An InDel molecular marker related to fiber length traits of upland cotton and its application

Abstract

The present invention provides an InDel molecular marker related to the fiber length trait of upland cotton and its application, belonging to the technical field of cotton genetic molecular breeding. The nucleotide sequence of the InDel molecular marker related to the fiber length trait of upland cotton provided by the present invention is shown in SEQ ID NO.3. By using the primers for detecting the InDel molecular marker provided by the present invention to perform PCR amplification on cotton varieties or strains, the cotton fiber length of the cotton varieties or strains can be quickly judged, so as to quickly screen out cotton varieties or strains with long fiber traits for breeding, which can greatly accelerate the breeding process of high-yield cotton varieties. Applying the molecular marker provided by the present invention to breeding practice can significantly improve the cotton fiber length, can stably replace the fiber length genotype into the recipient parent, and can accurately, quickly and effectively improve the fiber length of cotton varieties.

Description

Technical Field

[0001] The invention belongs to the technical field of cotton genetic molecular breeding, and in particular relates to an InDel molecular marker related to upland cotton fiber length traits and an application thereof. Background Art

[0002] Cotton (Gossypium spp.) is the most important natural fiber crop in the world and one of the important cash crops. It is of great significance in the world and my country's national economy. Cotton fiber is the most abundant natural renewable textile fiber raw material in the world and is the main economic value of cotton. At present, the global population is growing, social and economic development is changing with each passing day, and people's pursuit of material life is constantly improving. In order to meet people's demand for fiber textiles, the goal of cotton breeding has also undergone corresponding adjustments, from a single pursuit of yield goals to high-yield and high-quality goals.

[0003] Cotton fiber length is one of the important indicators of cotton fiber quality. There is a negative correlation with yield traits such as boll weight, boll number, and lint percentage to varying degrees. How to increase the fiber length of cotton varieties without affecting yield is an important task in the current breeding work to improve cotton fiber quality. Cotton fiber length is a quantitative trait and is controlled by multiple genes. With the rapid development of high-throughput sequencing, a large number of molecular markers have emerged, and molecular marker-assisted breeding has accelerated the positioning of cotton fiber length QTL. However, since the population for QTL positioning is generally a primary population or a secondary population, there is a lot of genetic "noise" during QTL analysis, which is not conducive to the fine positioning of the site and the identification of candidate genes. Therefore, there is an urgent need in the art to provide a molecular marker that can significantly improve cotton fiber length in breeding practice. Summary of the invention

[0004] In view of this, the purpose of the present invention is to provide an InDel molecular marker FL_D01_InDel related to the fiber length trait of upland cotton, which can be used to accurately, quickly and effectively improve the fiber quality of cotton varieties.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] The present invention provides an InDel molecular marker FL_D01_InDel related to the fiber length trait of upland cotton. The nucleotide sequence of the InDel molecular marker FL_D01_InDel is shown in SEQ ID NO.3.

[0007] The present invention also provides a primer pair for detecting the above-mentioned InDel molecular marker FL_D01_InDel, wherein the primer pair comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO.1 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.2.

[0008] The present invention also provides a kit for detecting the fiber length of upland cotton, and the kit comprises the above primer pair.

[0009] The present invention also provides the use of the InDel molecular marker FL_D01_InDel or the primer pair or the kit in detecting the fiber length of upland cotton.

[0010] The present invention also provides the use of the InDel molecular marker FL_D01_InDel or the primer pair or the kit in breeding for improving upland cotton fiber quality.

[0011] The present invention also provides a method for detecting the fiber length of upland cotton, comprising the following steps: using the cotton DNA to be tested as a template, performing PCR amplification with the above primer pair to obtain an amplified product; judging the fiber length of the cotton to be tested according to the size of the amplified product sequence: when the amplified product sequence length is 420 bp, the genotype of the cotton to be tested is FL_D01, and the fiber length of the cotton to be tested is relatively short; when the amplified product sequence is 390 bp, the genotype of the cotton to be tested is fl_D01, and the fiber length of the cotton to be tested is relatively long; when the amplified product sequence is a heterozygous type (the heterozygous type means that the amplified product sequence has both 390 bp and 420 bp band types), the fiber length of the cotton to be tested is between the two.

[0012] Preferably, the reaction system of the PCR amplification includes 2.0 μL of 20-100 ng / μL genomic DNA template, 1.0 μL of 10×Taq Buffer, 0.2 μL of 10 mM dNTPs, 0.1 μL of 2.5 U Taq enzyme, 1.0 μL of 10 μM forward primer, 1.0 μL of 10 μM reverse primer, and 4.7 μL of sterile water.

[0013] Preferably, the reaction procedure of the PCR amplification is pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 57°C for 30 s, extension at 72°C for 45 s, 32 cycles; final extension at 72°C for 10 min; and storage at 16°C.

[0014] The present invention also provides a method for rapidly improving the fiber length of cotton varieties, comprising the following steps: using Luyuan 343 as a donor parent and Lumianyan 22 as a recipient parent to form a mating population, constructing a recombinant inbred line, backcrossing 3 to 5 times continuously with Lumianyan 22 with a single plant of the recombinant inbred line F8 (the recombinant inbred line F8 refers to a single plant obtained after 8 self-pollinations with Luyuan 343 as a donor parent and Lumianyan 22 as a recipient parent), selecting a chr.15 single QTL fragment replacement line of low lint long fiber, which is recorded as SL15 (the fiber length of SL15 is 1.1 to 1.4 mm longer than that of the recipient parent); hybridizing SL15 as a donor parent and Lumianyan 22 as a recipient parent to obtain an exchange plant, self-pollinating the exchange plant, and screening to obtain a homozygous exchange plant containing the fl_D01 genotype, which is recorded as SL15 fl _ D01 ; SL15 fl _ D01 The donor parent and the upland cotton variety are used as the recipient parent for hybridization to obtain the F1 generation, and the exchange plant with the fl_D01 genotype is screened and obtained, and the exchange plant with the recipient parent is backcrossed three times to obtain the BC3F1 generation; the plant with the fl_D01 genotype is selected from the BC3F1 generation plants for 2 to 3 self-pollinations, and the homozygous plant with the fl_D01 genotype is selected during the self-pollination process, and the long-fiber strain can be obtained by multiplying for generations;

[0015] The screening is performed by using the above primer pair for PCR amplification. If the sequence of the amplified product is 390 bp, the cotton genotype to be tested is fl_D01.

[0016] Preferably, the upland cotton varieties include Lumianyan 29, Lumianyan 36, Lu 7619B, Tao 7619, Lumian 301, Lumian 303, Lumian 319, Lumianyan 37 and Lu 6269.

[0017] Beneficial effects of the present invention:

[0018] The present invention proposes for the first time an InDel molecular marker FL_D01_InDel related to the fiber length trait of upland cotton. By using the primers for detecting the InDel molecular marker provided by the present invention to perform PCR amplification on cotton varieties or lines, the cotton fiber length of the cotton varieties or lines can be quickly judged, so as to quickly screen out cotton varieties or lines with long fiber traits for breeding, which can greatly accelerate the breeding process of high-yield cotton varieties and provide excellent gene resources and selection tools for molecular design breeding of cotton yield traits.

[0019] Applying the molecular markers provided by the present invention to breeding practice can significantly increase cotton fiber length, stably replace the fiber length genotype into the recipient parent, accurately, quickly and effectively improve the fiber length of cotton varieties, and cultivate new high-yield and high-quality cotton varieties. Therefore, the development of the molecular markers of the present invention provides technical support for cotton fiber quality improvement breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 This is the polyacrylamide gel band diagram of the InDel molecular marker FL_D01_InDel, where 1 represents the genotype FL_D01 and 2 represents the genotype fl_D01;

[0021] Figure 2 For fine positioning map;

[0022] Figure 3 It is a bar chart of fiber length of improved offspring, including P1: Lu Mian Yan No. 29; P2: Lu Mian Yan No. 36; P3: Lu 7619B; P4: Tao 7619; P5: Lu Mian 301; P6: Lu Mian 303; P7: Lu Mian 319; P8: Lu Mian Yan No. 37; P9: Lu 6269. DETAILED DESCRIPTION

[0023] The present invention provides an InDel molecular marker FL_D01_InDel related to the fiber length trait of upland cotton. The nucleotide sequence of the InDel molecular marker FL_D01_InDel is TAATAATAACAAAATTAACAAATGTCTT (SEQID NO. 3).

[0024] The present invention utilizes single-segment substitution line long-fiber materials and their recurrent parents to construct a fine-mapping population, develops polymorphic InDel molecular markers based on the parent resequencing results, finely locates QTLs related to fiber length traits, and develops a functional InDel molecular marker FL_D01_InDel, which can significantly improve cotton fiber length when applied in breeding practice. The development of this molecular marker provides technical support for cotton fiber quality improvement breeding.

[0025] The present invention also provides a primer pair for detecting the above-mentioned InDel molecular marker FL_D01_InDel, wherein the primer pair comprises a forward primer having a nucleotide sequence as shown in SEQ ID NO.1 and a reverse primer having a nucleotide sequence as shown in SEQ ID NO.2.

[0026] The present invention also provides a kit for detecting the fiber length of upland cotton, the kit comprising the above primer pair. The present invention has no special limitation on other reagents contained in the kit, and any reagent commonly used in PCR amplification in the art can be used.

[0027] The present invention also provides the use of the InDel molecular marker FL_D01_InDel or the primer pair or the kit in detecting the fiber length of upland cotton or in breeding for improving the fiber quality of upland cotton.

[0028] The present invention also provides a method for detecting the fiber length of upland cotton, comprising the following steps: using the cotton DNA to be tested as a template, performing PCR amplification with the above primer pair to obtain an amplified product; judging the fiber length of the cotton to be tested according to the size of the amplified product sequence: when the amplified product sequence length is 420 bp, the genotype of the cotton to be tested is FL_D01, and the fiber length of the cotton to be tested is relatively short; when the amplified product sequence is 390 bp, the genotype of the cotton to be tested is fl_D01, and the fiber length of the cotton to be tested is relatively long; when the amplified product sequence is a heterozygous type, the fiber length of the cotton to be tested is between the two.

[0029] The present invention does not specifically limit the specific method for obtaining the cotton DNA to be tested, and the conventional DNA extraction method in the art can be used. In the present invention, the reaction system of the PCR amplification is based on 10 μL, preferably including 2.0 μL of genomic DNA template of 20-100 ng / μL, 1.0 μL of 10×Taq Buffer, 0.2 μL of 10 mM dNTPs, 0.1 μL of 2.5 U Taq enzyme, 1.0 μL of 10 μM forward primer, 1.0 μL of 10 μM reverse primer, and 4.7 μL of sterile water. The present invention does not specifically limit the specific sources of the above reagents, and conventional commercial products in the art can be used. In the present invention, the reaction procedure of the PCR amplification is preferably 95°C pre-denaturation for 5 min; 95°C denaturation for 30 s, 57°C annealing for 30 s, 72°C extension for 45 s, 32 cycles; 72°C final extension for 10 min; 16°C storage. In the present invention, the size of the amplified product sequence is preferably detected by polyacrylamide gel electrophoresis or sequencing, and the band types of the genotype FL_D01 and the genotype fl_D01 in polyacrylamide gel electrophoresis are recorded as "1" and "2", respectively. Figure 1 shown.

[0030] The present invention also provides a method for rapidly improving the fiber length of cotton varieties, comprising the following steps: using Luyuan 343 as a donor parent and Lumianyan 22 as a recipient parent to form a population, constructing a recombinant inbred line, backcrossing the individual plants of the recombinant inbred line F8 with Lumianyan 22 for 3 to 5 consecutive times, selecting a chr.15 single QTL fragment replacement line of low lint long fiber, which is recorded as SL15 (the fiber length of SL15 is 1.1 to 1.4 mm longer than that of the recipient parent); hybridizing SL15 as a donor parent and Lumianyan 22 as a recipient parent to obtain an exchange plant, self-pollinating the exchange plant, and screening to obtain a homozygous exchange plant containing the fl_D01 genotype, which is recorded as SL15 fl _ D01 ; SL15 fl _ D01 The method comprises the following steps: hybridizing a cotton variety as a donor parent and an upland cotton variety as a recipient parent to obtain an F1 generation, screening an exchange plant with the fl_D01 genotype, and performing three backcrossings with the recipient parent to obtain a BC3F1 generation; screening a plant with the fl_D01 genotype from the BC3F1 generation plants for 2 to 3 self-pollinations, screening a homozygous plant with the genotype of fl_D01 during the self-pollination process, and then breeding for additional generations to obtain a long-fiber strain; the screening comprises performing PCR amplification using the above primer pair, and if the sequence of the amplified product is 390 bp, the genotype of the cotton to be tested is fl_D01.

[0031] The present invention does not specifically limit the specific method for selecting the chr.15 single QTL segment replacement line of low lint long fiber, and the conventional single QTL segment replacement line method in the art can be used. In the present invention, the upland cotton varieties preferably include Lumianyan 29, Lumianyan 36, Lu 7619B, Tao 7619, Lumian 301, Lumian 303, Lumian 319, Lumianyan 37 and Lu 6269. The method for rapidly improving the fiber length of cotton varieties of the present invention can stably introduce the long fiber genotype into the recipient parent, and the method provided by the present invention can increase the fiber length of cotton varieties by 0.7 to 2.8 mm.

[0032] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0033] In the following embodiments, unless otherwise specified, all of them are conventional methods.

[0034] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0035] Example 1

[0036] Process for obtaining the molecular markers of the present invention

[0037] The high-quality Luyuan 343 (LY343) from land-sea distant hybrid and the high-yield upland cotton variety Lumianyan 22 (LMY22) were used as parental mating populations to construct recombinant inbred lines. The individual plants of the recombinant inbred line F8 were backcrossed with LMY22 for four consecutive times. The chr.15 single QTL fragment replacement line with low lint content and long fiber was obtained from the backcross progeny using SSR molecular markers (only the Chr15 chromosome had an introgression fragment, and the other chromosome backgrounds were consistent with LMY22). This line was named SL15, and the fiber length of SL15 was 1.1-1.4 mm longer than that of its recipient parent LMY22, which was a very significant difference (the results are shown in Table 1).

[0038] Table 1 Investigation on fiber length characteristics of SL15 and Lumianyan 22

[0039]

[0040] In order to further identify and isolate fiber length-related loci, a fine-mapping population was constructed using SL15 and LMY22 as parents to identify and isolate QTL loci related to the target trait fiber length. Specifically, the SL15 obtained above was used as the male parent and LMY22 as the female parent, and the F1 generation was obtained by hybridization. Polymorphic SSR primers were used to preliminarily screen plants that only contained SL15 gene components on the D01 chromosome, and an F2 population of 1,860 individuals was obtained after self-pollination. Leaves were taken at the seedling stage, and genomic DNA was extracted using the CTAB method. The genotypes of individual plants in the F2 population were analyzed using known polymorphic SSR primers on the D01 chromosome and polymorphic InDel primers developed based on resequencing data. After the fibers matured, the individual plants were harvested for seed testing, and cotton samples were kept for fiber quality testing. Combined with the F2 population The genotype and fiber length phenotypic data of individual plants were used to identify exchange plants; self-pollinated seeds of exchange plants of the target genotype were collected and planted in rows to obtain the F2:3 population. Leaves were taken at the seedling stage, and genomic DNA was extracted by the CTAB method. The known polymorphic SSR primers on the D01 chromosome and the newly developed polymorphic InDel primers based on the resequencing data were used to perform genotypic analysis on the individual plants of the F2:4 family to identify the homozygous exchange plant rows. After the fiber matured, 20 bolls per row were collected and repeated 3 times for seed testing. Cotton samples were retained for fiber quality testing, and the average fiber length was used as the fiber length of the F2:4 exchange plant rows. The genotype of the exchange plant row combined with the fiber length phenotypic data identified a major QTL site related to fiber length, and the QTL interval was narrowed to 64Kb, which contained 12 candidate genes (the results of fine positioning are shown in Figure 2The parents SL15 and LMY22 have an InDel variation in this interval, that is, there is a 30 bp base deletion in the long-fiber parent SL15 (the deleted base sequence is: TAATAATAACAAAATTAACAAATGTCTT (SEQ ID NO.3)). The InDel is named FL_D01_InDel, and InDel primers are designed at the flanking sequences on both sides of the deletion site. The FL_D01_InDel forward primer sequence is: CAATAACATCATCTCTAGAGGTGTGCG (SEQ ID NO.1); the FL_D01_InDel reverse primer sequence is: CACTTTACTATTATGTTGTTATTGTTTGGA (SEQ ID NO.2), and the amplified fragment length is 420 bp (the nucleotide sequence is shown in SEQ ID NO.4) or 390 bp (the nucleotide sequence is shown in SEQ ID NO.5).

[0041] Example 2

[0042] 40 varieties were used as samples to be tested, and genomic DNA of the samples to be tested was used as a template. PCR amplification was performed using the primer sequences SEQ ID NO.1 and SEQ ID NO.2 of the molecular marker FL_D01_InDel described in Example 1. The PCR amplification system was as follows:

[0043] The PCR system was 10 μL, including 2.0 μL of 20 ng / μL genomic DNA template, 10× Taq Buffer (containing Mg 2+ ) 1.0 μL, 10 mM dNTPs 0.2 μL, 2.5 U Taq enzyme 0.1 μL, 10 μM FL_D01_InDel forward primer and reverse primer 1.0 μL each, and add 4.7 μL of sterile water.

[0044] The PCR amplification reaction procedure is as follows:

[0045] Pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 57°C for 30 s, extension at 72°C for 45 s, 32 cycles (1 cycle refers to denaturation, annealing to extension, 32 cycles refer to the above process 32 times); final extension at 72°C for 10 min; storage at 16°C until the end of the reaction. PCR products were analyzed by polyacrylamide gel banding and sequencing, and the genotypes were recorded.

[0046] The fiber length of the cotton variety is judged according to the sequence and size of the amplified product: when the fragment size of the amplified product is 390bp and the band type is consistent with SL15, the genotype of the cotton sample to be tested is fl_D01, and the fiber length is relatively long; on the contrary, when the fragment size of the amplified product is 420bp and the band type is consistent with LMY22, the genotype of the cotton sample to be tested is FL_D01, and the fiber length is relatively short; if the sequence of the amplified product is heterozygous (there are both 390bp bands and 420bp bands), the genotype of the cotton sample to be tested is FL_D01 / fl_D01, and the fiber length is between the two.

[0047] The results are shown in Table 2. The molecular marker FL_D01_InDel obtained in Example 1 was used to screen 40 germplasms in the natural population. According to genotype identification, it was found that the average fiber length of cotton containing the fl_D01 genotype germplasm was greater than 33 mm, belonging to the long fiber type, while the average fiber length of cotton containing the FL_D01 genotype germplasm was between 27 and 28 mm, and the fiber length was relatively short.

[0048] Table 2 Genotypes and fiber lengths of 40 randomly selected cotton varieties

[0049]

[0050]

[0051] Example 3

[0052] Rapidly improve the fiber length of cotton varieties using the FL_D01_InDel marker obtained in Example 1

[0053] The SL15 obtained in Example 1 was used as the donor parent and the Lumianyan 22 was used as the recipient parent for hybridization to obtain an exchange plant. The exchange plant was self-pollinated, and the FL_D01_InDel marker obtained in Example 1 was used for rapid screening to obtain a homozygous exchange plant containing the fl_D01 genotype (the specific detection method is the same as in Example 2), which was recorded as SL15 fl _ D01 .

[0054] The genotype is SL15 fl _ D01The exchange plant of was used as the donor parent (♂), and the conventional upland cotton varieties in production, Lumianyan 29, Lumianyan 36, Lu 7619B, Tao 7619, Lumian 301, Lumian 303, Lumian 319, Lumianyan 37 and Lu 6269, were used as the recipient parents (♀), and the F1 generation was obtained by hybridization; the FL_D01_InDel marker obtained in Example 1 was used to quickly identify the exchange plant containing the fl_D01 genotype (the specific detection method is the same as in Example 2), and then the BC3 generation was obtained by backcrossing three times with the recipient parents. F1 generation; screening from the BC3F1 generation plants (using the FL_D01_InDel marker obtained in Example 1 to quickly screen and obtain homozygous exchange plants containing the fl_D01 genotype (the specific detection method is the same as in Example 2)) the plants with the fl_D01 genotype were self-pollinated 2 to 3 times, and during the self-pollination process, the FL_D01_InDel marker obtained in Example 1 (the specific detection method is the same as in Example 2) was used to identify homozygous plants with the genotype of fl_D01, and the long-fiber variety BC3F2:3 was obtained by multiplication.

[0055] The results are shown in Table 3 and Figure 3 As shown, it is shown that the method of the present invention can stably introduce the long-fiber genotype into the recipient parent, and the fiber length of the cotton variety can be increased by 0.7 to 2.8 mm using the method of the present invention.

[0056] Table 3 Fiber length of the recipient parent and its improved bred lines

[0057]

[0058] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. An InDel molecular marker FL_D01_InDel related to the fiber length trait of upland cotton, characterized in that: The nucleotide sequence of the InDel molecular marker FL_D01_InDel is shown in SEQ ID NO.4 and SEQ ID NO.5; SEQ ID NO.4 and SEQ ID NO.5 differ by 30bp, and the 30bp nucleotide sequence is shown in SEQ ID NO.3; when the nucleotide sequence of the InDel molecular marker FL_D01_InDel is SEQ ID NO.4, the fiber length of upland cotton is relatively short; when the nucleotide sequence of the InDel molecular marker FL_D01_InDel is SEQ ID NO.5, the fiber length of upland cotton is relatively long; when the nucleotide sequence of the InDel molecular marker FL_D01_InDel is SEQ ID NO.4 and SEQ ID NO.5, the fiber length of upland cotton is between the two.

2. A primer pair for detecting the InDel molecular marker FL_D01_InDel according to claim 1, characterized in that: The primer pair includes a forward primer whose nucleotide sequence is shown as SEQ ID NO.1 and a reverse primer whose nucleotide sequence is shown as SEQ ID NO.

2.

3. A kit for detecting the fiber length of upland cotton, characterized in that: The kit comprises the primer pair according to claim 2.

4. Use of a reagent for detecting the InDel molecular marker FL_D01_InDel according to claim 1 in detecting the fiber length of upland cotton or in breeding for improving the fiber quality of upland cotton, characterized in that: When the nucleotide sequence of the InDel molecular marker FL_D01_InDel is SEQ ID NO.4, the fiber length of upland cotton is relatively short; when the nucleotide sequence of the InDel molecular marker FL_D01_InDel is SEQ ID NO.5, the fiber length of upland cotton is relatively long; when the nucleotide sequence of the InDel molecular marker FL_D01_InDel is SEQ ID NO.4 and SEQ ID NO.5, the fiber length of upland cotton is between the two.

5. The use according to claim 4, characterized in that: The reagents include the primer pair according to claim 2.

6. Use of the kit according to claim 3 for detecting the fiber length of upland cotton or for improving the fiber quality of upland cotton breeding, characterized in that: When the nucleotide sequence of the InDel molecular marker FL_D01_InDel is SEQ ID NO.4, the fiber length of upland cotton is relatively short; when the nucleotide sequence of the InDel molecular marker FL_D01_InDel is SEQ ID NO.5, the fiber length of upland cotton is relatively long; when the nucleotide sequence of the InDel molecular marker FL_D01_InDel is SEQ ID NO.4 and SEQ ID NO.5, the fiber length of upland cotton is between the two.

7. A method for detecting the fiber length of upland cotton, characterized in that: The method comprises the following steps: using the DNA of cotton to be tested as a template and performing PCR amplification with the primer pair described in claim 2 to obtain an amplified product; judging the fiber length of the cotton to be tested according to the size of the amplified product sequence: when the length of the amplified product sequence is 420 bp, the genotype of the cotton to be tested is FL_D01, and the fiber length of the cotton to be tested is relatively short; when the amplified product sequence is 390 bp, the genotype of the cotton to be tested is fl_D01, and the fiber length of the cotton to be tested is relatively long; when the amplified product sequence is a heterozygous type, the fiber length of the cotton to be tested is between the two.

8. The method according to claim 7, characterized in that The PCR amplification reaction system, based on 10 μL, includes 2.0 μL of genomic DNA template of 20-100 ng / μL, 1.0 μL of 10×Taq Buffer, 0.2 μL of 10 mM dNTPs, 0.1 μL of 2.5 U Taq enzyme, 1.0 μL of 10 μM forward primer, 1.0 μL of 10 μM reverse primer, and 4.7 μL of sterile water.

9. The method according to claim 7, characterized in that: The reaction procedure of the PCR amplification is as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 57°C for 30 s, extension at 72°C for 45 s, 32 cycles; final extension at 72°C for 10 min; and storage at 16°C.

10. A method for rapidly improving the fiber length of cotton varieties, characterized in that: The method comprises the following steps: using Luyuan 343 as a donor parent and Lumianyan 22 as a recipient parent to form a mating population, constructing a recombinant inbred line, backcrossing the individual plants of the recombinant inbred line F8 with Lumianyan 22 for 3 to 5 times, selecting a chr.15 single QTL fragment replacement line with low lint content and long fiber, which is recorded as SL15; hybridizing using SL15 as a donor parent and Lumianyan 22 as a recipient parent to obtain an exchange plant, self-pollinating the exchange plant, and screening to obtain a homozygous exchange plant containing the fl_D01 genotype, which is recorded as SL15. fl_D01 ; SL15 fl_D01 The donor parent and the upland cotton variety are used as the recipient parent for hybridization to obtain the F1 generation, and the exchange plant with the fl_D01 genotype is screened and obtained, and the exchange plant with the recipient parent is backcrossed three times to obtain the BC3F1 generation; the plant with the fl_D01 genotype is selected from the BC3F1 generation plants for 2 to 3 self-pollinations, and the homozygous plant with the fl_D01 genotype is selected during the self-pollination process, and the long-fiber strain can be obtained by multiplying for generations; The screening is performed by using the primer pair described in claim 2 for PCR amplification. If the sequence of the amplified product is 390 bp, the cotton genotype to be tested is fl_D01.

11. The method according to claim 10, characterized in that The upland cotton varieties include Lumianyan No. 29, Lumianyan No. 36, Lu 7619B, Lumian 301, Lumian 303, Lumian 319, Lumianyan No. 37 and Lu 6269.

Images