Phytophthora capsici pcstt3a gene and application thereof

By knocking out the PcSTT3A gene of the STT3A protein in Phytophthora capsici using CRISPR/Cas9 technology, the problem of Phytophthora capsici disease control has been solved, and effective control of mycelial growth and pathogenicity has been achieved, providing a direction for the development of novel fungicides.

CN117660387BActive Publication Date: 2026-02-17CHINA AGRI UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311656355.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2022-12-23
Filing Date
2023-12-05
Publication Date
2026-02-17
Estimated Expiration
2043-12-05

AI Technical Summary

Technical Problem

Existing technologies are insufficient to effectively control plant diseases caused by Phytophthora capsici, and the single mechanism of action of fungicides leads to serious resistance problems, making it urgent to develop new oomycete inhibitors.

Method used

By studying the STT3A protein PcSTT3A in Phytophthora capsici, and using CRISPR/Cas9 gene editing technology to knock out or silence this gene, interfering with its expression and activity, we can regulate mycelial growth, zoospore release and pathogenicity, and develop it as a novel fungicide target.

Benefits of technology

It effectively reduces the infectivity and pathogenicity of Phytophthora capsici, slows down mycelial growth rate, and reduces zoospore production, providing a potential molecular target for novel fungicides and offering technical support for the control of Phytophthora capsici diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0004589029620000061
    Figure BDA0004589029620000061
  • Figure BDA0004589029620000062
    Figure BDA0004589029620000062
  • Figure BDA0004589029620000071
    Figure BDA0004589029620000071
Patent Text Reader

Abstract

The application discloses an oligosaccharyltransferase STT3A (staurosporine and temperature-sensitive A) subunit from Phytophthora capsici and a coding gene and application thereof. The oligosaccharyltransferase STT3A subunit provided by the application is shown as sequence 2; and the coding gene is shown as sequence 1. Experiments prove that the protein provided by the application plays an important role in the growth and development of Phytophthora capsici, and the specific performance is that after the protein is deleted, the mycelium growth rate of Phytophthora capsici is slowed down, the zoospore quantity is reduced, and the pathogenicity is reduced, etc. The above conclusion provides a technical basis for exploring the development and pathogenic molecular mechanism of Phytophthora capsici, and provides a potential molecular target for the research and development of a new type of bactericide in the future.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of biotechnology, and particularly relates to STT3A (staurosporine and temperature-sensitive) protein PcSTT3A from Phytophthora capsici, a coding gene thereof and application. BACKGROUND

[0002] Oomycetes are widely distributed and can cause serious harm to the plant kingdom and the animal kingdom. The oomycete genus Phytophthora infects a large number of crops and is difficult to control, and new control agents need to be developed urgently. With the deepening of the mechanism of fungicides, people have begun to pay more attention to the development of new oomycete inhibitors targeting the key binding site of the protein. N-glycosylation is the most common glycosylation modification in eukaryotes, which is a process in which oligosaccharides are transferred to the asparagine residue of the specific motif Asn-X-Ser / Thr of a protein in the endoplasmic reticulum, and further processed in the Golgi to form mature glycoproteins. N-glycosylation affects the folding, stability and localization of proteins, thereby regulating multiple biological processes such as cell growth and development and cell-to-cell communication. N-glycosylation is catalyzed by oligosaccharyltransferase (OTase), which is an oligomeric membrane protein complex in animals, plants and fungi that catalyzes the transfer of oligosaccharides to the Asn residue of the acceptor polypeptide. The STT3 subunit is the largest protein in eukaryotic oligosaccharyltransferase, is highly conserved, and has catalytic activity. Since oligosaccharyltransferase plays an important catalytic role in N-glycosylation, its catalytic mechanism has been concerned and studied in various species.

[0003] In recent years, studies have shown that N-glycosylation plays an important role in the growth and development of pathogenic fungi, the process of infecting plants and escaping from the immune system of host plants. AfSTT3 knockout disrupts the cell wall integrity of Aspergilus fumigatus and inhibits hyphal growth. Verticilium dahliae secretes a large amount of toxic proteins during infection, most of which are N-glycoproteins. VdSTT3 knockout inhibits hyphal growth, spore formation, significantly reduces the amount of glycoprotein secretion, and significantly reduces pathogenicity.

[0004] Phytophthora capsici is a typical plant pathogenic oomycete in the family Peronosporaceae, which is widely distributed in the world. As an important soil-borne pathogen, P. capsici has a very wide host range, which can infect Solanaceae, Leguminosae, Cucurbitaceae and other host plants, causing sudden collapse, wilting and root, stem and fruit rot, causing serious economic losses to agricultural production. Under suitable environmental conditions, P. capsici can produce a large number of sporangia on the surface of the infected host, release zoospores, and continuously infect the host. The sporangia and zoospores play an important role in the multiple infection cycles of P. capsici in a growing season.

[0005] In summary, P. capsici is an important plant pathogen that poses a serious threat to agricultural production and economy. Due to the limited types of fungicides for oomycete disease control and the emergence of drug resistance in the field, it is urgent to develop new control agents. The present application has important guiding significance for the development of new oomycete inhibitors targeting the oligosaccharyltransferase STT3 subunit. SUMMARY

[0006] The present application carries out related research work on the function of the homologous protein PcSTT3A of STT3 protein in P. capsici, which will help to further understand the role of N-glycosylation in P. capsici in regulating the growth and development of P. capsici and its interaction with the host, and provide reference for the design of new oomycete control targets.

[0007] Through the research of the inventors, it is found that PcSTT3A in P. capsici is closely related to the mycelial growth rate, zoospore release and pathogenicity of P. capsici. These results show that PcSTT3A protein in P. capsici has important regulatory role in the physiology and pathogenic process of the pathogen. Developing the gene as a molecular pesticide target for the pathogenic oomycete P. capsici has important application prospects.

[0008] Therefore, one of the purposes of the present application is to provide P. capsici STT3A protein, which is named PcSTT3A and derived from P. capsici strain BYA5, and is the protein of A1) or A2) A3) or A4) as follows:

[0009] A1) the amino acid sequence is the protein as shown in SEQ ID NO. 2;

[0010] A2) a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein as shown in SEQ ID NO. 2;

[0011] A3) a protein derived from the protein as shown in SEQ ID NO. 2 with the same function obtained by substitution and / or deletion and / or addition of one or more amino acid residues of the amino acid sequence as shown in SEQ ID NO. 2;

[0012] A4) an amino acid sequence having more than 75%, preferably more than 85%, more preferably more than 95% similarity to the amino acid sequence shown as SEQ ID NO: 2, and having the same function as the amino acid sequence shown as SEQ ID NO: 2.

[0013] To facilitate the purification of the protein in A1), a tag such as Poly-Arg (RRRRR), Poly-His (HHHHHH), FLAG (DYKDDDDK), Strep-tag II (WSHPQFEK), c-myc (EQKLISEEDL) can be attached to the amino terminal or carboxyl terminal of the protein consisting of the amino acid sequence shown as SEQ ID NO: 2 in the sequence listing.

[0014] The proteins in A1) to A4) above can be artificially synthesized, or can be obtained by first synthesizing the encoding gene and then performing biological expression. The encoding gene of the proteins in A2) to A4) above can be obtained by deleting one or several codons of the amino acid residues in the DNA sequence shown as SEQ ID NO: 1 in the sequence listing, and / or performing missense mutation of one or several nucleotide pairs, and / or attaching the encoding sequence of the above-mentioned tag to the 5' end and / or 3' end.

[0015] In A1), the sequence 2 (PcSTT3A) in the sequence listing consists of 886 amino acid residues.

[0016] The second object of the present application is to provide a nucleic acid molecule encoding the desired STT3A protein. The nucleic acid molecule can be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule can also be RNA, such as mRNA, hnRNA or tRNA, etc.

[0017] In the above, the encoding gene of the STT3A protein is as follows:

[0018] B1) a DNA molecule shown by the nucleotide sequence shown as SEQ ID NO: 1 in the sequence listing;

[0019] B2) a cDNA molecule or DNA molecule having more than 75% or more than 85% or more than 95% identity to the nucleotide sequence shown as B1), and encoding the above-mentioned PcSTT3A protein;

[0020] B3) a cDNA molecule or DNA molecule hybridizing to the nucleotide sequence defined in B1) or B2) under stringent conditions, and encoding the above-mentioned PcSTT3A protein.

[0021] In the above, the encoding gene consists of 2731 nucleotides in SEQ ID NO: 1 in the sequence listing; the 1-266th and 337-2731th nucleotides from the 5' end of SEQ ID NO: 1 are the coding sequences, which encode the protein PcSTT3A shown as SEQ ID NO: 2 in the sequence listing.

[0022] said RNA molecule is a RNA molecule transcribed from said encoding gene;

[0023] Preferably, the sequence of said RNA molecule is as follows C1) or C2):

[0024] C1) a RNA sequence transcribed from a DNA sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 3 with more than 75%, further more than 85%, and more preferably more than 95% similarity to a RNA sequence transcribed from a DNA sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 3 and having the same function as a RNA sequence transcribed from a DNA sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 3;

[0025] C2) a RNA sequence transcribed from a DNA sequence as shown in SEQ ID NO: 1.

[0026] A DNA sequence as claimed in the present application is a DNA sequence which can hybridize to a DNA sequence as shown in SEQ ID NO: 1 under stringent conditions and encodes a protein as shown in SEQ ID NO: 2. The above-mentioned stringent conditions can be hybridization at 65°C in a solution of 6xSSC, 0.5% SDS, followed by washing the membrane once with 2xSSC, 0.1% SDS and once with 1xSSC, 0.1% SDS.

[0027] A third object of the present application is to provide biological materials related to the above-mentioned nucleic acid molecules, including recombinant vectors, expression cassettes, recombinant microorganisms or transgenic plant cell lines. The recombinant vectors can be recombinant expression vectors or recombinant cloning vectors. In the above-mentioned biological materials, the vectors can be plasmids, cosmids, bacteriophages or viral vectors; the microorganisms can be yeasts, bacteria, algae or fungi, such as Agrobacterium; and the transgenic plant cell lines do not include propagation materials. Specifically, they can be any one of the following D1) to D10):

[0028] D1) an expression cassette containing the encoding gene as claimed in claim 2;

[0029] D2) a recombinant vector containing the encoding gene as claimed in claim 2, or a recombinant vector containing the expression cassette as claimed in D1);

[0030] D3) a recombinant microorganism containing the encoding gene as claimed in claim 2, or a recombinant microorganism containing the expression cassette as claimed in D1), or a recombinant microorganism containing the recombinant vector as claimed in D2);

[0031] D4) a transgenic plant cell line containing the encoding gene as claimed in claim 2, or a transgenic plant cell line containing the expression cassette as claimed in D1);

[0032] D5) a transgenic plant tissue containing the encoding gene as claimed in claim 2, or a transgenic plant tissue containing the expression cassette as claimed in D2);

[0033] D6) a transgenic plant organ comprising the coding gene according to claim 2, or a transgenic plant organ comprising the expression cassette according to D2);

[0034] D7) a nucleic acid molecule which inhibits the expression of the coding gene according to claim 2;

[0035] D8) an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line comprising the nucleic acid molecule according to D7);

[0036] D9) a nucleic acid molecule which inhibits the translation of the above-mentioned RNA molecule;

[0037] D10) an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line which produces the nucleic acid molecule according to D9).

[0038] The fifth object of the present application is to provide the use of the P. capsici PcSTT3A protein and the nucleic acid molecule encoding the P. capsici PcSTT3A protein or the biological material comprising the nucleic acid molecule encoding the P. capsici PcSTT3A protein.

[0039] The use is any one or several of the following 1) to 5):

[0040] 1) the use in regulating (increasing or decreasing) the zoospore production of P. capsici;

[0041] 2) the use in regulating (increasing or decreasing) the mycelial growth rate of P. capsici;

[0042] 3) the use in regulating (increasing or decreasing) the germination of the cysts and the ability to infect the host of P. capsici;

[0043] 4) the use in regulating (increasing or decreasing) the pathogenicity of P. capsici to the host;

[0044] 5) the use in inhibiting and / or killing P. capsici.

[0045] Preferably, in the use, the use of 1) to 5) is achieved by inhibiting the transcription of the coding gene according to SEQ ID NO. 1 or inactivating it, or inhibiting the translation of the above-mentioned RNA molecule, or inhibiting and / or inactivating the activity of the P. capsici PcSTT3A protein according to SEQ ID NO. 2.

[0046] In the use, the growth of the mycelium, the zoospore production and the ability to infect the host are interfered by inhibiting the transcription of the coding gene as described above, or inhibiting the translation of the above-mentioned RNA sequence, or inhibiting and / or inactivating the activity of the above-mentioned P. capsici PcSTT3A protein, so that the growth of P. capsici can be inhibited and / or killed.

[0047] The sixth object of the present application is to provide the PcSTT3A protein shown in sequence 2 in the above-mentioned sequence list, and the use of the coding gene shown in sequence 1 in the above-mentioned sequence list as a target for screening a bacteriostatic or bactericidal agent for Phytophthora capsici Leonian.

[0048] The seventh object of the present application is to provide a method for screening or assisting in screening a bacteriostatic and / or bactericidal agent for Phytophthora capsici, which comprises applying a test substance to the Phytophthora capsici Leonian, and when the test substance can inhibit the transcription of the above-mentioned DNA sequence, or inhibit the translation of the above-mentioned RNA sequence, or inhibit and / or inactivate the PcSTT3A protein shown above, then the test substance is a candidate for the plant Phytophthora capsici bacteriostatic and / or bactericidal agent.

[0049] The eighth object of the present application is to provide a method for reducing the activity of Phytophthora capsici Leonian, which comprises the following steps: inhibiting the transcription of the above-mentioned coding gene or deleting it, or inhibiting the translation of the above-mentioned RNA molecule, or inhibiting and / or inactivating the activity of the PcSTT3A protein shown above.

[0050] The reduction of the activity of Phytophthora capsici Leonian is the reduction of the infection ability of Phytophthora capsici Leonian to the host and / or the pathogenicity to the host, and / or the reduction of the growth rate of the Phytophthora capsici Leonian, and / or the inhibition of the production of zoospores of Phytophthora capsici.

[0051] In the above-mentioned method, the inactivation of the protein is achieved by inhibiting or reducing the expression of the coding gene of the protein to be inactivated, and specifically, it can be achieved by gene knockout or by gene silencing.

[0052] The gene knockout refers to the phenomenon of inactivating a specific target gene by homologous recombination. The gene knockout is to inactivate a specific target gene by changing the DNA sequence.

[0053] The gene silencing refers to the phenomenon of not expressing or lowly expressing a gene without damaging the original DNA. The gene silencing can occur at two levels, one is the transcriptional level of gene silencing caused by DNA methylation, heterochromatinization, and position effect, etc., and the other is the post-transcriptional gene silencing, i.e., inactivating a gene by specifically inhibiting the target RNA after the transcription of the gene, including antisense RNA, co-suppression, gene quelling, RNA interference (RNAi), and microRNA (miRNA) mediated translation inhibition, etc.

[0054] Preferably, the gene shown in sequence 1 in the sequence list is knocked out to inactivate the protein shown in the protein shown in sequence 2 in the sequence list; or the nucleotides from 4 to 189 at the 5' end of sequence 1 in the sequence list are knocked out to inhibit the activity of the protein shown in sequence 2 in the sequence list.

[0055] In an embodiment of the present application, the method for knocking out the above-mentioned gene is a CRISPR / Cas9-based gene knockout method.

[0056] Specifically, the CRISPR / Cas9-based gene knockout method is to transfect the Donor vector of the target gene, the sgRNA expression vector and the Cas9 expression plasmid into P. capsici to screen the recombinant bacteria in which the target knockout protein is inactivated.

[0057] The Donor vector pBS-PcSTT3A-NPTII is a recombinant vector containing the sequence of 800-1500 bp upstream of the target gene to be knocked out, the Dodor DNA sequence (which can be the sequence of NPTII or GFP or RFP gene) and the sequence of 800-1500 bp downstream of the target gene to be knocked out. The sgRNA expression vector pYF2.3G-PcSTT3A is a vector for expressing the sgRNA fragment targeting the target gene to be knocked out, wherein the target gene to be knocked out is sequence 1 in the sequence list, and the sgRNA sequence targeting the PcSTT3A gene is sgPcSTT3A: GGTCTGATAGGCTGCAGTCG (targeting the 80-99th of SEQ ID No. 1 of the PcSTT3A gene). Preferably, the sgRNA expression plasmid is obtained by inserting the double-stranded sgRNA coding sequence obtained by annealing the sgRNA of the PcSTT3A gene into the Nhe I and Bsa I enzyme recognition sites of the pYF2.3G-Ribo-sgRNA vector, using the pYF2.3G-Ribo-sgRNA vector as the starting vector. The Donor vector pBS-PcSTT3A-NPTII, the sgRNA expression vector pYF2.3G-PcSTT3A and the Cas9 expression plasmid pYF2-Cas9 knockout the full-length sequence of the PcSTT3A gene.

[0058] Alternatively, the Donor vector pBS-PcSTT3A is a recombinant vector containing the sequence of 800-1500bp upstream of the 4-189bp sequence of the target gene PcSTT3A to be knocked out and the sequence of 800-1500bp downstream of the 4-189bp sequence of the target gene PcSTT3A to be knocked out. The 4-189bp sequence of the PcSTT3A gene is knocked out by using the Donor vector pBS-PcSTT3A, the sgRNA expression vector pYF2.3G-PcSTT3A and the Cas9 expression plasmid pYF2-Cas9.

[0059] The use of the substance inhibiting the expression and / or activity of the PcSTT3A protein in the preparation of a plant pepper Phytophthora capsici bactericide also belongs to the protection scope of the present application.

[0060] In the above use, the substance inhibiting the expression and / or activity of the PcSTT3A protein is a substance inhibiting the expression of the PcSTT3A protein and / or inhibiting the transcription of the coding gene of the PcSTT3A protein and / or inhibiting the translation of the RNA molecule obtained by the transcription of the coding gene of the PcSTT3A protein.

[0061] It has been proved by experiments that the PcSTT3A protein provided by the present application plays a role in the growth and development of the pepper Phytophthora capsici itself. The PcSTT3A gene knockout homozygous transformant cannot be obtained by using the CRISPR / Cas9 gene editing technology, and the PcSTT3A gene knockout will cause the death of the pepper Phytophthora capsici. The 4-189bp, 190-1657bp and 1658-2728bp sequences of the PcSTT3A gene are knocked out by using the CRISPR / Cas9 gene editing technology, and only the knockout transformant of the 4-189bp sequence of the PcSTT3A gene is obtained, which has obvious changes compared with the wild type parent strain, mainly including the slowing down of the mycelial growth rate, the reduction of the zoospore yield and the weakening of the ability to infect the host plant. Therefore, the PcSTT3A protein of the pepper Phytophthora capsici can play an important role in multiple processes of the pepper Phytophthora capsici such as the vegetative growth, asexual reproduction and infection of the host. The present application provides technical support for the pathogenic mechanism research of the pepper Phytophthora capsici, and provides a potential molecular action target for the future research and development of new bactericides. BRIEF DESCRIPTION OF DRAWINGS

[0062] Figure 1 The colony diameter column chart of the pepper Phytophthora capsici strain BYA5 (WT), the control transformant N-CK and the knockout transformant of the 4-189bp sequence of the PcSTT3A gene (N27, N62, N250) (cultured on V8 solid medium for 3d).

[0063] Figure 2The pathogenicity of zoospores of pepper Phytophthora capsici strain BYA5 (WT), control transformant N-CK, knock-out transformant of 4-189 bp sequence of PcSTT3A gene (N27, N62, N250) on pepper leaves. DETAILED DESCRIPTION

[0064] The following examples facilitate a better understanding of the present application, but do not limit the present application. In the following examples, the experimental methods are conventional methods unless otherwise specified. In the following examples, the materials, reagents, etc. are commercially available unless otherwise specified.

[0065] Pepper Phytophthora capsici strain BYA5: Isolated, identified and preserved by the Seed Pathology and Fungicide Pharmacology Experiment of the College of Plant Protection, China Agricultural University in 2011, isolated from a diseased pepper sample in Gansu Province, publicly available from China Agricultural University.

[0066] Culture medium or reagent formula:

[0067] 10% V8 solid medium: 100 mL V8 vegetable juice, 1.4 g CaCO3, stir and mix well, dilute 10 times with deionized water, i.e. add 900 mL deionized water, add 15 g agar, 121 ℃ high pressure wet heat sterilization for 20 min.

[0068] 10% V8 liquid medium: 100 mL V8 vegetable juice, 1.4 g CaCO3, stir and mix well, centrifuge at 12000 rpm for 5 min, take the supernatant, dilute 10 times with deionized water, 121 ℃ high pressure wet heat sterilization for 20 min.

[0069] Nutrient pea broth (NPB): 125 g of peas are added to 1 L of deionized water, 121 ℃ high pressure wet heat sterilization for 20 min, and the pea nutrient solution is obtained by filtering with gauze; 2.0 g of yeast extract, 5.0 g of glucose, 5.0 g of mannitol, 5.0 g of sorbitol, 2.0 g of CaCO3, 0.1 g of CaCl2, 0.5 g of MgSO4, 3.0 g of KNO3, 1.0 g of K2HPO4, 1.0 g of KH2PO4, stir and mix well, centrifuge at 3000 rpm for 10 min or stand for 30 min, take the supernatant, and dilute to 1 L with the pea nutrient solution, and add 15 g of agar powder for solid medium (NPBA), wet heat sterilization for 20 min. Before use, add 2 mL of vitamin stock solution (Biotin 6.7×10 -7 g / mL; Folic acid 6.7×10 -7 g / mL; L-inositol 4.0×10 -5 g / mL; Nicotinic acid 4.0×10-5 g / mL; Pyridoxine-HCl 6.0 x 10 -4 g / mL; Riboflavin 5.0 x 10 - 5 g / mL; Thiamine-HCl 1.3 x 10 -3 g / mL) and 2 ml of trace element stock solution (FeC6H5O7-3H2O 5.4 x 10 -4 g / mL; ZnSO4-7H2O 3.8 x 10 -4 g / mL; CuSO4-5H2O 7.5 x 10 -4 g / mL; MgSO4-H2O 3.8 x 10 -5 g / mL; H3BO32.5 x 10 -5 g / mL; Na2MoO4-H2O 3.0 x 10 -5 g / mL).

[0070] Pea Mannitol (PM): 91.1 g mannitol, 1 g CaCl2, 2 g CaCO3, add about 900 mL pea nutrient solution, mix well for about 30 min, centrifuge at 3000 rpm for 10 min or stand for 30 min, take supernatant, dilute to 1 L with pea nutrient solution, add 15 g agar powder to solid medium (PMA), autoclave for 20 min.

[0071] Mycelium enzyme solution (20 mL): 10 mL 0.8 M mannitol, 0.8 mL 0.5 M KCl, 0.8 mL 0.5 M 4-morpholineethanesulfonic acid, 0.4 mL 0.5 M CaCl2, 0.12 g cellulase (Calbiochem, cat. No. 219466), 0.12 g lyticase (Sigma, cat. No. L1412), sterilize with 0.22 μm filter membrane, prepare fresh.

[0072] MMG solution (250 mL): 18.22 g mannitol, 0.76 g MgCl2-6H2O, 2.0 mL 0.5 M 4-morpholineethanesulfonic acid (pH = 5.7), sterilize with 0.22 μm filter membrane.

[0073] W5 solution: 0.1 g KCl, 4.6 g CaCl2-2H2O, 2.25 g NaCl, 7.8 g glucose, sterilize with 0.22 μm filter membrane.

[0074] PEG-CaCl2 solution (40% w / v): 12 g PEG 4000, 3.75 mL 0.5M CaCl2, 3 mL sterile ultrapure water, 0.22 μm filter membrane sterilization.

[0075] The pBluescript II SK+ homologous arm vector plasmid (Donor vector), sgRNA expression vector pYF2.3G-Ribo-sgRNA and Cas9 expression plasmid pYF2-Cas9 used in this example were all donated by Professor Brett M. Tyler of Oregon State University, USA.

[0076] Example 1, obtaining of Phytophthora capsici PcSTT3A protein and its encoding gene

[0077] The PcSTT3A protein and its encoding gene (or cDNA) of Phytophthora capsici used in this example can be obtained by amplification with the primers listed in Table 1 using the DNA (or cDNA) of Phytophthora capsici strain BYA5 as a template. The material for DNA or RNA extraction is mycelium of Phytophthora capsici strain BYA5. The encoding gene of PcSTT3A is shown in SEQ ID NO: 1 in the sequence listing, which consists of 2731 nucleotides; the 1-266th and 337-2731th nucleotides from the 5' end of SEQ ID NO: 1 are the coding sequence, which encodes the protein PcSTT3A shown in SEQ ID NO: 2. The above protein or gene can also be artificially synthesized.

[0078] Table 1. Primers for amplifying the full-length encoding gene of PcSTT3A

[0079]

[0080] SEQ ID NO: 1 in the sequence listing is shown as follows:

[0081]

[0082]

[0083] SEQ ID NO: 2 in the sequence listing is shown as follows:

[0084]

[0085] Example 2, construction of 4-189 bp knockout vector of Phytophthora capsici PcSTT3A gene

[0086] The CRISPR / Cas9-based gene knockout vector construction method and the sequences of the related vectors in this embodiment are disclosed in the literature "Fang, Y., and Tyler, B. M. (2016). Efficient disruption and replacement of an effector gene in the oomycete Phytophthora sojae using CRISPR / Cas9. Molecular plant pathology, 17(1), 127-139." and "Fang, Y., Cui, L., Gu, B., Arredondo, F., and Tyler, B. M. (2017). Efficient genome editing in the oomycete Phytophthora sojae using CRISPR / Cas9. Curr. Protoc. Microbiol. 44, 21A.1.1-21A.1.26.". The pBluescript II SK+ homologous arm vector plasmid (Donor vector), sgRNA expression vector pYF2.3G-Ribo-sgRNA and Cas9 expression plasmid pYF2-Cas9 used in this embodiment are all donated by Professor Brett M. Tyler of Oregon State University, USA.

[0087] Experiments have proved that the PcSTT3A protein provided by the present application plays a role in the growth and development of P. capsici. The PcSTT3A gene knockout homozygous transformant cannot be obtained by using the CRISPR / Cas9 gene editing technology, and the PcSTT3A gene knockout leads to the death of P. capsici.

[0088] The 4-189 bp, 190-1657 bp and 1658-2728 bp sequences of the PcSTT3A gene are knocked out by using the CRISPR / Cas9 gene editing technology, and only the knockout transformant of the 4-189 bp sequence of the PcSTT3A gene is obtained, which has obvious changes compared with the wild type parent strain, mainly including: the mycelial growth rate is slowed down, the zoospore yield is reduced, and the ability to infect host plants is weakened. Therefore, the PcSTT3A protein of P. capsici can play an important role in multiple processes of P. capsici, such as vegetative growth, asexual reproduction and host infection.

[0089] The donor vector pBS-PcSTT3A, the donor vector pBS-PcSTT3A-NPTII, and the sgRNA expression plasmid pYF2.3G-PcSTT3A used in the present embodiment are constructed as follows:

[0090] The donor vector pBS-PcSTT3A, the donor vector pBS-PcSTT3A-NPTII, and the sgRNA expression plasmid pYF2.3G-PcSTT3A used in the present embodiment are constructed as follows:

[0091] 1) Construction of the homology arm vector of pBS-PcSTT3A: The 4-189 bp upstream 1000 bp sequence of the target gene PcSTT3A (shown as SEQ ID NO: 3 in the sequence listing, amplified by the primers shown as pBS-STT3A-F1 and pBS-STT3A-R1 in Table 2) and the 4-189 bp downstream 1000 bp sequence of the target gene PcSTT3A (shown as SEQ ID NO: 4 in the sequence listing, amplified by the primers shown as pBS-STT3A-F2 and pBS-STT3A-R2 in Table 2) were amplified from the DNA of the P. capsici strain BYA5 using the TaKaRa-In-Fusion_Tools online website (http: / / www.clontech.com / US / Products / Cloning_and_Competent_Cells / Cloning_Resources / Online_In-Fusion_Tools) to design the primers. The two amplified fragments were sequentially fused and ligated into the cloning vector pBluescript II SK+ (EcoR V enzyme cut) using the HD Cloning Kit, and the ligation product was transformed into E. coli DH5a competent cells. After overnight culture at 37°C, the recombinant expression vector containing the 4-189 bp upstream 1000 bp sequence of the target gene PcSTT3A and the 4-189 bp downstream 1000 bp sequence of the target gene PcSTT3A was amplified and sequenced using the universal primers M13F (sequence: 5'-TGTAAAACGACGGCCAGT-3') / M13R (sequence: 5'-CAGGAAACAGCTATGACC-3'), and the correct recombinant expression vector was named pBS-PcSTT3A.

[0092] Table 2. 4-189 bp sequence knock-out Donor vector construction of PcSTT3A gene Amplification primer

[0093]

[0094] 2) Homologous arm vector construction of pBS-PcSTT3A-NPTII: The upstream 1000 bp of the target gene PcSTT3A (sequence 5 in the sequence listing, amplified by primers as shown in pBS-STT3A-NPTII-F1 and pBS-STT3A-NPTII-R1 in Table 3), the NPTII gene (the NPTII gene was amplified by primers as shown in pBS-STT3A-NPTII-F2 and pBS-STT3A-NPTII-R2 in Table 3, using pYF2-Cas9 backbone plasmid as template), and the downstream 1000 bp sequence of the PcSTT3A gene (sequence 6 in the sequence listing, amplified by primers as shown in pBS-STT3A-NPTII-F3 and pBS-STT3A-NPTII-R3 in Table 3) were amplified using the TaKaRa-In-Fusion_Tools online website (http: / / www.clontech.com / US / Products / Cloning_and_Competent_Cells / Cloning_Resources / Online_In-Fusion_Tools) to design primers. The three amplified fragments were sequentially fused and ligated into the cloning vector pBluescript II SK+(EcoR V enzyme digestion) using the HD Cloning Kit, and the ligation product was transformed into E. coli DH5a competent cells. After overnight culture at 37°C, the recombinant expression vector containing the sequentially ligated upstream 1000 bp of the PcSTT3A gene, NPTII gene, and downstream 1000 bp of the PcSTT3A gene was amplified and sequenced using universal primers M13F (sequence: 5'-TGTAAAACGACGGCCAGT-3') / M13R (sequence: 5'-CAGGAAACAGCTATGACC-3'), and was named pBS-PcSTT3A-NPTII.

[0095] Table 3. Full-length knock-out Donor vector construction of PcSTT3A gene Amplification primer

[0096]

[0097] 3) Construction of pYF2.3G-Ribo-sgRNA: The sgRNA sequence (sgSTT3A: GGTCTGATAGGCTGCAGTCG, targeting the 80-99th of SEQ ID No. 1 of PcSTT3A gene) was designed by using the sgRNA design website EuPaGDT (http: / / grna.ctegd.uga.edu / ) and the RNA structure online analysis tool (http: / / rna.urmc.rochester.edu / RNAstructureWeb / Servers / Predictl / Predictl.html) to specifically target the 4-189 bp sequence of PcSTT3A gene with weak secondary structure. The sgRNA sequence primer with Nhe I and Bsa I enzyme cutting sites and HHribozyme was synthesized by a company (as shown in Table 4). It was dissolved in sterile water to form a 100 mM solution. Double-stranded sgRNA sequence was synthesized by annealing reaction. The reaction system was 3 pL of forward strand solution, 3 pL of reverse strand solution, 3 pL of 10 x T4 DNA Ligase Buffer (NEB), 4 pL of 0.5 M NaCl, 21 pL of ultrapure sterile water, mixed by pipetting, reacted at 100 °C for 2 min, and naturally cooled at room temperature for 4 h. Then the reaction solution was diluted 500 times. 2 pL of 10 x T4 DNA Ligase Buffer (NEB), 50 ng of pYF2.3G-Ribo-sgRNA vector (Nhe I / Bsa I double enzyme cutting), 4 pL of diluted double-stranded sgRNA solution, 1 pL of T4 DNA Ligase, and sterile ultrapure water were added to 20 pL, and reacted at room temperature for 30 min. 5 pL of ligation product was used to transform E. coli DH5a competent cells. After overnight culture at 37 °C, colony PCR was performed using primer pair RPL41_Pseq_F (sequence: 5'-CAAGCCTCACTTTCTGCTGACTG-3') / M13F (sequence: 5'-TGTAAAACGACGGCCAGT-3'), and the positive clone was verified by sequencing. The recombinant vector verified to express the above sgRNA was named pYF2.3G-STT3A.

[0098] Table 4. Synthesis of sgRNA nucleotide sequence for knocking out 4-189 bp sequence of PcSTT3A gene

[0099]

[0100] Example 3, Obtaining of the transformant for knocking out 4-189 bp sequence of PcSTT3A gene of Phytophthora capsici

[0101] The CaCl2-PEG mediated protoplast transformation method was used to prepare the knock-out transformants of the 4-189 bp sequence of the PcSTT3A gene. The method of oomycete genetic transformation is disclosed in the literature "Fang, Y., and Tyler, B. M. (2016). Efficient disruption and replacement of an effector gene in the oomycete Phytophthora sojae using CRISPR / Cas9. Molecular plant pathology, 17(1), 127-139."

[0102] The knock-out series of the full-length of the PcSTT3A gene obtained in Example 2 (Donor vector pBS-PcSTT3A-NPTII, sgRNA vector pYF2.3G-STT3A, and Cas9 expression plasmid pYF-Cas9) were co-transformed into the protoplasts of P. capsici BYA5. The transformants grown were screened by G418 resistant V8 solid medium plate, and the mycelium of suspected transformants was collected for DNA extraction and PCR sequencing verification, and RNA extraction for Q-PCR verification. After multiple biological repeats, no homozygous transformants of the full-length of the PcSTT3A gene were obtained, indicating that the full-length knock-out of the PcSTT3A gene caused the death of P. capsici. The knock-out series of the 4-189 bp sequence of the PcSTT3A gene obtained in Example 2 (Donor vector pBS-PcSTT3, sgRNA vector pYF2.3G-STT3A, and Cas9 expression plasmid pYF-Cas9) were co-transformed into the protoplasts of P. capsici BYA5, and the knock-out transformants of the 4-189 bp sequence of the PcSTT3A gene (N27, N62, N250) were obtained. At the same time, the transformants with the same vector plasmids and the same transformation steps but without homologous replacement were used as control transformants N-CK.

[0103] Example 4, Biological shape analysis of the knock-out transformants of the 4-189 bp sequence of the PcSTT3A gene of P. capsici

[0104] I. Mycelial growth rate detection

[0105] The wild type P. capsici strain BYA5 (WT), the control transformant N-CK, the knock-out transformant series of the 4-189 bp sequence of the PcSTT3A gene obtained in Example 3 (N27, N62, N250) were inoculated in the center of a sterile Petri dish (9 cm in diameter) with 15 mL V8 solid medium, and cultured at 25°C in the dark for 3 days. The colony diameters of each strain were measured by cross method, with 3 repeats for each strain.

[0106] The results show that the mycelium growth rate of the knock-out transformants of 4-189bp sequence of PcSTT3A gene (N27, N62, N250) significantly decreased compared with wild type P. capsici strain BYA5 (WT) and control transformant N-CK. Figure 1 The experimental results show that the PcSTT3A protein regulates the mycelium growth of P. capsici.

[0107] II. Detection of the number of sporangia and zoospores

[0108] Prepare 10% V8 solid medium, inoculate wild type P. capsici strain BYA5 (WT), control transformant N-CK, and knock-out transformants of 4-189bp sequence of PcSTT3A gene (N27, N62, N250) obtained in Example 3 on V8 solid medium (9 cm in diameter) respectively, and cultivate at 25°C in dark for 3 days, then place the culture dishes with the front side up in a light incubator at 25°C (RH = 60%-80%) for further cultivation for 5 days. Add 10 mL sterile water, and place in a refrigerator at 4°C for 30 min, then take out the culture dishes and place at room temperature (25°C) for 40 min, collect the released zoospore suspension, shake on a vortex for 1 min, and drop 10 μL of the released zoospore suspension onto a hemocytometer, observe under a microscope and count the number of zoospores produced. Observe the number and morphology of sporangia produced on the medium under a 20x objective, and set 3 replicates for each strain.

[0109] The results show that the number of sporangia of the knock-out transformants of 4-189bp sequence of PcSTT3A gene (N27, N62, N250) obtained in Example 3 did not change significantly compared with wild type P. capsici strain BYA5 (WT) and control transformant N-CK, while the number of released zoospores significantly decreased, but the morphology of sporangia and zoospores was normal, which indicates that the PcSTT3A protein mainly affects the number of zoospores of P. capsici (Table 5).

[0110] III. Detection of the morphology of chlamydospores and counting of germination rate

[0111] Obtain wild type P. capsici strain BYA5 (WT), control transformant N-CK, and knock-out transformants of 4-189bp sequence of PcSTT3A gene (N27, N62, N250) obtained in Example 3 by the above method, shake the zoospore suspension of each strain on a vortex for 1 min to obtain chlamydospore suspension, and cultivate at 25°C in dark for 8 h, observe the morphology of chlamydospores under an optical microscope, and randomly detect the number of germinated chlamydospores in every 100 chlamydospores, and set 3 replicates for each strain.

[0112] The results show that the sporulation and zoospore germination of the knock-out transformants of 4-189bp sequence of PcSTT3A gene (N27, N62, N250) obtained in Example 3 have no significant difference compared with wild type P. capsici strain BYA5 (WT) and control transformant N-CK (Table 5).

[0113] IV. Statistics and observation of pathogenicity results

[0114] The zoospores of each treated strain of P. capsici were collected according to the above method, and the concentration of the zoospores of each strain was adjusted to 10 5 The spore suspension was inoculated on the picked equilateral, same-age, healthy pepper leaves, 10 μL of the zoospore suspension was added to each pepper leaf, and 6 leaves were inoculated for each treatment. The inoculated leaves were placed on a glass rack and in a 15 cm glass dish with 3 layers of water-absorbing paper and an appropriate amount of water, and the inoculated pepper leaves were placed in a light incubator at 25°C (RH = 60%-80%) in the dark for 3 days. The lesion diameters were measured by the cross method and photographed, and the whole test was repeated 3 times.

[0115] The results show that the pathogenicity of the knock-out transformants of 4-189bp sequence of PcSTT3A gene (N27, N62, N250) obtained in Example 3 is significantly reduced compared with wild type P. capsici strain BYA5 (WT) and control transformant N-CK. Figure 2

[0116] Table 5. Spore yield and zoospore germination rate of knock-out transformants of 4-189bp sequence of PcSTT3A gene

[0117]

[0118] Note: a BYA5 represents the parent strain; N-CK represents the control transformant; N27, N62, N250 represent the knock-out transformants of 4-189bp sequence of PcSTT3A gene.

[0119] b The values in the table represent the mean ± standard deviation. F test method in single factor ANOVA analysis in DPS software was used to calculate the biological trait difference between wild type strain and different transformants, and the same letter in the same column indicates that there is no significant difference (P < 0.05).​

Claims

1. Use of a biological material according to any one of D1 ) to D4), D1 ) a nucleic acid molecule encoding a gene according to SEQ ID NO: 1 ; D2) an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line comprising the nucleic acid molecule according to D1 ); D3) a nucleic acid molecule inhibiting the translation of an RNA molecule encoding a gene according to SEQ ID NO: 1 ; D4) an expression cassette, a recombinant vector, a recombinant microorganism or a transgenic plant cell line producing the nucleic acid molecule according to D3); characterized in that said use being any one or several of 1 ) to 5): 1 ) use in pepper to reduce the production of zoospores of P. capsici; 2) use in pepper to reduce the growth rate of mycelium of P. capsici; 3) use to reduce the ability of P. capsici to infect pepper; 4) use to reduce the pathogenicity of P. capsici on pepper; 5) use in pepper to inhibit and / or kill P. capsici.

2. The use according to claim 1, wherein, The use according to 1 ) to 5) is achieved by inhibiting or inactivating the transcription of a gene according to SEQ ID NO: 1, or inhibiting the translation of an RNA molecule encoding a gene according to SEQ ID NO: 1, or inhibiting and / or inactivating a PcSTT3A protein according to SEQ ID NO:

2.

3. Use of the PcSTT3A protein according to SEQ ID NO: 2, or of a gene according to SEQ ID NO: 1, as a target for screening a bacteriostatic or fungicidal agent against P. capsici; said bacteriostatic or fungicidal agent being capable of inhibiting the transcription of a gene according to SEQ ID NO: 1, or inhibiting the translation of an RNA molecule encoding a gene according to SEQ ID NO: 1, or inhibiting the activity or inactivating a PcSTT3A protein according to SEQ ID NO:

2.

4. A method for screening or assisting in the screening of a bacteriostatic and / or fungicidal agent against P. capsici, said method comprising applying a test agent to said P. capsici, and when said test agent is capable of inhibiting the transcription of a gene according to SEQ ID NO: 1, or inhibiting the translation of an RNA molecule encoding a gene according to SEQ ID NO: 1, or inhibiting the activity or inactivating a PcSTT3A protein according to SEQ ID NO: 2, then said test agent is a bacteriostatic and / or fungicidal agent against said P. capsici.

5. A method for reducing the activity of P. capsici, comprising the step of inhibiting the transcription of a gene according to SEQ ID NO: 1, or inactivating a gene according to SEQ ID NO: 1, or inhibiting the translation of an RNA molecule encoding a gene according to SEQ ID NO: 1, or inhibiting the activity or inactivating a PcSTT3A protein according to SEQ ID NO: 2; wherein said reduction of the activity of P. capsici being a reduction of the ability of P. capsici to infect a host and / or of the pathogenicity of P. capsici on a host, and / or a reduction of the growth rate of mycelium of P. capsici, and / or a reduction of the production of zoospores.

6. The method of claim 5, wherein, by gene knockout of a gene according to SEQ ID NO: 1 in P. capsici to inactivate or inhibit the activity of a protein according to SEQ ID NO:

2.

7. The method of claim 6, wherein, The method for knocking out the gene encoding the polypeptide represented by SEQ ID NO: 1 in the Phytophthora capsici is to knock out the gene from the 4th to 189th nucleotide from the 5' end of SEQ ID NO:

1. The method for knocking out the gene encoding the polypeptide represented by SEQ ID NO: 1 in the Phytophthora capsici is to knock out the gene from the 4th to 189th nucleotide from the 5' end of SEQ ID NO: 1.