCTTCACTGTCAATGCCTTCACA; Chicken probe Gal-P: Cy5-CCTCTTTGTGGATCCTGT-BHQ3; The upstream primer for ducks, Ana-F: CAGTCCCCCCTGCCTAGGA; Downstream primer for duck, Ana-R: TCAGTGTACAGGTAGCCCCTCTCT; The duck probe Ana-P: Texas-AAGTGCCAGTATGCGGG-BHQ2.

2. The detection method according to claim 1, characterized in that, In steps (3) and (4), the real-time fluorescence PCR reaction system for cattle is as follows: 12.5 µL of qPCR TaqMan Probe Master Mix, 1.0 µL each of Bos-F and Bos-R primers, 0.6 µL of Bos-P probe, 2 µL of DNA template, and ddH2O to make up to 25 µL.

3. The detection method according to claim 1, characterized in that, In steps (3) and (4), the real-time fluorescence PCR reaction system for pigs is as follows: 12.5 µL of qPCR TaqMan Probe Master Mix, 1.0 µL each of Sus-F and Sus-R primers, 0.6 µL of Sus-P probe, 2 µL of DNA template, and ddH2O to make up to 25 µL.

4. The detection method according to claim 1, characterized in that, In steps (3) and (4), the real-time fluorescence PCR reaction system for chicken is as follows: 12.5 µL of qPCR TaqMan Probe Master Mix, 1.0 µL each of Gal-F and Gal-R primers, 0.6 µL of Gal-P probe, 2 µL of DNA template, and ddH2O to make up to 25 µL.

5. The detection method according to claim 1, characterized in that, In steps (3) and (4), the real-time fluorescence PCR reaction system for the duck is as follows: 12.5 µL of qPCR TaqMan Probe Master Mix, 1.0 µL each of Ana-F and Ana-R primers, 0.6 µL of Ana-P probe, 2 µL of DNA template, and ddH2O to make up to 25 µL.

6. The detection method according to claim 1, characterized in that, In steps (3) and (4), the real-time fluorescence PCR reaction conditions are as follows: the first stage is 95℃ for 5 min; the second stage is 95℃ for 10 s, 62℃ for 30 s, and the number of cycles is 40; the fluorescence signal is collected during the annealing extension period of the second stage.

7. The application of the method according to any one of claims 1-6 in real-time fluorescence PCR quantitative detection of beef, pork, chicken and duck-derived components in meat products.

8. A reagent kit, characterized in that, The kit contains the primers and probes as described in any one of claims 1-6.

9. The use of the primers and probes according to any one of claims 1-6 in the preparation of a kit for real-time fluorescence PCR quantitative detection of beef, pork, chicken and duck-derived components in meat products.

Citation Information

Patent Citations

  • Multiple-PCR primer system for quickly testing animal origin ingredients of pigs, sheep and cows and testing method

    CN105177150A