Rhodococcus pyridinovorans, microbial agent and application thereof in remediation of petroleum hydrocarbon contaminated soil

Abstract

The application discloses a kind of Rhodococcus pyridinivorans, microbial inoculum and its application in petroleum hydrocarbon contaminated soil remediation, and relates to the field of microbial technology.The Rhodococcus pyridinivorans is preserved in China General Microbiological Culture Collection Center on December 11, 2023, and the preservation number is CGMCC NO.29278.The application also discloses the application of the strain in soil pollution bio-pile remediation.The strain has a significant removal effect on petroleum hydrocarbons in soil, and the petroleum hydrocarbon degradation rate of the bio-pile using the strain is 63.25% in 14 days, and the petroleum hydrocarbon degradation rate is 82.21% in 14 days after adding carbon source, and the strain can resist 5000mg / kg of petroleum hydrocarbon.The Rhodococcus pyridinivorans and the microbial inoculum made of the strain provided by the application can be used for bio-pile treatment of high-concentration petroleum hydrocarbon contaminated soil, and have the advantages of green, safe, efficient and good application prospect.

Description

TECHNICAL FIELD

[0001] The present application relates to the field of microbial technology, and relates to a strain of Rhodococcus pyridinolus and application of a microbial agent to biopile remediation of soil pollution. BACKGROUND

[0002] Petroleum hydrocarbons (C10-C40) are common organic pollutants in groundwater of petroleum processing and chemical raw material manufacturing enterprises, which include n-alkanes, cycloalkanes, alkenes, arenes, polycyclic arenes and other substances. Petroleum hydrocarbon pollutants have the characteristics of strong penetration, large flowability and wide influence range of contaminated soil, resulting in a complex pollution system and great difficulty in treatment. Petroleum pollutants are difficult to remove and can remain in the soil for a long time, causing serious impact on the soil ecosystem.

[0003] At present, the remediation processes for petroleum contaminated soil mainly include thermal desorption process, chemical oxidation process, bioremediation process and combined process, each of which has its applicable range. The thermal desorption process removes organic matter such as petroleum hydrocarbons in soil by high temperature heating, but also destroys the soil structure. Although the chemical oxidation process has short remediation period and reliable effect, the residual chemical reagents will affect the soil. Compared with the above two remediation processes, bioremediation is more green, safe and environmentally friendly, and is very suitable for petroleum contaminated soil remediation and soil ecological structure conditioning. Moreover, bioremediation will become the main process for petroleum contaminated soil remediation in the future due to its low cost. Petroleum contaminated soil bioremediation is divided into in-situ remediation and ex-situ remediation. In-situ remediation is limited by the site conditions and it is difficult to control various indicators, and it is usually suitable for soil with low petroleum hydrocarbon pollution level. Ex-situ remediation is controllable in various indicators, and this process is suitable for soil with high concentration of petroleum hydrocarbons, has small occupation and relatively wide application range. There are more than 70 genera of microorganisms in nature that can degrade petroleum hydrocarbons, mainly including bacteria, fungi and algae. However, there are still few efficient degradation bacteria that can resist high concentration of petroleum hydrocarbons. Therefore, it is urgent to screen and apply degradation bacteria for ex-situ biopile remediation of contaminated soil. SUMMARY

[0004] In view of the shortage of bacterial resources for remediation of soil contaminated by high concentration of petroleum hydrocarbons, the present application provides a strain of Rhodococcus pyridinolus and a microbial agent, which can be applied to biopile soil remediation and microbial agent. The strain has a significant removal effect on petroleum hydrocarbons in soil.

[0005] The technical solutions adopted by the present application are as follows:

[0006] In a first aspect, the present application provides a Rhodococcus pyridinivorans, which was deposited with the China General Microbiological Culture Collection Center on December 11, 2023, and has the accession number of CGMCC No. 29278.

[0007] As a preferred embodiment of the first aspect, the nucleotide sequence of the 16S rRNA gene of the Rhodococcus pyridinivorans is shown in SEQ ID NO. 1.

[0008] In a second aspect, the present application provides a microbial inoculum for biopile soil remediation, wherein the effective component is the Rhodococcus pyridinivorans according to any of the embodiments of the first aspect.

[0009] As a preferred embodiment of the second aspect, the microbial inoculum is a liquid inoculum obtained by fermentation culture of the Rhodococcus pyridinivorans.

[0010] In a third aspect, the present application provides the use of the Rhodococcus pyridinivorans according to any of the embodiments of the first aspect in the remediation of petroleum hydrocarbon contaminated soil.

[0011] In a fourth aspect, the present application provides the use of the microbial inoculum according to any of the embodiments of the second aspect in the remediation of petroleum hydrocarbon contaminated soil.

[0012] As a preferred embodiment of the third aspect or the fourth aspect, the method for removing petroleum hydrocarbon contamination in soil using the microbial inoculum is biopile technology.

[0013] In a fifth aspect, the present application provides a biopile-based method for remediation of petroleum hydrocarbon contaminated soil, characterized in that the petroleum hydrocarbon contaminated soil to be remediated is placed in a pile according to biopile technology, and the microbial inoculum according to any of the embodiments of the second aspect is added to the soil to reach a minimum effective concentration required for remediation, and then the soil is remediated according to biopile technology to degrade petroleum hydrocarbon using the Rhodococcus pyridinivorans in the microbial inoculum.

[0014] As a preferred embodiment of the fifth aspect, carbon source is added during the biopile remediation process.

[0015] As a preferred embodiment of the fifth aspect, the minimum effective concentration is 10 7 CFU / g or more.

[0016] The present application provides a Rhodococcus pyridinivorans and its inoculum, which can degrade 63.25% of petroleum hydrocarbon in 14 days of biopile, and after adding carbon source, the petroleum hydrocarbon degradation rate in 14 days reaches 82.21%, which can be applied to remove petroleum hydrocarbon contamination in soil. BRIEF DESCRIPTION OF DRAWINGS

[0017] Figure 1 The colony morphology of Rhodococcus pyridinivorans in the present application; wherein the left and right pictures show the colonies on LB plates and petroleum hydrocarbon plates, respectively;

[0018] Figure 2 Identification of petroleum hydrocarbon degradation genes of Rhodococcus pyridinivorans in the present application.

[0019] Figure 3 Degradation of petroleum hydrocarbons by Rhodococcus pyridinivorans liquid bacterial agent in the present application.

[0020] Figure 4 Antistress characteristics of Rhodococcus pyridinivorans on petroleum hydrocarbons in the present application.

[0021] Figure 5 Simulation of petroleum hydrocarbon degradation characteristics in the present application.

[0022] Figure 6 Survival and proliferation characteristics of Rhodococcus pyridinivorans in simulated biopile in the present application.

[0023] Biological preservation

[0024] Rhodococcus pyridinivorans was preserved in the China General Microbiological Culture Collection Center on December 11, 2023, at address: No. 1, Beichen West Road, Yard 3, Beijing Chaoyang District, Institute of Microbiology of Chinese Academy of Sciences, postcode: 100101, with preservation number CGMCC No. 29278. DETAILED DESCRIPTION

[0025] The present application will be further described in detail below with reference to the accompanying drawings, which are an explanation of the present application rather than a limitation. In the following examples, the methods used are conventional methods unless otherwise specified, and the reagents used are commercially available products unless otherwise specified.

[0026] The above Rhodococcus pyridinivorans and microbial agent of the present application will be demonstrated below through examples in terms of specific preparation process and application effect.

[0027] Example 1:

[0028] In this example, the isolation and identification process of the Rhodococcus pyridinivorans strain involved in the present application is mainly demonstrated, as follows:

[0029] (1) Single cell separation culture

[0030] Under sterile conditions, 5 g of actual petroleum hydrocarbon contaminated soil was taken to obtain a bacterial suspension by soil bacteria separation method, and a cell screen with a pore size of 40 μm was used to remove impurities and suspended matter, and the concentration of the diluted bacterial solution was 10 2CFU / mL. The diluted bacterial solution was outputted in the form of single droplets by a droplet output device, and the single droplets were added into 96-well plates, 100 μL of inorganic salt medium was added into each well plate, and the petroleum hydrocarbon concentration in each well was 20 mg / L. The droplet output device included a syringe, a micro-injection pump and a needle, the syringe was installed on the micro-injection pump, and the syringe and the needle were connected by a PFA hose; the syringe was used to suck the diluted bacterial solution. The 96-well plate was placed in a microplate shaker, and incubated at 30°C with constant temperature shaking at 180 r / min. The OD value at 600 nm of each well of the bacterial microplate was determined by a full-wavelength microplate reader to obtain the growth of the bacteria in each well.

[0031] The components of the inorganic salt medium used in the example were as follows: KH2PO4 1 g, K2HPO4·3H2O 3 g, MgSO4 0.2 g, FeSO4·7H2O 0.02 g, NaCl 1 g, (NH4)2SO4 0.5 g, CaCl2 0.01 g, trace salt solution 1 mL, and distilled water 1000 mL. The pH of the inorganic salt medium was 7.3, and the inorganic salt medium was autoclaved at 121°C for 20 min before use.

[0032] (2) Isolation and purification

[0033] OD 600 The highest and >0.5 bacterial suspension was selected, and 50 μL of the bacterial suspension was used for isolation and purification. The bacterial suspension was spread on a petroleum hydrocarbon inorganic salt plate, and colonies were cultured at 30°C. Single colonies on the plate were picked and purified on LB plates by multiple "Z" streaking, and no impurities were observed. The single colonies were picked to obtain the purified strain.

[0034] (3) Strain identification

[0035] The strains screened above were identified by combining the physiological and biochemical characteristics of bacteria and 16S rRNA sequences. Colony PCR primers were as follows: colony PCR was performed using bacterial universal primers 27F (5'-AGAGTTTGATCCTGGCTCAG-3'), 1492R (5'-GGTTACCTTGTTACGACTT-3') and NCBI BLAST sequence alignment was used for preliminary identification of the strain species. In the example, the strain was identified as Rhodococcus pyridinivorans, and the obtained single colony was as shown in Figure 1 The above Rhodococcus pyridinivorans was preserved in the China General Microbiological Culture Collection Center on December 11, 2023, and the preservation number was CGMCC No. 29278.

[0036] In addition, the culture of Rhodococcus pyridinovorans, extraction of genomic DNA and identification of degradation genes are as follows:

[0037] The single colony on the plate was inoculated into LB medium, and cultured at 30°C, 180 rpm for 48 h to the late logarithmic phase (OD 600 = 1). Genomic DNA extraction was performed using a genomic DNA extraction kit for gram-negative bacteria, and the extracted DNA solution was stored at -20°C. The PCR primers are as follows:

[0038] bphA3-F AACAAGGAGATTTCGATGTCGAACAAATTGCGCCTT

[0039] bphA3-R CTACGTCTCCTTCTATCAGGCGCTCTCTTTCGGTT

[0040] bphA4-F AGGAGATATACATAGTGCGCTCGATTGCGATTG

[0041] bphA4-R TCGAAATCTCCTTGTTGTCACAGGCCAGACACTTTTCG

[0042] bphC-F GGTAAGCCCGACTACAACACAA

[0043] bphC-R GGAGGCATGCAACACGATGC

[0044] xylE-F GGCACTGACCGGTGTACTTCG

[0045] xylE-R CGACCTTGAAGGCCATCC

[0046] almA-F GACATGTGTATTGTCAAATTTGTGC

[0047] almA-R CCAATGAGATCATGGAAGAAC

[0048] akbD1-F ATGGCAAAAGTGACCGAA

[0049] akbD1-R CTATGCCGCGCGGAAATG

[0050] In this embodiment, according to the colony sequencing result of Rhodococcus pyridinovorans, the nucleotide sequence of the 16S rRNA gene of Rhodococcus pyridinovorans is shown in SEQ ID NO. 1, and the PCR sequencing data of the specific nucleotide sequence are as follows:

[0051]

[0052] The complete gene fragments xylE and akbD were obtained by PCR using the genome of Rhodopseudomonas palustris as a template, and the obtained degradation gene PCR is shown in Figure 2 .

[0053] It should be noted that the formula of the LB medium used in this embodiment is as follows: 10.0 g of tryptone, 5.0 g of yeast extract, 10.0 g of sodium chloride, dissolved in 1000 mL of distilled water, adjusted to pH = 7, and autoclaved at high temperature and high pressure. The formula of the LB medium used in the subsequent embodiments is the same, and will not be repeated here.

[0054] Example 2:

[0055] The present application provides a microbial liquid inoculum for biopile remediation of petroleum hydrocarbon pollution in soil, and the specific preparation method and application effect are shown below.

[0056] Based on the isolated petroleum hydrocarbon-degrading bacteria Rhodopseudomonas palustris (i.e. the aforementioned Rhodopseudomonas palustris with the preservation number CGMCC No. 29278), the microbial amount of Rhodopseudomonas palustris was expanded through fermentation culture with a volume of 5L, and a microbial liquid inoculum for biopile remediation of petroleum hydrocarbon pollution in soil was obtained. The culture conditions are as follows: the culture medium is LB medium, the temperature is 30℃, and the culture is carried out at 180rpm for 48h.

[0057] In this embodiment, the microbial liquid inoculum obtained by final fermentation is applied to degrade petroleum hydrocarbon pollutants. Specifically, petroleum hydrocarbons with a final concentration of 4346.9mg / L are added to the inorganic salt medium in Example 1 to form a petroleum hydrocarbon-inorganic salt solution system; then the microbial liquid inoculum is added to the petroleum hydrocarbon-inorganic salt solution system, and the final concentration of Rhodopseudomonas palustris in the solution is 10 7 CFU / g. A control group without the addition of Rhodopseudomonas palustris microbial liquid inoculum is also set. The petroleum hydrocarbon concentration of the two groups is detected by GC-MS, and the degradation effect of the change in petroleum hydrocarbon concentration is shown in Figure 3 . Figure 3 It can be found from 7 CFU / g, the petroleum hydrocarbon concentration decreased significantly on the second day, with a degradation rate of 30.24%, and the petroleum hydrocarbon degradation rate reached 87.94% on the eighth day after continuous culture.

[0058] It should be noted that the fermentation method used in the preparation of the microbial agent in the present embodiment is relatively mature, and the fermentation culture is mainly to amplify the biomass of the microorganism to meet the subsequent experimental requirements. However, other fermentation methods in the prior art can also be used to prepare the microbial agent of Rhodopseudomonas palustris in the present application. In the finally prepared microbial agent, the effective component is Rhodopseudomonas palustris, but the viable bacterial content can be different, and the microbial agent can also contain other additional components produced during the fermentation process, which will not inhibit the growth and metabolism of Rhodopseudomonas palustris.

[0059] Example 3:

[0060] Based on the microbial liquid agent prepared in Example 2, the present application further provides a soil remediation method for removing petroleum hydrocarbon pollution in soil by biological pile.

[0061] (1) The stress resistance characteristics of Rhodopseudomonas palustris to petroleum hydrocarbons in the present embodiment

[0062] Firstly, the concentration of inoculated Rhodopseudomonas palustris strain was optimized. In the inorganic salt medium in Example 1, 4000 mg / L of petroleum hydrocarbon was added to form a petroleum hydrocarbon inorganic salt solution system. The microbial liquid agent prepared in Example 2 was inoculated in the system, and multiple groups of experiments with different inoculation amounts of Rhodopseudomonas palustris (the final concentration in the solution system was 10 5 ~ 10 7 CFU / g) were set to explore the optimal inoculation amount. The results showed that under the condition of 5000 mg / L of petroleum hydrocarbon concentration, the bacterial amount of the treatment group inoculated with 10 5 CFU / g of Rhodopseudomonas palustris decreased after 24 h; under the condition of 10 6 CFU / g, the bacterial amount did not change significantly after 24 h; and under the condition of 10 7 CFU / g, the bacterial amount increased significantly after 24 h. Therefore, the final concentration of 10 7 CFU / g was selected as the minimum effective concentration of the microbial agent applied to the biological pile. Figure 4

[0063] (2) The petroleum hydrocarbon degradation characteristics in the simulated biological pile in the present application

[0064] The petroleum hydrocarbon contaminated soil to be repaired (the petroleum hydrocarbon content was 3616.7 mg / kg) was pretreated and stacked into a biological pile. The petroleum hydrocarbon degradation characteristics of Rhodopseudomonas palustris in the simulated biological pile were investigated by laboratory simulation experiment. In the present embodiment, Rhodopseudomonas palustris was applied to the petroleum hydrocarbon contaminated soil, and the final concentration of Rhodopseudomonas palustris was 10 7 ​CFU / g, and the soil without adding Rhodopseudomonas palustris was set as a control group. In addition, for the treatment group with added Rhodopseudomonas palustris, two experimental groups were further divided according to whether to supplement carbon source, the soil with only added Rhodopseudomonas palustris was set as a treatment group 1, and the soil with added Rhodopseudomonas palustris and supplemented with an external carbon source (glucose) on the seventh day was set as a treatment group 2. The petroleum hydrocarbon in each treatment group and the control group was detected by GC-MS. The results are shown in Figure 4 As shown in the table, it was found that the petroleum hydrocarbon concentration in the control group did not decrease within 0-10 days, slightly decreased on the 14th day, and the degradation rate was about 30.16%. The petroleum hydrocarbon concentration in the treatment group 1 obviously decreased on the 2nd day, the degradation rate was 37.68%, the petroleum hydrocarbon degradation rate was 61.95% on the 7th day, and the petroleum hydrocarbon degradation rate was 63.25% when the culture was continued to the 14th day. The petroleum hydrocarbon concentration in the treatment group 2 obviously decreased on the 2nd day, the degradation rate was 28.23%, the petroleum hydrocarbon degradation rate was 66.57% on the 7th day, and the petroleum hydrocarbon degradation rate was 82.21% when the culture was continued to the 14th day after the carbon source was added. The petroleum hydrocarbon degradation rate in the treatment group 1 without added carbon source remained unchanged after 7 days, and the petroleum hydrocarbon was not further degraded. However, the petroleum hydrocarbon degradation rate increased after 7 days of added carbon source, and the petroleum hydrocarbon in the soil was further degraded. Figure 4 The above results show that the biological pile of Rhodopseudomonas palustris species can quickly degrade the petroleum hydrocarbon in the soil, and the addition of carbon source is beneficial to the degradation of the petroleum hydrocarbon in the soil.

[0065] (3) Survival and proliferation characteristics of Rhodopseudomonas palustris in the simulated biological pile in the present application

[0066] Rhodopseudomonas palustris was added to the petroleum hydrocarbon contaminated soil (the petroleum hydrocarbon content was 3616.7 mg / kg), and the final concentration of Rhodopseudomonas palustris was 10 7 CFU / g, the soil without added bacteria was set as a control group, the soil with added Rhodopseudomonas palustris was set as a treatment group 1, and the soil with added Rhodopseudomonas palustris and supplemented with an external carbon source (glucose) on the seventh day was set as a treatment group 2. The change of the degradation bacteria concentration was detected based on the fluorescence quantitative value of 16S of Rhodopseudomonas palustris. It was found that the Rhodopseudomonas palustris concentration in the control group maintained at 5.56 log10 orders of magnitude within 0-10 days, and the Rhodopseudomonas palustris concentration increased to 7.42 log10 orders of magnitude on the 14th day. The Rhodopseudomonas palustris concentration in the treatment group 1 increased after the addition of Rhodopseudomonas palustris on the second day, from 7.86 log10 orders of magnitude to 8.07 log10 orders of magnitude, and maintained at 8.01 log10 orders of magnitude on the 14th day. The Rhodopseudomonas palustris concentration in the treatment group 2 was 7.86 log10 on the 7th day, and the Rhodopseudomonas palustris concentration increased to 8.21 log10 on the 10th day after the addition of carbon source, and the Rhodopseudomonas palustris concentration continued to increase to 8.39 log10 on the 14th day Figure 5). The above results show that the Rhodococcus pyridinovorans species can stably colonize in the soil, can utilize the petroleum hydrocarbon in the soil as a substrate to grow, and the addition of a carbon source is beneficial to the growth of the Rhodococcus pyridinovans species in the soil.

[0067] The above Rhodococcus pyridinovans and microbial inoculant thereof can be applied to biopiles for removing petroleum hydrocarbon pollution in the soil, and the biopile has a petroleum hydrocarbon degradation rate of 63.25% in 14 days, and after the addition of a carbon source, the petroleum hydrocarbon degradation rate is 82.21% in 14 days, and can be applied to the removal of petroleum hydrocarbon pollution in the soil.

[0068] It should be noted that the final Rhodococcus pyridinovans concentration in the biopile in the present application can be reasonably optimized according to the actual pollution condition in the soil. If the petroleum hydrocarbon content in the soil is too high, the final Rhodococcus pyridinovans concentration needs to be appropriately increased to avoid growth stress of the Rhodococcus pyridinovans, and therefore the final Rhodococcus pyridinovans concentration needs to reach the minimum effective concentration required for remediation. In actual application, when remediation of petroleum hydrocarbon contaminated soil is performed, the minimum effective concentration required for remediation can be determined through a pre-experiment, and then the petroleum hydrocarbon contaminated soil to be remediated is stacked into a heap body according to the biopile technology, and the final concentration of the microbial inoculant added to the soil needs to reach the minimum effective concentration required for remediation, and then soil remediation is performed according to the biopile technology to utilize the Rhodococcus pyridinovans in the microbial inoculant to degrade petroleum hydrocarbon.

[0069] It should be noted that the biopile technology belongs to the prior art, and the specific method and process parameters can be optimized and adjusted according to actual conditions. Of course, in addition to the biopile technology, the soil to be remediated in the present application can also use other soil remediation technologies, which are not limited.

[0070] The above-described embodiments are only a preferred scheme of the present application, and are not intended to limit the present application. Those skilled in the art can make various changes and modifications without departing from the spirit and scope of the present application. Therefore, any technical scheme obtained by equivalent replacement or equivalent transformation falls within the protection scope of the present application.

Claims

1. A type of pyridine-eating Rhodococcus, characterized in that, The pyridine-containing Rhodococcus ( Rhodococcus pyridinivorans It was deposited on December 11, 2023, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO. 29278.

2. A microbial inoculant for soil remediation in biomass compost, characterized in that, Its active ingredient is the Rhodococcus pyridostigma described in claim 1.

3. The microbial agent as described in claim 2, characterized in that, The microbial agent is a liquid agent obtained by fermenting and culturing the Rhodococcus pyridostigma.

4. The application of Rhodococcus pyridostigma as described in claim 1 in the remediation of petroleum hydrocarbon contaminated soil.

5. The application of the microbial agent according to claim 2 or 3 in the remediation of petroleum hydrocarbon contaminated soil.

6. The application as described in claim 5, characterized in that, The method of using the aforementioned microbial agents to remove petroleum hydrocarbon pollution from soil is called biomass technology.

7. A method for remediating petroleum hydrocarbon-contaminated soil based on biomass piles, characterized in that, The petroleum hydrocarbon-contaminated soil to be remediated is piled up in situ using biomass technology, and the microbial agent described in claim 2 or 3 is added to the soil at a final concentration that meets the minimum effective concentration required for remediation. The soil is then remediated using biomass technology, so as to utilize the pyridine-eating Rhodococcus in the microbial agent to degrade the petroleum hydrocarbons.

8. The method for remediating petroleum hydrocarbon-contaminated soil according to claim 7, characterized in that, Carbon sources need to be added midway through the bioreactor remediation process.

9. The method for remediating petroleum hydrocarbon-contaminated soil according to claim 7, characterized in that, The minimum effective concentration is 10. 7 CFU / g.

Images