Escherichia coli strains for producing 1,4-butanediamine and applications thereof
By constructing a genetically engineered strain of Escherichia coli, knocking out a specific gene and overexpressing argJ, the biosynthetic pathway of 1,4-butanediamine was optimized, solving the problem of dependence on chemical synthesis, realizing efficient production of 1,4-butanediamine, and providing an excellent biomanufacturing pathway.
Patent Information
- Application Number
- CN202311595033.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-11-27
- Publication Date
- 2026-03-03
- Estimated Expiration
- 2043-11-27
AI Technical Summary
The industrial production of 1,4-butanediamine in the present technology relies on chemical synthesis, which has problems such as dependence on non-renewable resources, environmental pollution and high cost, and lacks efficient biomanufacturing methods.
By constructing an Escherichia coli genetically engineered strain, knocking out genes such as argR, patA, puuA, speED, speG, puuP, argF, and ydcSTUV, and overexpressing the argJ gene, the biosynthetic pathway of 1,4-butanediamine was optimized, thereby increasing its yield.
It significantly increased the yield of 1,4-butanediamine by hundreds to nearly two thousand times compared to the original strain, providing an efficient biomanufacturing pathway and a chassis strain for green production.
Smart Images

Figure CN117736951B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of genetic engineering and relates to the breeding of industrial microorganisms, particularly to Escherichia coli chassis strains that produce 1,4-butanediamine and their applications. Background Technology
[0002] 1,4-Butanediamine, also known as putrescine, is a small, positively charged aliphatic compound containing nitrogen. It is the simplest of the biogenic amines (including putrescine, spermine, spermidine, and cadaverine). Biogenic amines were first discovered in 1885 by Ludwig Brieger, a physician in Berlin, Germany, in putrescine, and subsequently named putrescine, spermine, spermidine, and cadaverine. It can polymerize with diacids to form polyamide (PA) materials with different properties (commonly known as nylon), such as PA46 and PA4T. PA46, in particular, is widely used in textiles, machinery, chemicals, electronics, automobile manufacturing, aerospace, and packaging materials due to its high melting point, high crystallinity, high heat resistance, and high mechanical strength, and is considered a high-quality nylon.
[0003] Currently, the industrial production of 1,4-butanediamine mainly relies on petrochemical-based chemical synthesis, which is exclusively monopolized by DSM. Due to the general environmental and economic problems associated with chemical synthesis, the raw materials required are non-renewable petroleum resources, the reaction process requires expensive catalysts, and the synthesis process is highly toxic and flammable, causing adverse effects on human health and the environment. With the increasing emphasis on environmental protection and resource recycling, the green bio-manufacturing of 1,4-butanediamine has become an inevitable trend for future 1,4-butanediamine production.
[0004] One of the keys to the green biomanufacturing of 1,4-butanediamine is the construction of engineered strains that can produce high yields of 1,4-butanediamine. *Escherichia coli* is a natural strain that synthesizes 1,4-butanediamine, which can be achieved through the ornithine decarboxylase pathway (ODC pathway) and the arginine decarboxylase pathway (ADC pathway). Qian et al. constructed the first chassis strain XQ26 (ΔargIΔspeEΔspeGΔpuuPA) for 1,4-butanediamine (ADC) synthesis by knocking out argI in the 1,4-butanediamine (ADC) synthesis pathway, speE in the 1,4-butanediamine degradation pathway, speG and puA in the 1,4-butanediamine reuse pathway, and the 1,4-butanediamine uptake transport protein puP in *E. coli* W3110. They further knocked out the repressor gene ArgR for ornithine synthesis, constructing the second chassis strain XQ38 for 1,4-butanediamine synthesis. Based on this, they overexpressed genes related to the 1,4-butanediamine biosynthesis pathway, constructing a series of strains that synthesize 1,4-butanediamine, and effectively increasing the yield of 1,4-butanediamine. (Qian, ZG; Xia, XX; Lee, SY) (Diamine. Biotechnol. Bioeng. 2009, 104, 651-662.). However, they did not knock out the PatA / YgjG gene for 1,4-butanediamine reuse via the PatA pathway because they believed that the degradation of 1,4-butanediamine by the PatA pathway was negligible. Summary of the Invention
[0005] To address the lack of efficient 1,4-butanediamine-producing bacteria in existing technologies, the purpose of this invention is to provide an efficient Escherichia coli chassis strain for 1,4-butanediamine production through the modification of genetically engineered hosts.
[0006] To achieve the above objectives, the present invention adopts the following technical solution:
[0007] In a first aspect, the present invention provides a genetically engineered Escherichia coli strain that does not express the following genes on the Escherichia coli genome: argR, patA, puuA, speED, speG, puuP, and argF.
[0008] Secondly, the present invention further provides a genetically engineered Escherichia coli strain, which is based on the genetically engineered strain of the first aspect but does not express the gene ydcSTUV.
[0009] Thirdly, the present invention further provides a genetically engineered Escherichia coli strain that, based on the genetically engineered strain of the second aspect, does not express the gene potFGHI.
[0010] Fourthly, the present invention further provides a genetically engineered Escherichia coli strain that, based on the genetically engineered strain of the third aspect, does not express the plaP gene.
[0011] Fifthly, the present invention further provides a genetically engineered bacterium for producing 1,4-butanediamine, which is based on the genetically engineered bacterium described in the first to fourth aspects above by overexpressing the argJ gene.
[0012] In a sixth aspect, the present invention provides a method for producing 1,4-butanediamine using genetically engineered bacteria as described in the first to fifth aspects above, comprising: culturing the genetically engineered bacteria in a culture medium to produce 1,4-butanediamine; and collecting the 1,4-butanediamine from the genetically engineered bacteria and / or the culture medium.
[0013] The advantages and beneficial effects of this invention are as follows:
[0014] This invention first constructed Escherichia coli chassis strains (PUT7, PUT8, PUT9, and PUT10) that are conducive to the efficient synthesis of 1,4-butanediamine. Compared with the starting strains, the yield of 1,4-butanediamine increased by 1363.03%, 1428.74%, 1686.88%, and 1887.52%, respectively, demonstrating significant inventive effects. This invention systematically studied the regulatory genes related to 1,4-butanediamine biosynthesis, the genes related to 1,4-butanediamine degradation and reuse, and the genes related to 1,4-butanediamine transport. Experiments elucidated the effects of not expressing the E. coli genes argF, ydcSTUV, potFGHI, and plaP on 1,4-butanediamine synthesis.
[0015] This invention further demonstrates the promising application prospects of Escherichia coli chassis strains in constructing engineered strains that produce high yields of 1,4-butanediamine, providing excellent chassis strains for the microbial fermentation production of 1,4-butanediamine. Using chassis strains (PUT7, PUT8, PUT9, and PUT10) to overexpress the argJ gene from Corynebacterium glutamicum, and after 24 hours of shake-flask fermentation, the yields of 1,4-butanediamine increased by 1633.29%, 1734.64%, 2044.44%, and 2499.26%, respectively, compared to the starting strains. Attached Figure Description
[0016] Figure 1 The pGRB map of the knockout target plasmid constructed in Example 1 for knocking out the target gene.
[0017] Figure 2Electrophoresis diagram verifying the donor DNA fragment from which the ArgR gene was knocked out in Example 1. Wherein, M: DNA Marker; 1, 2: donor DNA fragments (892bp).
[0018] Figure 3 Example 1: Colony PCR verification electrophoresis images after PUT1-PUT10 gene knockout. Wherein, M is the DNA Marker; ah is the PCR band of the original strain MG1655 genes argR, patA, puA, speE, speG, puP, ydcS, and potF; AH is the colony PCR verification band after knocking out genes argR, patA, puA, speE, speG, puP, ydcS, and potF; 1 is the PCR band of the original strain MG1655 gene plap; 2 and 3 are the colony PCR bands of successfully knocked-out gene plap.
[0019] Figure 4 HPLC detection results of 1,4-butanediamine in Example 2.
[0020] Figure 5 HPLC detection results of 1,4-butanediamine in Example 3. Detailed Implementation
[0021] The present invention will now be described through specific embodiments. Unless otherwise specified, all technical means used in this invention are methods well known to those skilled in the art. Furthermore, the embodiments should be understood as illustrative, not limiting, of the scope of the invention; the essence and scope of the invention are defined only by the claims. For those skilled in the art, various changes or modifications to the material composition and dosage in these embodiments without departing from the essence and scope of the invention also fall within the protection scope of this invention.
[0022] In a first aspect, the present invention provides a genetically engineered Escherichia coli strain that does not express the following genes on the Escherichia coli genome: argR, patA, puuA, speED, speG, puuP, and argF.
[0023] Secondly, the present invention further provides a genetically engineered Escherichia coli strain, which is based on the genetically engineered strain of the first aspect but does not express the gene ydcSTUV.
[0024] Thirdly, the present invention further provides a genetically engineered Escherichia coli strain that, based on the genetically engineered strain of the second aspect, does not express the gene potFGHI.
[0025] Fourthly, the present invention further provides a genetically engineered Escherichia coli strain that, based on the genetically engineered strain of the third aspect, does not express the plaP gene.
[0026] According to the first to fourth aspects of the present invention, the way to not express the above-mentioned gene can be done by conventional means in the art, for example, by inactivating or knocking out the gene by conventional means in the art.
[0027] According to the first to fourth aspects of the present invention, "non-expression" means that the amount of the gene expression product is significantly lower than the original level, for example, significantly reduced by at least 50%, 60%, 70%, 80%, 90%, or 100%.
[0028] According to a preferred embodiment of the present invention, the following genes on the *E. coli* genome: argR, patA, puuA, speED, speG, puuP, and argF are knocked out. The knockout can be performed using methods conventional in the art.
[0029] According to the first to fourth aspects of the present invention, the starting strain used to construct the genetically engineered bacteria can be any Escherichia coli, such as the model strains commonly used in the art, such as E. coli MG1655, E. coli W3110, E. coli BL21, E. coli BW25113, etc.
[0030] According to a preferred embodiment of the present invention, the starting strain is E. coli MG1655.
[0031] The genetically engineered Escherichia coli strains according to the first to fourth aspects of the present invention can be used as chassis strains for the production of 1,4-butanediamine.
[0032] Fifthly, the present invention further provides a genetically engineered bacterium for producing 1,4-butanediamine, which is based on the genetically engineered bacterium described in the first to fourth aspects above by overexpressing the argJ gene.
[0033] According to a fifth aspect of the invention, overexpression means that the amount of the gene expression product is significantly higher than the original level, for example, significantly increased by 150% or more, 200% or more, 300% or more.
[0034] According to a fifth aspect of the present invention, the overexpression of the gene argJ can be achieved by introducing and / or increasing the copy number of the gene argJ in the bacterial genome (e.g., by increasing the copy number of the gene argJ through self-replicating plasmids such as pET22b, pET28a, pTrc99a, pSTV28, or by increasing the copy number of the gene argJ in the bacterial chromosome), or by modifying the expression regulatory sequence of the gene argJ (e.g., promoter, ribosome binding site, etc.), or a combination of the above methods.
[0035] According to a preferred embodiment of the present invention, the argJ gene is derived from Corynebacterium glutamicum.
[0036] In a sixth aspect, the present invention provides a method for producing 1,4-butanediamine using genetically engineered bacteria as described in the first to fifth aspects above, comprising: culturing the genetically engineered bacteria in a culture medium to produce 1,4-butanediamine; and collecting the 1,4-butanediamine from the genetically engineered bacteria and / or the culture medium.
[0037] According to a sixth aspect of the invention, the 1,4-butanediamine includes not only 1,4-butanediamine in its free form, but also salts or hydrates of 1,4-butanediamine.
[0038] According to a sixth aspect of the invention, the culture of the genetically engineered bacteria can be carried out using methods conventional in the art. The culture medium used for the production of 1,4-butanediamine can be a synthetic or natural culture medium, such as a typical culture medium containing a carbon source, a nitrogen source, a sulfur source, inorganic ions, and other desired organic and inorganic components.
[0039] The genetically engineered bacteria can be cultured under aerobic conditions for 12 to 72 hours, or 16 to 48 hours, or 20 to 30 hours; the culture temperature can be controlled within 30 to 45°C, or 30 to 37°C; and the pH can be adjusted between 5.0 and 8.0, or 6.0 and 7.5, or 6.8 and 7.2.
[0040] After cultivation, solids, such as cells and cell debris, can be removed from the liquid culture medium using conventional techniques (e.g., centrifugation, membrane filtration). 1,4-Butanediamine can then be recovered from the fermentation broth using any combination of conventional techniques (e.g., concentration, ion exchange chromatography, crystallization).
[0041] Other specific operational methods involving molecular biology and genetic engineering can be implemented using technical manuals, textbooks, or literature reports readily available to those skilled in the art, and need not be described in detail here. Furthermore, specific starting strains were selected in the following examples, and specific target genes and primers were chosen based on these starting strains. However, this does not mean that the objective of the present invention can only be achieved through these specific selections, nor should it limit the scope of the present invention. The essence and scope of the present invention are defined only by the claims.
[0042] The present invention will be described in more detail below through specific embodiments.
[0043] Example 1: Construction of Escherichia coli chassis strains
[0044] In this embodiment, Escherichia coli MG1655 (Escherichia coli str.K-12substr.MG1655) was used as the starting strain. The following genes in E. coli were knocked out one by one using CRISPR-Cas9 technology: argR, patA, puuA, speED, speG, puuP, argF, ydcSTUV, potFGHI, and plaP to construct an E. coli chassis strain for 1,4-butanediamine synthesis. The procedure is summarized as follows: Using the E. coli MG1655 genome as a template, the upstream and downstream homologous arm sequences of the target genes argR, patA, puuA, speED, speG, puuP, argF, ydcSTUV, potFGHI, and plaP were amplified by PCR. The upstream and downstream homologous arm sequences of the gene were then ligated by overlap PCR to obtain recombinant DNA fragments. Using the target gene sequence as a template, a 20 bp target sequence was obtained using the CRISPR RGEN tool. A pair of complementary primers were then synthesized and annealed to form double-stranded DNA. The double-stranded DNA was then ligated with Solution I ligase to the pGRB-BbsI plasmid vector digested with BbsI restriction endonuclease to construct the knockout target plasmid pGRB-target. The recombinant DNA fragment of the corresponding gene and the pGRB-target knockout target plasmid were co-electroplated into E. coli MG1655 electroporated competent cells containing the pRED-Cas9 plasmid. The electroporated cells were then revived in 1 ml SOC medium at 32°C for 2 hours, and then plated on LB medium containing zirconia and ampicillin and cultured at 32°C for 15 hours. Single colonies were selected by colony PCR to verify positive colonies and obtain gene knockout strains. 0.2% L-arabinose was used to eliminate the pGRB-target knockout target plasmid in correct colonies. Further, by increasing the culture temperature of the strains to 42°C to eliminate the pREDCas9 plasmid, E. coli chassis strains without the pREDCas9 plasmid and with the corresponding target gene knocked out were obtained.
[0045] Taking the construction of the argR gene knockout strain PUT1 as an example, the steps include:
[0046] (1) Construction of the argR gene knockout target plasmid pGRB-argR
[0047] Using the argR gene sequence as a template, a 20bp target sequence (cggagccgtagagtggcaag) was obtained using CRISPR RGEN. A pair of complementary primers, gapA-argR-U and gapA-argR-D, were synthesized and annealed to form double-stranded DNA. This DNA was then ligated into the pGRB plasmid, which had been digested with BBSI. The plasmid was then transformed into E. coli JM109 competent cells and evenly spread on LB agar containing 100 μg / mL ampicillin-resistant medium. The cells were incubated overnight at 37°C with the medium inverted. Single colonies were picked for colony PCR verification, yielding the argR gene knockout target plasmid pGRB-argR. The knockout target plasmid map is shown below. Figure 1 As shown.
[0048] The LB solid medium containing ampicillin resistance consists of: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride, and 15 g / L agar powder. It is sterilized at 121°C for 20 min. When the culture medium cools to approximately 50°C after sterilization, ampicillin is added to a final concentration of 100 μg / mL.
[0049] (2) Obtaining the donor DNA fragment for knocking out the argR gene
[0050] Primers for the upstream homologous arm of the argR gene, argR-U1 / argR-U2, and primers for the downstream homologous arm, argR-D1 / argR-D2, were designed. Using the genome of *E. coli* MG1655 as a template, the upstream and downstream homologous arm fragments of the argR gene were amplified by PCR. Then, the donor DNA fragment for knocking out the ArgR gene was obtained by overlap PCR amplification. The verification electrophoresis diagram is shown below. Figure 2 As shown.
[0051] (3) Construction of argR gene knockout strain PUT1
[0052] The donor DNA fragment with the argR gene knocked out and the knockout target plasmid pGRB-argR were co-electrotransformed into *E. coli* MG1655 containing plasmid pRED-Cas9. After electrotransformation, the culture was incubated at 32°C for 2 hours in 1 ml SOC medium, and then plated on LB medium containing azithromycin and ampicillin and incubated at 32°C for 15 hours. Single colonies were selected from the plates for colony PCR verification. Figure 3 As shown in Figure A), the argR gene knockout strain PUT1 was obtained through screening.
[0053] The target plasmid pGRB-argR was induced to knock out using 0.2% L-arabinose. The argR gene knockout bacteria PUT1 were inoculated into 5 mL of LB liquid medium, and zizomycin was added to a final concentration of 50 μg / mL. L-arabinose was then added to a final concentration of 0.2%, and the medium was incubated at 32 °C and 220 rpm. -1 The culture was incubated overnight on a shaker; the induced bacterial culture was streaked on LB agar plates containing azithromycin and incubated overnight at 32°C; then single colonies were picked and inoculated one-to-one onto LB agar plates containing azithromycin and LB agar plates containing azithromycin and ampicillin, and incubated overnight at 32°C; colonies that did not grow on LB agar plates containing azithromycin and ampicillin, but grew on LB agar plates containing azithromycin, were colonies whose knockout target plasmid pGRB-argR had been eliminated.
[0054] The pREDCas9 plasmid elimination method is as follows: The argR gene knockout strain PUT1 is inoculated into 5 mL of LB liquid medium and incubated at 42°C and 220 rpm. -1 Incubate overnight; streak the bacterial culture after induction at 42℃ onto antibiotic-free LB plates and incubate overnight at 37℃; pick single colonies and inoculate them one-to-one onto LB plates containing zizomycin and antibiotic-free LB plates, and incubate overnight at 37℃; colonies that do not grow on zizomycin-containing LB plates but grow on antibiotic-free LB plates are strains that have had the pREDCas9 plasmid eliminated.
[0055] The gene knockout transformation method is E. coli electroporation.
[0056] The SOC culture medium is prepared as follows: For each liter of medium, add 20g tryptone, 5g yeast extract, and 0.5g NaCl to 950ml of deionized water, shaking the container to ensure complete dissolution. Add 10ml of 250mmol / L KCl solution (dissolve 1.86g KCl in 100ml of deionized water to prepare a 250mmol / L KCl solution), adjust the pH to 7.0 with 5mol / L NaOH, and bring the volume to 1L with deionized water. Autoclave at 15psi for 20min, cool to 60℃ or below, and add 20mL of sterile 1mol / L glucose solution. Before use, add 5ml of sterile 2mol / L MgCl2 solution.
[0057] Following the same steps as described above, each target gene was knocked out to construct Escherichia coli chassis strains PUT1-PUT10, as shown in Table 1.
[0058] Table 1. Constructed knockout strains
[0059]
[0060]
[0061] The primer sequences used in this embodiment are shown in Table 2.
[0062] Table 2 Primer sequences
[0063]
[0064]
[0065] Example 2: Application of 1,4-Butanediamine synthesis by fermentation of Escherichia coli chassis strain
[0066] The specific steps of the method for producing 1,4-butanediamine by fermentation in shake flasks using the *E. coli* gene knockout strain PUT1-PUT10 constructed in Example 1 are as follows:
[0067] First, single colonies of PUT1-PUT10 were inoculated into 5 mL of LB liquid medium and incubated at 37°C and 220 rpm. -1 The culture was incubated overnight to prepare the seed culture. Then, 500 μL of the seed culture was transferred to a 250 mL flask containing 25 mL of LB medium at a 2% inoculation ratio and incubated at 37 °C and 220 rpm. -1 Shake-flask fermentation was carried out, and after 24 hours of culture, the fermentation supernatant was collected to prepare test samples. The content of 1,4-butanediamine in the fermentation broth was determined by HPLC.
[0068] The composition and preparation method of the Escherichia coli 1,4-butanediamine fermentation medium are as follows: 10 g / L tryptone, 5 g / L yeast extract, 10 g / L sodium chloride (NaCl), water as solvent, and autoclaving at 121°C for 20 min.
[0069] The sample preparation method described herein is as follows: Dansyl chloride pre-column derivatization combined with HPLC is used for the quantitative detection of the product 1,4-butanediamine. The dansyl chloride pre-column derivatization procedure is as follows:
[0070] Preparation of standard samples: For the preparation of 1,4-butanediamine hydrochloride standard samples, take 2.5 mL of 800 mg·L⁻¹ solution. -1 Using 1,4-butanediamine hydrochloride solution as the sample, 2.5 mL of saturated NaHCO3 solution was added and mixed thoroughly. The pH was then adjusted to 10 with saturated NaOH solution, followed by the addition of 5 mL of the derivatization reagent dansyl chloride (5 g·L⁻¹). -1The compound (soluble in acetone) was thoroughly mixed. The mixture was then incubated in a light-protected water bath at 60°C for 1 hour. After extraction with 10 mL of anhydrous diethyl ether for 10 minutes, the upper organic phase was collected. The ether was allowed to evaporate naturally. This extraction process was repeated twice. The derivatized compound was dissolved in 2.5 mL of acetonitrile solution. The solution was filtered through a 0.22 μm membrane and used for HPLC analysis to prepare a standard curve for 1,4-butanediamine hydrochloride.
[0071] Table 3. Preparation of Standard Samples at Different Concentrations
[0072]
[0073] Treatment of fermentation broth: The fermentation broth was subjected to a process at 12000 r·min -1 After centrifugation for 10 min, 500 μL of the supernatant was taken as a sample. 500 μL of saturated NaHCO3 solution was added and mixed thoroughly. The pH was then adjusted to 10 with saturated NaOH solution. Subsequently, 1 mL of the derivatization reagent dansyl chloride (5 g·L⁻¹) was added. -1 The compound (soluble in acetone) was thoroughly mixed. The mixture was then incubated in a light-protected water bath at 60°C for 1 hour. After extraction with 2 mL of anhydrous diethyl ether for 10 minutes, the upper organic phase was collected. The ether was allowed to evaporate naturally. This extraction process was repeated twice. The derivatized compound was dissolved in 1 mL of acetonitrile solution, filtered through a 0.22 μm filter, and then analyzed by HPLC.
[0074] The chromatographic column used was a C18 column (InfinityLab Poroshell 120EC-C18), the temperature was 30℃, the UV detection wavelength was 254nm, and the injection volume was 10μL. Mobile phase A was ultrapure water, and mobile phase B was chromatographic grade acetonitrile. Both mobile phases were filtered through a 0.22μm filter and sonicated before use. The gradient elution program was set as follows: 0-5 min, 55%-70% B; 5-10 min, 70% B; 10-15 min, 70%-95% B; 15-20 min, 95% B; 20-25 min, 95%-55% B. The total flow rate was set to 0.7 mL / min. -1 .
[0075] HPLC results of the synthesis of 1,4-butanediamine by fermentation of *Escherichia coli* MG1655 and chassis strains PUT1-PUT10 are as follows: Figure 4As shown, the yields of 1,4-butanediamine synthesized by chassis strains PUT1-PUT10 were all increased to varying degrees compared to the starting strain MG1655. Furthermore, the yield of 1,4-butanediamine synthesized by the chassis strains gradually increased with the increase in the number of gene knockouts. Specifically, the yields of 1,4-butanediamine synthesized by chassis strains PUT7, PUT8, PUT9, and PUT10 reached 670.36 mg / L, 700.47 mg / L, 818.75 mg / L, and 910.68 mg / L, respectively, representing increases of 1363.03%, 1428.74%, 1686.88%, and 1887.52% compared to the starting strain MG1655 (45.82 mg / L), and increases of 25.19%, 30.81%, 52.90%, and 70.07% compared to the gene knockout strain PUT6 (535.47 mg / L). This indicates that the yield of 1,4-butanediamine synthesized by fermentation of chassis strains PUT7, PUT8, PUT9 and PUT10 was significantly improved.
[0076] Example 3: Construction of a high-yield 1,4-butanediamine strain based on Escherichia coli chassis strain
[0077] (1) Construction of MG1655 and PUT6-PUT10 overexpressing argJ engineered strains
[0078] Using the chassis strain PUT7-PUT10 constructed in this invention, engineered strains PUT7+argJ, PUT8+argJ, PUT9+argJ, and PUT10+argJ overexpressing the argJ gene were further constructed, along with control strains MG1655+argJ and PUT6+argJ overexpressing argJ using strains MG1655 and PUT6. The fermentation production of 1,4-butanediamine by chassis strain PUT7-PUT10 was studied by overexpressing the argJ gene from Corynebacterium glutamicum.
[0079] The main process for constructing engineered strains is as follows:
[0080] Primers argJF(GGGAATTCcatatggcagaaaaaggcattaccg) / argJR(GGactagtTGAATTCttaagagctgtacgcggagttg) were designed based on the argJ gene (Gene ID: 69621908). Using the Corynebacterium glutamicum SCgG2 gene sequence as a template, the argJ gene fragment was amplified. The argJ gene fragment was digested with NdeI and SpeI, then ligated into the pETPgapA plasmid (constructed by replacing the fragment between BssH II and NdeI on the pET22b plasmid with the PgapA promoter). This ligation was then transformed into E. coli JM109, and single clones were selected for colony PCR verification to obtain the vector pETPgapA-argJ. The pETPgapA-argJ plasmid was transformed into MG1655 and PUT6-PUT10, respectively, and engineered bacteria overexpressing the argJ gene, namely PUT6+argJ, PUT7+argJ, PUT8+argJ, PUT9+argJ, PUT10+argJ and MG1655+argJ, were obtained by screening.
[0081] (2) Detection of 1,4-butanediamine synthesis by fermentation of argJ overexpressing engineered strain
[0082] The yield of 1,4-butanediamine was determined by shake-flask fermentation using the engineered strains PUT7+argJ, PUT8+argJ, PUT9+argJ, and PUT10+argJ, with MG1655+argJ and PUT6+argJ serving as controls. The specific fermentation and detection methods were the same as in Example 2.
[0083] HPLC detection results of 1,4-butanediamine synthesis by engineered strains are as follows: Figure 5As shown, the yields of 1,4-butanediamine synthesized by fermentation using engineered strains PUT7+argJ, PUT8+argJ, PUT9+argJ, and PUT10+argJ overexpressing the argJ gene reached 1032.35 mg / L, 1092.71 mg / L, 1277.23 mg / L, and 1548.12 mg / L, respectively. Compared with the yield of 1,4-butanediamine synthesized by fermentation using engineered strain MG1655+argJ overexpressing the argJ gene (59.56 mg / L), these yields increased by 1633.29%, 1734.64%, 2044.44%, and 2499.26%, respectively; and compared with the yield of 1,4-butanediamine synthesized by fermentation using strain PUT6+argJ overexpressing the argJ gene (835.33 mg / L), these yields increased by 23.59%, 30.80%, 52.91%, and 85.33%, respectively. Meanwhile, when the chassis strains PUT7-PUT10 overexpressed the argJ gene, the yield of 1,4-butanediamine synthesized was increased by 53.99%, 55.80%, 56.02%, and 70.00%, respectively, compared with when they did not express the argJ gene. This indicates that the Escherichia coli chassis strains of the present invention are of great significance for constructing engineered strains with high 1,4-butanediamine production, and can effectively increase the yield of 1,4-butanediamine, providing an excellent chassis strain for the preparation of 1,4-butanediamine by microbial fermentation.
[0084] Although the present invention has been disclosed above with reference to preferred embodiments, it is not intended to limit the present invention. Any person skilled in the art can make various changes, modifications, substitutions and variations in form and detail to these embodiments without departing from the spirit and principles of the present invention. The scope of the present invention is defined by the claims and their equivalents.
Claims
1. An engineered Escherichia coli bacterium, characterized in that: The genetically engineered bacteria do not express the following genes on the genome of Escherichia coli: argR, patA, puuA, speED, speG, puuP , argF , ydcSTUV , potFGHI and plaP ; The genetically engineered bacteria also do not express genes ydcSTUV ; The genetically engineered bacteria also do not express genes potFGHI ; The genetically engineered bacteria also do not express genes plaP ; the starting strain of the genetically engineered bacteria is E. coli MG1655.
2. The genetically engineered bacterium of claim 1, wherein: The genetically engineered bacteria also overexpress the gene argJ.
3. The genetically engineered bacterium of claim 2, wherein: The gene argJ is the C. glutamicum gene argJ.
4. Use of the genetically engineered bacteria of any one of claims 1-3 for the fermentative production of 1,4-butanediamine.
5. A method for producing 1,4-butanediamine using the genetically engineered bacteria according to any one of claims 1 to 3, comprising: culturing the genetically engineered bacteria in a culture medium to allow them to produce 1,4-butanediamine; and collecting the 1,4-butanediamine from the genetically engineered bacteria and / or the culture medium.
Citation Information
Patent Citations
Biochemical synthesis of 1,4-butanediamine
CN101010433A
Mutant microorganism with high ability of producing putrescine and preparation of putrescine using same
CN101679964A
Recombinant microorganism with improved putrescine productivity, and method for producing putrescine using same
CN104136600A