A method for breeding a new japonica rice variety suitable for early growth, rapid development, disease resistance, high quality and large panicle in southern China

By combining traditional breeding with molecular breeding, we selected the weakly photosensitized southern indica rice and hybridized it with the high-yield japonica rice. Through molecular marker detection, we solved the problem of breeding early-growing, fast-growing, disease-resistant, high-quality japonica rice varieties in the south, achieved efficient and stable variety creation, and enriched Jiangxi's seed resources.

CN117694240BActive Publication Date: 2025-09-16江西省农业科学院水稻研究所
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202410041118.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-01-11
Publication Date
2025-09-16
Estimated Expiration
2044-01-11

AI Technical Summary

Technical Problem

Existing technologies make it difficult to quickly and efficiently breed new japonica rice varieties that are early-growing, disease-resistant, and high-quality in southern regions. In addition, the hybrid offspring of indica and japonica rice have poor stability and low efficiency of targeted selection.

Method used

By combining traditional breeding methods with molecular breeding technology, we selected southern indica rice varieties with weak photosensitivity and hybridized them with high-yield japonica rice varieties. Through 10 generations of directed selection and combined with molecular marker detection of fgr, DEP1, Pia, and Pi2 genes, we optimized the breeding process and created high-quality, fragrant, large-spike, small-grain japonica rice varieties suitable for cultivation in the south.

Benefits of technology

The stability and directional selection efficiency of indica-japonica rice hybrid offspring have been improved, and high-quality fragrant, multi-resistant, large-spike, small-grain japonica rice varieties suitable for cultivation in the south have been created, enriching the seed source base in Jiangxi.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117694240B_ABST
    Figure CN117694240B_ABST
Patent Text Reader

Abstract

The present invention discloses a method for breeding a new japonica rice variety that is early-growing, fast-growing, disease-resistant, high-quality, and large-spike suitable for southern China. The method comprises the following steps: (1) selecting an indica rice variety that is early-growing, fast-growing, high-quality, fragrant, and weakly photosensitized in southern China as the male parent and a high-yielding japonica rice variety as the female parent, hybridizing the rice, and backcrossing the F1 generation seeds with the female parent; (2) planting the BC1F1 seeds for three consecutive generations, with no less than 200 lines per generation, and selecting large-spike, japonica-type lines that are early-growing, fast-growing, fragrant, have a low chalky grain rate, are weakly photosensitized, and have strong field disease resistance for additional generations; (3) performing molecular marker detection on individual plants of the BC1F4 generation, and further detecting the BC1F5 generation of candidate lines, and tracking the subsequent generations for FGR detection. The present invention solves the problem of large separation and slow stabilization of indica-japonica hybrids, improves the efficiency of directional selection, and creates the first high-quality, fragrant, disease-resistant, large-spike, small-grain japonica rice variety suitable for planting in southern China.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to a method for breeding a new japonica rice variety, and in particular to a method for breeding a new japonica rice variety that is early-growing, fast-growing, disease-resistant, high-quality, and has large panicles and is suitable for the south. Background Art

[0002] Indica and japonica rice have their own unique characteristics. my country has a long tradition of cultivating "indica" in the south and japonica in the north. Over time, rice domestication and adaptation have led to a "southern indica, northern japonica" planting pattern along the Qinling Mountains and the Huaihe River. Relatively speaking, indica rice yields higher in the south, while japonica rice in the north offers better edible quality.

[0003] With the improvement of people's living standards and the demand for material diversity, and the fact that japonica rice has characteristics such as smoothness that indica rice does not have, some people in the south have begun to adapt to it, and "moving japonica rice from the north to the south" has become an important goal of rice breeding and improvement.

[0004] Although Jiangxi has some local japonica rice varieties, they have not been improved for a long time. In order to meet the requirements of modern breeding levels, it is necessary to introduce excellent varieties from japonica rice areas for trial planting and improvement. After more than three years of introduction experiments, the japonica rice in the Northeast is mainly temperature-sensitive, and the growth period introduced into Jiangxi is too short, and the yield is very low. The japonica rice in neighboring provinces such as Jiangsu, Zhejiang, and Anhui is mostly highly photosensitive, and there are very few high-quality, high-yield, and disease-resistant japonica rice varieties adapted to Jiangxi. Summary of the Invention

[0005] The purpose of the present invention is to provide a breeding method for a new early-growing, fast-growing, disease-resistant, high-quality japonica rice variety suitable for the south. By combining traditional breeding methods with molecular breeding technology, the difficult problems of large separation and slow stabilization of indica-japonica hybrids are solved, and the efficiency of directional selection is improved. Through 10 generations of directional selection, the first high-quality, fragrant, multi-resistant, large-spike, small-grain japonica rice variety suitable for planting in the south (Jiangxi) is created, enriching the seed source base for the revitalization of Jiangxi's seed industry.

[0006] In order to achieve the above-mentioned object, the present invention provides a method for breeding a new japonica rice variety that is early-growing, fast-growing, disease-resistant, and high-quality in southern China, the method comprising the following steps:

[0007] (1) Select an early-growing, fast-growing, high-quality, fragrant, and weakly photosensitized indica rice variety from the south as the male parent and a high-yielding japonica rice variety as the female parent, perform hybridization, and backcross the F1 generation seeds with the female parent;

[0008] (2) BCF1 seeds were planted for three consecutive generations, with no less than 200 lines in each generation. In the field, large-eared japonica-type lines with early early growth and rapid development, fragrance, chalkiness less than 5%, weak photosensitivity, and strong field disease resistance were selected for the generation. Among them, the survey method for early growth and rapid development was selected from 1 to 9 weeks after transplanting of mid-season rice. High temperature conditions of mid-season rice can significantly promote the early growth and rapid development characteristics of indica and japonica rice. The number of tillers was investigated from 2 to 6 weeks after transplanting. The ones with many early tillers, that is, those with more than 20 ears in the 6th week after transplanting, were considered to have good early growth and rapid development.

[0009] The method of reducing photosensitivity is to sow mid-season and late-season rice, investigate the time of heading, and use Huazhan, a conventional indica rice in the south, as the control. The difference between the heading date and the control is 3 days as the judgment standard.

[0010] Assume that the heading period of weakly photosensitive varieties is a1 days for mid-season rice and a2 days for late-season rice, and the heading period of strong photosensitive varieties is b1 days for mid-season rice and b2 days for late-season rice, and the range d = │[a1-b1]-[a2-b2]│. If d ≤ 3 days, the strong photosensitivity of the plant line is eliminated. If d > 3 days, the strong photosensitivity of the plant line is not eliminated.

[0011] The resistance to rice blast shall be based on the resistance of the National Rice Resistance Base at the Jinggangshan Resistance Identification Base;

[0012] (3) Molecular marker detection was performed on individual plants of the BC1F4 generation to detect the four genes fgr, DEP1, Pia, and Pi2, and the four genes were further detected in the BC1F5 generation of the breeding candidate line. The offspring after the BC1F5 generation were tracked and tested for fgr, so as to obtain a new japonica rice variety suitable for early growth, fast development, disease resistance, and high quality in the south; wherein, the primer sequences for detecting the Pi2 gene are shown in SEQ ID NO.1 and SEQ ID NO.2; the primer sequences for detecting the Pia gene are shown in SEQ ID NO.3 and SEQ ID NO.4; the primer sequences for detecting the fgr gene are shown in SEQ ID NO.5 and SEQ ID NO.6; the primer sequences for detecting the DEP1 gene are shown in SEQ ID NO.7 and SEQ ID NO.8.

[0013] Preferably, the average number of grains per panicle of the high-yield japonica rice variety is more than 150.

[0014] Preferably, the male parent is selected from Ivory Xiangzhan; and the female parent is selected from Wuyujing No. 33.

[0015] Preferably, in the method for reducing photosensitivity, the variety with weak photosensitivity is selected from conventional southern indica rice with weak photosensitivity.

[0016] Preferably, the method for reducing photosensitivity uses Huazhan, a conventional southern indica rice variety.

[0017] Preferably, the sequence of the DEP1 gene suitable for the new early-growing, fast-growing, disease-resistant, and high-quality japonica rice variety in southern China is shown as SEQ ID NO.10.

[0018] The breeding method of the present invention for a new japonica rice variety that is early-growing, fast-growing, disease-resistant, high-quality, and has large panicles and is suitable for the south has the following advantages:

[0019] The present invention combines traditional breeding methods with molecular breeding technology to solve the difficult problems of large separation and slow stabilization of indica-japonica crosses. Due to the large genomic differences in indica-japonica rice, the hybrid offspring are slow to stabilize. The inventors of the present invention have found that the target gene can be detected in the BC1F2 generation of indica-indica crosses and japonica-japonica crosses, while the target gene can only be detected in the BC1F4 generation of indica-japonica crosses. If the BC1F4 generation is not detected, the BC1F14 generation can achieve basic stability, and the workload is large. The present invention improves the efficiency of directional selection through 10 generations of directional selection, obtains stable varieties, and creates the first high-quality, fragrant, resistant, large-spike, small-grain japonica rice variety suitable for planting in the south (Jiangxi), enriching the seed source base for the revitalization of Jiangxi's seed industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the electrophoresis diagram of the molecule detection of the present invention.

[0021] Figure 2 This is a dynamic effect diagram of the early growth and rapid tillering of the present invention.

[0022] Figure 3 This is the phenotypic result diagram of Ganwanjing 45 created by the present invention. DETAILED DESCRIPTION

[0023] The following is a clear and complete description of the technical solutions in the embodiments of the present invention. Obviously, the embodiments described are only some embodiments of the present invention, not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative efforts are within the scope of protection of the present invention.

[0024] Example 1

[0025] A method for breeding a new japonica rice variety that is early-growing, fast-growing, disease-resistant, high-quality, and large-spike, suitable for southern China, comprising the following steps:

[0026] (1) An early-growing, fast-growing, high-quality, fragrant, and weakly photosensitized indica rice variety from the south was selected as the male parent (Xiangyaxiangzhan) and a high-yielding japonica rice variety (Wuyujing 33) was selected as the female parent. The hybridization was performed, and the F1 generation seeds were backcrossed with the japonica rice (Wuyujing 33).

[0027] (2) BCF1 seeds were planted for three consecutive generations, with no less than 200 lines in each generation. In the field, large-spike, japonica-type lines with early early growth and rapid development, fragrance, chalkiness less than 5%, weak photosensitivity, and strong field disease resistance were selected for the generation. Among them, the survey method for early growth and rapid development was selected from 1 to 9 weeks after transplanting the medium-season rice in Jiangxi (sown in mid-to-late May). The high temperature conditions of medium-season rice can significantly enhance the early growth and rapid development characteristics of indica and japonica rice. Tillering numbers were investigated in weeks 6 to 8. Early tillering was considered high, meaning that a single plant had 20 or more tillers by week 6 after transplanting. Early tillering and rapid emergence were considered good. To reduce photosensitivity, mid-season and late-season rice were sown and the time to heading was investigated, using the southern indica rice variety Huazhan as a control (highly photosensitive varieties can have a long heading period when planted as mid-season rice). A 3-day difference in time from the control was used as the criterion for judging rice blast resistance. Blast resistance was determined based on the resistance data from the National Rice Resistance Base at the Jinggangshan Resistance Identification Base.

[0028] The method for reducing photosensitivity involves sowing mid-season and late-season rice and investigating the time of heading. Huazhan, a conventional southern indica rice, is used as the control, and a 3-day difference between the heading date and the control is used as the judgment standard. For the weakly photosensitized variety, the heading date for mid-season rice is a1 day, and for the late-season rice is a2 day. For the highly photosensitized variety, the heading date for mid-season rice is b1 day, and for the late-season rice is b2 day. The range difference, d, is [a1-b1]-[a2-b2]. If d ≤ 3 days, the strain's high photosensitivity has been eliminated; if d > 3 days, the strain's high photosensitivity has not been eliminated.

[0029] (3) Molecular marker detection was performed on individual plants of the BC1F4 generation, and the four genes fgr, DEP1, Pia, and Pi2 were detected. Molecular marker primers were designed for the 698 bp deletion in the middle of the 5th exon of the DEP1 gene (SEQ ID NO. 9 of the DEP1 gene). The molecular marker primer information is shown in Table 1. The BC1F5 generation of the candidate breeding line was tested again, and the fgr of the subsequent generations was tracked and tested. Figure 1 Shown are the molecular detection electrophoresis diagrams of some BC1F4 generation single plants (a: fgr electrophoresis diagram; b: pi2 electrophoresis diagram; c: pia electrophoresis diagram; d: dep1 electrophoresis diagram). It can be seen from the figure that the electrophoresis band runs from top to bottom, and the DNA runs downward under the action of the negative electrode. The faster it runs, the smaller the molecular weight (small product). By comparing the phenotype, the resistance can be judged; the fragrance gene is also judged in the same way; the DEP1 gene is a functional gene because its 698bp deletion gene is the functional gene, so the one that runs fast is the large-ear variety.

[0030] Table 1 Molecular marker primer information

[0031]

[0032] DEP1 gene (SEQ ID NO.9):

[0033]

[0034] A8 (DEP1 gene sequence of GWJ45 sequence, SEQ ID NO.10):

[0035] TGTATCTGCATTTCATGTCTTTGCTACTGTTGCAAGTGCTCACCCAAGTGCAAAAGACCAAGGTTGCCTCAATTGTTCTTGCAGCTCATGCTGCGACGAGCCATGCTGTAAGCCAAACTGCAGTGCGTGCTGCGCTGGGTCATGCTGTAGTCCAGAC TGCTGCTCATGCTGTAAACCTAACTGCAGTTGCTGCAAGACCCCTTCTTGCTGCAAACCGAACTGCTCGTGCTCCTGTCCAAGCTGCAGCTCATGCTGCGATACATCGTGCTGCAAACCGAGCTGCACCTGCTTCAACATCTAGATCCTTTTTTGG

[0036] As shown in Table 2, the breeding process of Ganwanjing 45 was carried out. Through the above method, the first high-quality, fragrant, multi-resistant, large-spike, small-grain japonica rice variety suitable for cultivation in the south (Jiangxi) was created. The new plant type combines the advantages of indica and japonica rice. As shown in Table 3, the data of quality analysis, variety characteristics and resistance identification of Ganwanjing 45 are shown. The table shows that the rice quality is high, the number of grains in the panicle is large, the comprehensive resistance of the five points is strong, and the loss rate of rice blast is low. Figure 3 The figure shows the phenotypic results of Ganwanjing 45 created by the present invention, including plant type, ear type and grain type.

[0037] Table 2 Breeding process of Ganwanjing 45

[0038]

[0039] Table 3 Data of Ganwanjing 45 in Jiangxi Province Regional Trial in 2022

[0040]

[0041]

[0042] like Figure 2 Figure 1 shows the tillering dynamics of early-maturing and fast-growing lines (Ganwanjing 45 is in the japonica-infiltrated indica type), B and C show the tillering dynamics of indica rice Huazhan and Xiangyaxiangzhan, H and I show the tillering dynamics of japonica rice WJ162 and WJ80, and D, E, F, and G show the tillering dynamics of japonica rice with indica infiltration. It is obvious that japonica rice with indica infiltration has stronger early-maturing and fast-growing properties than japonica rice, but slightly weaker than pure indica rice, but it still has a japonica phenotype.

[0043] Although the present invention has been described in detail through the above preferred embodiments, it should be understood that the above description is not intended to limit the present invention. After reading the above description, various modifications and substitutions of the present invention will become apparent to those skilled in the art. Therefore, the scope of protection of the present invention should be defined by the appended claims.

Claims

1. A method for breeding a new japonica rice variety suitable for early growth, rapid development, disease resistance, high quality and large panicle in southern China, characterized by: The method comprises the following steps: (1) Selecting an early-growing, fast-growing, high-quality, fragrant, and weakly photosensitized indica rice variety from the south as the male parent and a high-yielding japonica rice variety as the female parent, hybridizing the rice, and backcrossing the F1 generation seeds with the female parent; the male parent is selected from Ivory Xiangzhan; the female parent is selected from Wuyujing No. 33; (2) Planting BC1F1 seeds for three consecutive generations, with no less than 200 lines per generation, and selecting large-eared, japonica-type lines that are early-maturing, fragrant, less than 5% chalky, weakly photosensitized, and highly resistant to field diseases for additional generations; wherein the field disease resistance is resistance to rice blast; Among them, the survey method for early growth and rapid development is selected from 1 to 9 weeks after transplanting of mid-season rice. High temperature conditions of mid-season rice can significantly promote the early growth and rapid development characteristics of indica and japonica rice. The number of tillers is investigated from 2 to 6 weeks after transplanting. The early growth and rapid development of the rice is good if the number of tillers is high, that is, the number of tillers reaches more than 20 ears in the 6th week after transplanting. The method for reducing photosensitivity is as follows: sowing mid-season and late-season rice, investigating the time of heading, using a weakly photosensitized variety as a control, the weakly photosensitized variety being the conventional southern indica rice variety Huazhan, and using a 3-day difference between the heading date and the extreme difference of the control as the judgment standard: Assume that the heading period of weakly photosensitive varieties is a1 days for mid-season rice and a2 days for late-season rice, and the heading period of strong photosensitive varieties is b1 days for mid-season rice and b2 days for late-season rice, and the range d = │[a1-b1]-[a2-b2]│. If d ≤ 3 days, the strong photosensitivity of the plant line is eliminated. If d > 3 days, the strong photosensitivity of the plant line is not eliminated. The resistance to rice blast shall be based on the resistance of the National Rice Resistance Base at the Jinggangshan Resistance Identification Base; (3) Conduct molecular marker detection on BC1F4 generation single plants. fgr、DEP1、Pia、Pi2 Four genes, and then test these four genes in the BC1F5 generation of the breeding candidate strain, and follow up the offspring after the BC1F5 generation fgr , to obtain new japonica rice varieties suitable for early growth, rapid development, disease resistance, high quality and large panicle in the south; Among them, detection Pi2 The primer sequences of the gene are shown in SEQ ID NO.1 and SEQ ID NO.2; Pia The primer sequences of the gene are shown in SEQ ID NO.3 and SEQ ID NO.4; fgr The primer sequences of the gene are shown in SEQ ID NO.5 and SEQ ID NO.6; DEP1 The primer sequences of the gene are shown in SEQ ID NO.7 and SEQ ID NO.

8.

2. The breeding method according to claim 1, characterized in that: The average number of grains per panicle of the high-yield japonica rice variety is more than 150.

3. The breeding method according to claim 1, characterized in that: The new japonica rice variety suitable for early growth, rapid development, disease resistance, high quality and large panicle in the south DEP1 The sequence of the gene is shown in SEQ ID NO.10.

Citation Information

Patent Citations

  • Method for creating broad-spectrum long-lasting rice blast-prevention excellent germ plasm of japonica rice in lower reaches of Yangtze River

    CN109089875A

  • Method for improving plant variety

    US20200008387A1