A method for artificially regulating the yellowing of transgenic tobacco leaves by inducing estradiol
By overexpressing the NtDSR1 gene in tobacco and inducing it with estradiol, the problem of inaccurate tobacco leaf harvesting time in the existing technology was solved, the yellowing of tobacco leaves was precisely regulated, and the quality of cigarettes was improved.
Patent Information
- Application Number
- CN202311709923.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-12
- Publication Date
- 2025-09-12
- Estimated Expiration
- 2043-12-12
AI Technical Summary
Existing technologies are unable to effectively apply genetic resources to regulate the yellowing of tobacco leaves, resulting in inaccurate tobacco leaf harvesting time and affecting cigarette quality.
By overexpressing the transcription factor NtDSR1 gene in tobacco and using estradiol induction, precise regulation of yellowing of transgenic tobacco leaves is achieved. The specific steps include constructing the NtDSR1-PER8 plasmid, Agrobacterium infection and estradiol spraying treatment.
It achieves precise control over the time and position of yellowing of tobacco leaves, improves the accuracy of tobacco leaf harvesting period, and thus improves the quality of cigarettes.
Smart Images

Figure CN117678442B_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of tobacco planting, and in particular relates to a method for artificially regulating the yellowing of transgenic tobacco leaves by inducing estradiol. Background Art
[0002] Tobacco is one of my country's important economic crops, and yellowing is the final stage of leaf growth. As a key economic plant, tobacco leaves also experience leaf senescence and yellowing during the late stages of their growth. Since cigarette quality is closely related to leaf metabolites, timely harvesting and curing can transform tobacco leaf metabolites toward desirable flavor profiles, making them key to improving cigarette quality. Currently, several key genes involved in regulating leaf senescence have been identified, but these genes are not directly applicable to production and have limited scope of application. Therefore, identifying genetic resources to improve leaf yellowing has become a key goal in tobacco breeding. This study identified a key transcription factor, NtDSR1, in tobacco, that regulates leaf yellowing. Estradiol-induced overexpression of this gene was used to generate transgenic material, confirming that NtDSR1 can serve as a key gene resource for regulating leaf yellowing in tobacco. This could potentially allow for the artificial manipulation of leaf yellowing in transgenic material by spraying estradiol on overexpressing transgenic material late in its growth cycle. Summary of the Invention
[0003] The present invention provides a method for artificially controlling the yellowing of cultivated tobacco leaves by induction of estradiol. The method can artificially control the yellowing time and yellowing position of tobacco leaves by induction of estradiol, thereby realizing precise artificial control.
[0004] To achieve the above-mentioned object, the present invention provides a method for artificially regulating the yellowing of transgenic tobacco leaves by inducing estradiol. The transgenic tobacco is obtained by transferring the target gene plasmid NtDSR1-PER8 into wild-type tobacco by Agrobacterium infection and then subculturing. The nucleotide sequence of the target gene plasmid NtDSR1-PER8 is shown in SEQ ID NO: 1.
[0005] Preferably, the target gene plasmid NtDSR1-PER8 is constructed by the following method:
[0006] Specific primers for NtDSR1 were designed and PCR amplified using tobacco cDNA as template. The PCR products were identified using 1% agarose gel.
[0007] The PCR product obtained above was diluted 50 times as a template and PCR amplified using the primer pair. After amplification, the PCR product was identified using 1% agarose gel and the gel was cut and recovered, which was named NtDSR1-linker PCR product.
[0008] PER8 was double-digested with endonucleases pacI and speI to obtain a linearized vector. The vector fragment was recovered by gel and prepared for ligation. The linearized vector was named PER8-linearized.
[0009] Using the infusion homologous recombination method, the NtDSR1-linker PCR product was connected to the PER8-linearized product and sent to the company for sequencing to construct the target gene plasmid NtDSR1-PER8.
[0010] In the above scheme, the nucleotide sequence of NtDSR1 is shown in SEQ ID NO: 2, and the amino acid sequence thereof is shown in SEQ ID NO: 3.
[0011] Preferably, the NtDSR1 specific primers include:
[0012] NtDSR1F: ATGGTGCAAGAGGAAATCAG;
[0013] NtDSR1R:TTACCGAAAGGTATTCCAGTCAAAATC;
[0014] Preferably, the primer pair comprises:
[0015] NtDSR1-perF:
[0016] GGCCCATACGCGTTATGGTGCAAGAGGAAATCAG;
[0017] NtDSR1-perR:
[0018] GCCTGGATCGACTAGTTACCGAAAGGTATTCCAGTCAAAATCPCR.
[0019] Preferably, the amplification conditions for PCR amplification using transgenic tobacco cDNA as a template are as follows: the amplification system for PCR amplification using transgenic tobacco cDNA as a template is: Green Taq Mix 10 μL, 10 μM NtDSR1F 1 μL, 10 μM NtDSR1R 1 μL, Template DNA 2 μL, ddH2O 6 μL, total volume 20 μL;
[0020] The amplification procedure is:
[0021] 98°C for 3 min, 32 cycles of 98°C for 10 s, 56°C for 15 s, and 72°C for 20 s, 72°C for 5 min, and 25°C for 24 h;
[0022] The amplification system for PCR amplification using the primer pair was: Green Taq Mix 10 μL, 10 μM NtDSR1-perF 1 μL, 10 μM NtDSR1-perR 1 μL, Template DNA 2 μL, ddH O 6 μL, total volume 20 μL;
[0023] The amplification procedure is:
[0024] 98°C for 3 min, 32 cycles of 98°C for 10 s, 56°C for 15 s, and 72°C for 20 s, 72°C for 5 min, and 25°C for 24 h.
[0025] Preferably, the specific procedure of the infusion homologous recombination method is as follows:
[0026] Infusion recombinase 1 μL, NtDSR1-linker PCR product 2 μL, PER8-linearized 22 μL, react at 50 ° C for 15 min in a PCR instrument, remove the reaction product, and transform it into Escherichia coli DH5a.
[0027] The present invention provides an application of estradiol in a method for inducing artificially regulated yellowing of transgenic tobacco leaves.
[0028] Preferably, the transgenic tobacco is obtained by transferring the target gene plasmid NtDSR1-PER8 into wild-type tobacco through Agrobacterium infection and then subcultured. The nucleotide sequence of the target gene plasmid NtDSR1-PER8 is shown in SEQ ID NO: 1.
[0029] The present invention provides a method according to any of the above technical solutions or an application according to any of the above technical solutions, which can effectively achieve artificially controlled yellowing of tobacco leaves by spraying 20-30 μM / 1L of estradiol working solution on tobacco grown for 60-80 days.
[0030] Preferably, a 20-30 μM / 1L estradiol working solution is prepared by the following method:
[0031] Prepared by adding 2 or 3 mL of estradiol stock solution to 1 L of water, followed by 100 μL of Tween-20;
[0032] Wherein, estradiol mother solution is prepared by the following method:
[0033] Weigh 0.136 g of estradiol powder and dissolve it in 50 ml of anhydrous ethanol to prepare an estradiol mother solution with a mother solution concentration of 10 mM.
[0034] Compared with the prior art, the advantages and positive effects of the present invention are:
[0035] The present invention provides a method for artificially controlling the yellowing of cultivated tobacco leaves by induction of estradiol. The method can artificially control the yellowing time and yellowing position of tobacco leaves by induction of estradiol, thereby realizing precise artificial control. BRIEF DESCRIPTION OF THE DRAWINGS
[0036] Figure 1 The NtDSR1 cloning results provided in the embodiments of the present invention;
[0037] Figure 2 The bacterial liquid identification results of the clone NtDSR1 provided in the embodiment of the present invention;
[0038] Figure 3 The results of the cultivated tobacco transformation with inducible expression of NtDSR1 provided in the embodiments of the present invention;
[0039] Figure 4 This is the positive identification result of the transgenic tobacco provided in the embodiment of the present invention;
[0040] Figure 5 The results of the identification of the transcription level of the NtDSR1 gene induced by estradiol provided in the embodiments of the present invention;
[0041] Figure 6 The phenotype of tobacco grown for 60 days and sprayed with estradiol according to an embodiment of the present invention;
[0042] Figure 7 Chlorophyll measurement results of tobacco leaves grown for 60 days after spraying estradiol provided in an embodiment of the present invention;
[0043] Figure 8 The phenotype of tobacco grown for 80 days and sprayed with estradiol according to an embodiment of the present invention;
[0044] Figure 9 Chlorophyll measurement results of leaves of tobacco grown for 80 days after spraying estradiol provided in an embodiment of the present invention;
[0045] Figure 10 The phenotype of tobacco grown for 200 days and sprayed with estradiol according to an embodiment of the present invention;
[0046] Figure 11 The chlorophyll measurement results of tobacco leaves grown for 200 days after spraying estradiol are provided in an embodiment of the present invention. DETAILED DESCRIPTION
[0047] The following is a clear and complete description of the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts are within the scope of protection of the present invention.
[0048] Example 1: Construction of NtDSR1-PER8 overexpression vector by induction of NtDSR1
[0049] 1. Design NtDSR1-specific primers and perform PCR amplification using cultivated tobacco cDNA as a template. After amplification, identify the PCR product using 1% agarose gel. The NtDSR1-specific primers include:
[0050] NtDSR1F: ATGGTGCAAGAGGAAATCAG;
[0051] NtDSR1R:TTACCGAAAGGTATTCCAGTCAAAATC;
[0052] Amplification conditions were as follows: PCR amplification using transgenic tobacco cDNA as a template consisted of the following system: GreenTaq Mix 10 μL, 10 μM NtDSR1F 1 μL, 10 μM NtDSR1R 1 μL, Template DNA 2 μL, ddH O 6 μL, total volume 20 μL;
[0053] The specific amplification procedure is as follows:
[0054] 98°C for 3 min, 32 cycles (98°C for 10 s, 56°C for 15 s, 72°C for 20 s), 72°C for 5 min, and 25°C for 24 h.
[0055] 2. The PCR product obtained under item 1 above was diluted 50-fold and used as a template. PCR amplification was performed using the following primers (amplification system: Green Taq Mix 10 μL, 10 μM NtDSR1-perF 1 μL, 10 μM NtDSR1-perR 1 μL, Template DNA 2 μL, ddH2O 6 μL, total volume 20 μL; amplification procedure was the same as under item 1 above). After amplification, the PCR product was identified using a 1% agarose gel and the gel was cut to recover the PCR product, which was named NtDSR1-linker PCR product. Figure 1 As shown, a band with the same size as the target fragment was obtained, indicating that the target gene has been successfully cloned; wherein, the primers include:
[0056] NtDSR1-perF:
[0057] GGCCCATACGCGTTATGGTGCAAGAGGAAATCAG;
[0058] NtDSR1-perR:
[0059] GCCTGGATCGACTAGTTACCGAAAGGTATTCCAGTCAAAATCPCR.
[0060] 3. Double-digest PER8 with endonucleases pacI and speI to obtain a linearized vector. Recover the vector fragment on gel and prepare for ligation. The linearized vector is named PER8-linearized.
[0061] 4. Use the infusion homologous recombination method to connect the NtDSR1-linker PCR product with the PER8-linearized product. The specific procedure is as follows:
[0062] Infusion recombinase 1 μL, NtDSR1-linker PCR product 2 μL, PER8-linearized 22 μL, react at 50 ° C for 15 min in a PCR instrument, remove the reaction product, and transform it into Escherichia coli DH5a.
[0063] 5. Identify the positive bacteria and send them to the company for sequencing. The constructed vector is named NtDSR1-PER8. Figure 2 As shown, the target band was identified, indicating that a plasmid containing the target gene was obtained.
[0064] Example 2: Creation of NtDSR1 Inducible Overexpression Transgenic Tobacco Material
[0065] 1. Cultivation of Agrobacterium: Positive Agrobacterium NtDSR1-PER8-GV3101 was placed in YEB medium (pH 7.0) (5 g / L peptone; 1 g / L yeast extract; 0.5 g / L magnesium sulfate; 5 g / L beef extract; 5 g / L sucrose) and cultured at 28°C and 250 rpm in the dark for about 18 h to an OD of 0.6-0.8.
[0066] 2. Cultivation of Sterile Seedlings: Take tobacco seeds (wild-type tobacco, ecotype Honghua Dajinyuan) and sterilize them sequentially using 75% alcohol for 90 seconds, 50% sodium hypochlorite twice for 10 minutes each, and rinse with sterile water at least three times. After disinfection, sow them on seedling initiation medium (F). When seedlings reach approximately 0.5 cm in height, transfer them to transplanting medium (MS0). When the leaves have grown to 5-8, select green leaves and infect them with Agrobacterium.
[0067] 3. Agrobacterium infection: Dilute Agrobacterium to an OD600 of 0.8, then add 20 mg / L AS (acetosyringone) and infect sterile leaves for 5-8 minutes. Spread the infected leaves onto co-cultivation medium (G) with the veins facing upwards and incubate in the dark at 22°C or 23°C for 3 days.
[0068] 4. S1 subculture: Inoculate the co-cultivated leaves onto S1 medium (with the veins facing downward), place them in an artificial climate chamber, and culture them in the dark at around 25°C (block the light of the incandescent lamp with a black plastic bag) for 2-3 weeks. Clusters of buds will grow on the edges of the leaves, and the buds should be 0.1-0.5 cm long. You can adjust the length based on your experience.
[0069] 5. S2 Subculture: Transfer the buds from S1 to S2 medium (S2). If the buds can be broken off, inoculate them directly. If they cannot be broken off, inoculate them together with the leaves, removing the leaves that have not grown buds. After 1-2 weeks of incubation under light, the buds will grow into young seedlings.
[0070] 6. Rooting culture: Remove the swollen part at the bottom and the yellowed leaves at the bottom of the healthy seedlings on S2, inoculate them onto the rooting medium (R), and culture them under light for 1-2 weeks. When 3-10 roots are formed and the roots are about 2-3 cm long, transplant them into nutrient pots to obtain transgenic tobacco plants that may contain the target gene NtDSR1-PER8.
[0071] The above process is as follows Figure 3 As shown, NtDSR1-PER8 transgenic tobacco has undergone induction, screening, differentiation, rooting and other steps, and can take root normally on the culture medium containing basta. It is preliminarily identified as a positive transgenic material, and molecular identification will be carried out in the next step.
[0072] The culture medium formulas (1 L) in steps 1-6 above are shown in Table 1, and the pH of the formulas is 5.8.
[0073] Table 1
[0074]
[0075]
[0076] Example 3 Identification of positive transgenic material
[0077] (1) Identification at the genomic level
[0078] Fourteen-day-old tobacco seedling leaves were ground into a powder in liquid nitrogen. The powder was transferred to a 1.5 mL centrifuge tube and 400 μL of DNA extraction buffer (20 mL of 1 M Tris-HCl (pH 7.5), 5 mL of 0.5 M EDTA (pH 8.0), 5 mL of 10% SDS, 5 mL of 5 M NaCl, and 65 mL of deionized water, totaling 100 mL) was added. The sample was mixed by inversion and then placed in a water bath at 65°C for 30 minutes, with the tube gently inverted every 5 minutes to mix the sample. The sample was removed from the water bath and centrifuged at 12,000 rpm for 10 minutes in a microcentrifuge. The tube was carefully removed, and 300 μL of the supernatant was pipetted and transferred to a new 1.5 mL centrifuge tube. 300 μL of isopropanol (previously cooled in a 4°C refrigerator) was added to the supernatant, mixed by inversion, and allowed to stand at room temperature for 10 minutes. Place the centrifuge tube in a microcentrifuge and centrifuge at 12,000 rpm for 5 minutes. Carefully remove the centrifuge tube, slowly tilt the bottom of the tube, discard the supernatant, add 700 μL of 70% ethanol along the wall of the tube to rinse the precipitate. Slowly discard the 70% ethanol in the centrifuge tube, add 500 μL of anhydrous ethanol, and centrifuge at 12,000 rpm for 2 minutes. Remove the centrifuge tube, carefully discard the anhydrous ethanol, and let it stand at room temperature (the centrifuge tube can be tilted and inverted) to dry the precipitate. Add 100 μL of sterilized ddH2O to the centrifuge tube, centrifuge briefly, let it stand at room temperature for 30 minutes, and store it in a -20°C refrigerator. The results are as follows: Figure 4 As shown, using the genomic DNA of the transgenic material as a template, the target band of the expected size can be obtained, while the wild type cannot amplify the same band. Therefore, it is preliminarily judged that the transgenic material is positive.
[0079] (2) Identification of transcriptional levels
[0080] Methods (using different concentrations of estradiol to activate target gene expression): Leaves of 30-day-old tobacco seedlings were sprayed with 10 μM, 20 μM, and 30 μM estradiol for 0 h, 30 min, 1 h, 3 h, and 12 h, respectively. RNA was extracted from the treated materials and reverse transcribed into cDNA using a reverse transcription kit (Novozymes Biotech: R323-01 qPCR cDNA Reverse Transcription Mix). qRT-PCR was used to determine the optimal treatment method for obtaining the highest expression level of the target gene transcript.
[0081] The qRT-PCR method is specifically as follows:
[0082] The cDNA obtained by reverse transcription was diluted ten times as a template and used the Green PremixPro Taq HS qPCR Kit (Rox Plus), the reaction system is as follows:
[0083]
[0084] qRT-PCR reaction conditions:
[0085]
[0086] Quantitative results data analysis:
[0087] The data were analyzed using 7500Software Version 2.0.5, refer to 2 -ΔΔCT Methods The relative expression of genes was calculated.
[0088] The results are as follows Figure 5 The results show that the transcription level of the NtDSR1 gene was verified 30 minutes, 1 hour, 3 hours, and 12 hours after the tobacco materials were sprayed with 10μM, 20μM, and 30μM estradiol. The results showed that the expression of the NtDSR1 gene increased 30 minutes after spraying with different concentrations of estradiol, with the effect being the best after 3 hours. There was no significant difference in the expression of the NtDSR1 gene between different concentrations of estradiol.
[0089] Example 4 Effect of artificial intervention on yellowing of tobacco
[0090] Preparation method of estradiol stock solution:
[0091] Weigh 0.136g of estradiol powder and dissolve it in 50ml of anhydrous ethanol to a stock solution concentration of 10mM
[0092] Preparation method of estradiol working solution:
[0093] 10 μM working solution (1 L): 1 mL of the above stock solution was added to 1 L of water. 100 μL of Tween-20 was added to increase the working efficiency of the estradiol solution.
[0094] 20 μM working solution (1 L): 2 mL of the above stock solution was added to 1 L of water. 100 μL of Tween-20 was added to increase the working efficiency of the estradiol solution.
[0095] 30 μM working solution (1 L): 3 mL of the above stock solution was added to 1 L of water. 100 μL of Tween-20 was added to increase the working efficiency of the estradiol solution.
[0096] Spraying method: Use a spray container to spray the working liquid onto both sides of the tobacco leaves, spray 3-5 times. If conditions permit, you can cover the tobacco plants with a plastic bag to prevent the solution from evaporating, which will have a better effect.
[0097] Observation time: After spraying, it is possible to observe the phenotypic differences between the transgenic materials and the wild-type controls at least 10 days after spraying.
[0098] 1) Spray 20 μM estradiol on tobacco plants grown for 60 days and observe the effect of leaf yellowing after 15 days. Figure 6 As shown in the results, compared with the wild type, the transgenic materials sprayed with estradiol can significantly promote leaf senescence.
[0099] 2) 60-day-old tobacco plants were sprayed with estradiol at different working concentrations (10 μM, 20 μM, 30 μM). Ten days later, the yellowing effect of leaves on the transgenic materials and wild-type controls at different working concentrations was compared (chlorophyll assay).
[0100] The results are as follows Figure 7 As shown, the results of chloroplast determination showed that 10 days after the transgenic tobacco grown for 60 days was sprayed with 10μM, 20μM, and 30μM estradiol, respectively, the leaves all fell yellow prematurely to varying degrees compared with the wild-type control, among which the spraying effect of 20μM estradiol was the most significant.
[0101] 3) Spray 30 μM estradiol on tobacco plants grown for 80 days and observe the effect of leaf yellowing after 20 days. Figure 8 As shown in the results, compared with the wild type, the transgenic materials sprayed with estradiol can significantly promote leaf senescence.
[0102] 4) 80-day-old tobacco plants were sprayed with estradiol at different working concentrations (10 μM, 20 μM, 30 μM). After 20 days, the yellowing effect of leaves on the transgenic materials and wild-type controls at different working concentrations was compared (chlorophyll assay).
[0103] The results are as follows Figure 9 As shown, the chloroplast assay results showed that for tobacco plants grown for 80 days, spraying 10μM, 20μM, and 30μM estradiol had different effects on yellowing of tobacco leaves. The effects of 10μM and 20μM estradiol were not obvious, but 30μM estradiol could promote yellowing of tobacco leaves, and 30μM estradiol had the best effect.
[0104] 5) Spray 30 μM estradiol on tobacco plants grown for 200 days and observe the effect of leaf yellowing after 30 days. Figure 10 As shown in the results, compared with the wild type, the transgenic materials sprayed with estradiol can significantly improve the yellowing effect of tobacco.
[0105] 6) 200-day-old tobacco plants were sprayed with estradiol at different working concentrations (10 μM, 20 μM, 30 μM). After 20 days, the yellowing effect of leaves on the transgenic materials and wild-type controls at different working concentrations was compared (chlorophyll assay).
[0106] The results are as follows Figure 11As shown, the chloroplast assay results showed that for tobacco plants growing at 200, spraying 10μM, 20μM, and 30μM estradiol had different effects on yellowing of tobacco leaves. The effect of 10μM estradiol was not obvious, but 20μM and 30μM estradiol could promote yellowing of tobacco leaves, and 30μM estradiol had a better effect.
[0107] The results of chloroplast detection show that 20 μM estradiol has the best effect after 60 days of tobacco growth, and 30 μM estradiol has the best effect after 80 days of growth. Yellowing of tobacco leaves is an event in the late growth stage of tobacco plants. Therefore, it is recommended to use 30 μM estradiol in the late growth stage of tobacco plants for artificial control of yellowing of tobacco leaves, which will have better effects on production applications.
Claims
1. A method for artificially regulating the yellowing of transgenic tobacco leaves by inducing estradiol, characterized in that: The transgenic tobacco is obtained by transferring the target gene plasmid NtDSR1-PER8 into wild-type tobacco through Agrobacterium infection and then subcultured. The nucleotide sequence of the target gene plasmid NtDSR1-PER8 is shown in SEQ ID NO:
1.
2. The method according to claim 1, characterized in that The target gene plasmid NtDSR1-PER8 was constructed by the following method: Specific primers for NtDSR1 were designed and PCR amplified using tobacco cDNA as template. The PCR products were identified using 1% agarose gel. The PCR product obtained above was diluted 50 times as a template and PCR amplified using the primer pair. After amplification, the PCR product was identified using 1% agarose gel and the gel was cut and recovered, which was named NtDSR1-linker PCR product. PER8 was double-digested with endonucleases pacI and speI to obtain a linearized vector. The vector fragment was recovered by gel and prepared for ligation. The linearized vector was named PER8-linearized. Using the infusion homologous recombination method, the NtDSR1-linker PCR product was connected to the PER8-linearized product and sent to the company for sequencing to construct the target gene plasmid NtDSR1-PER8.
3. The method according to claim 2, characterized in that NtDSR1-specific primers include: NtDSR1F:ATGGTGCAAGAGGAAATCAG; NtDSR1R:TTACCGAAAGGTATTCCAGTCAAAATC.
4. The method according to claim 2, characterized in that Primer pairs include: NtDSR1-perF: GGCCCATACGCGTTATGGTGCAAGAGGAAATCAG; NtDSR1-perR: GCCTGGATCGACTAGTTACCGAAAGGTATTCCAGTCAAAATC.
5. The method according to claim 2, characterized in that The amplification system for PCR amplification using transgenic tobacco cDNA as a template was as follows: Green Taq Mix 10 μL, 10 μM NtDSR1F 1 μL, 10 μM NtDSR1R 1 μL, Template DNA 2 μL, ddH O 6 μL, total volume 20 μL; The amplification procedure is: 98°C for 3 min, 32 cycles of 98°C for 10 s, 56°C for 15 s, and 72°C for 20 s, 72°C for 5 min, and 25°C for 24 h; The amplification system for PCR amplification using the primer pair was: Green Taq Mix 10 μL, 10 μM NtDSR1-perF 1 μL, 10 μM NtDSR1-perR 1 μL, Template DNA 2 μL, ddH O 6 μL, total volume 20 μL; The amplification procedure is: 98°C for 3 min, 32 cycles of 98°C for 10 s, 56°C for 15 s, and 72°C for 20 s, 72°C for 5 min, and 25°C for 24 h.
6. The method according to claim 2, characterized in that The specific procedures for using the infusion homologous recombination method are as follows: Infusion recombinase 1 μL, NtDSR1-linker PCR product 2 μL, PER8-linearized 22 μL, react at 50 ° C for 15 min in a PCR instrument, remove the reaction product, and transform it into Escherichia coli DH5a.
7. The method according to any one of claims 1 to 6, characterized in that For tobacco grown for 60-80 days, artificially regulated yellowing of tobacco leaves can be effectively achieved by spraying 20-30 μM / 1L of estradiol working solution.
8. The method according to claim 7, characterized in that The 20-30 μM / 1L estradiol working solution was prepared by the following method: Prepared by adding 2 or 3 mL of estradiol stock solution to 1 L of water and then adding 100 μL of Tween-20; Wherein, estradiol mother solution is prepared by the following method: 0.136 g of estradiol powder was weighed and dissolved in 50 ml of anhydrous ethanol to prepare an estradiol stock solution with a stock solution concentration of 10 mM.
9. The use of estradiol in a method for inducing artificial yellowing of transgenic tobacco leaves, characterized in that: The transgenic tobacco is obtained by transferring the target gene plasmid NtDSR1-PER8 into wild-type tobacco through Agrobacterium infection and then subcultured. The nucleotide sequence of the target gene plasmid NtDSR1-PER8 is shown in SEQ ID NO:
1.
10. The use according to claim 9, characterized in that For tobacco grown for 60-80 days, artificially regulated yellowing of tobacco leaves can be effectively achieved by spraying 20-30 μM / 1L of estradiol working solution.
11. The use according to claim 10, characterized in that The 20-30 μM / 1L estradiol working solution was prepared by the following method: Prepared by adding 2 or 3 mL of estradiol stock solution to 1 L of water and then adding 100 μL of Tween-20; Wherein, estradiol mother solution is prepared by the following method: 0.136 g of estradiol powder was weighed and dissolved in 50 ml of anhydrous ethanol to prepare an estradiol stock solution with a stock solution concentration of 10 mM.
Citation Information
Patent Citations
Primer for controlling leaf senescence of Arabidopsis thaliana, and kit and application thereof
CN108929917A
Application of tobacco NtTS3 gene in tobacco leaf senescence control
CN109182347A