A Vitis thornyii VdERF054 gene and its encoded protein and application

Abstract

The present invention relates to the field of biotechnology, and in particular to a Vitis thornyii VdERF054 gene, a protein encoded therein, and an application thereof. The Vitis thornyii VdERF054 gene is located on chromosome 12 of Vitis thornyii, distributed in the 5138849-5140246 region. The amino acid sequence of the protein encoded by the gene is shown in SEQ ID No. 2. And an application of the Vitis thornyii VdERF054 gene in improving the resistance of plants to pathogens after silencing. The VdERF054 gene provided by the present invention can improve the resistance of Kyoho grapes to grape anthracnose after silencing, providing a theoretical basis for grape anthracnose resistance breeding.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a Vitis thornii VdERF054 gene and a coded protein and application thereof. Background Art

[0002] Grape (Vitis vinifera L.) is one of the oldest fruit tree species in the world. It is native to western Asia and is cultivated all over the world. About 95% of the grapes in the world are concentrated in the northern hemisphere. It is one of the most widely planted fruits in the world. Anthracnose is caused by the fungus of the genus Colletotrichum of the subphylum Ascomycetes. It is an important disease of grapes worldwide, seriously affecting the yield and quality of grapes. Grape anthracnose mainly occurs on the cob of the fruit, and can also attack leaves, new shoots, tendrils, fruit stalks and other parts, but the symptoms are not as obvious as on the fruit and cob.

[0003] At present, fungicides are mainly used to control anthracnose in grape cultivation and production. However, the use of fungicides not only harms the environment and health, but also increases the resistance of pathogens. Due to the adverse effects of using fungicides to control the spread of anthracnose, people are increasingly paying attention to breeding anthracnose-resistant fresh-table grapes through hybridization. Previous studies have shown that only a few disease-resistant genes have been reported in the defense response mechanism of grapes in response to anthracnose infection, especially the interaction network between Vitis genus plants and anthracnose, and the isolation and functional analysis of key response genes.

[0004] Genes are carriers of genetic information and can determine the characteristics and functions of organisms. However, sometimes the expression of certain genes can lead to negative effects, such as overexpression may cause disease or abnormal growth. In order to avoid such adverse effects, organisms have evolved a gene silencing mechanism, namely the vigs gene silencing principle. The present invention provides a basis for enriching the theory of grape anthracnose resistance stress and grape anthracnose resistance breeding by analyzing the functional characteristics and mechanism of action of transcription factors involved in the response to anthracnose stress. Summary of the invention

[0005] The technical problem to be solved by the present invention is to provide a Vitis thornii VdERF054 gene and a protein encoded therein, which can improve the resistance of grape fruit to anthracnose after being silenced.

[0006] The present invention is achieved in that:

[0007] The invention firstly provides a Vitis thornii VdERF054 gene, which is located on chromosome 12 of Vitis thornii and distributed in the 5138849-5140246 region.

[0008] Specifically, the nucleotide sequence of the Vitis thornysis VdERF054 gene is shown in SEQ ID No.1.

[0009] The present invention also provides a protein encoded by the Vitis thornii VdERF054 gene, the amino acid sequence of which is shown in SEQ ID NO.2, contains an AP2 structural domain, and has the highest homology with that of Vitis vinifera.

[0010] Finally, the present invention provides the use of the V. thornysis VdERF054 gene in improving the resistance of plants to pathogens after silencing. The expression of the VdERF054 gene is downregulated under pathogen stress, and the resistance of grapes to pathogens is enhanced after silencing VdERF054.

[0011] Furthermore, the pathogen is pathogenic anthrax.

[0012] Furthermore, the plant includes grapes.

[0013] Furthermore, a silencing vector TRV::VdERF054 was constructed to silence the Vitis thunbergii VdERF054 gene.

[0014] Furthermore, the silencing vector is pTRV2 and pTRV2 carrying the target gene VdERF054.

[0015] The present invention has the following advantages:

[0016] The invention provides a Vitis thornii VdERF054 gene, whose nucleic acid sequence is shown in SEQ ID No.1, has a full length of 1398bp, encodes 466 amino acids, and whose amino acid sequence is shown in SEQ ID No.2, contains an AP2 domain, is highly homologous to that of Vitis vinifera, and the encoded protein is located in the cell nucleus.

[0017] The present invention analyzes the expression of VdERF054 in the peel of thorny grape fruits after being infected by anthracnose fungi. Experiments show that as the infection proceeds, the expression level of VdERF054 is downregulated in the later stage, indicating that VdERF054 can respond to grape anthracnose infection.

[0018] The present invention clones the VdERF054 sequence, constructs a silencing vector TRV::VdERF054, and transforms Kyoho fruit and inoculates grape anthracnose. Compared with TRV::00 (control), the disease symptoms are milder. It is verified that silencing VdERF054 can enhance the resistance of Kyoho grapes to grape anthracnose. Therefore, the VdERF054 gene provided by the present invention can improve the resistance of Kyoho grapes to grape anthracnose after silencing, providing a theoretical basis for grape anthracnose resistance breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] The present invention will be further described below in conjunction with embodiments with reference to the accompanying drawings.

[0020] Figure 1This is the clustering analysis of homologous protein sequences of V. davidii and some species VdERF054, where the red font represents V. davidii VdERF054.

[0021] Figure 2 Schematic diagram of the construction of the VdERF054 gene into pCambia2300-GFP and pTRV2-GATEWAY vectors.

[0022] Figure 3 This is a diagram of the structural domain analysis of the V. spinulosa VdERF054 protein.

[0023] Figure 4 Chromosome location of V. spinulosa VdERF054.

[0024] Figure 5 This is a graph showing the analysis of the induced expression of VdERF054 in response to grape anthracnose.

[0025] Figure 6 The figure shows the subcellular localization analysis of VdERF054 (scale bar is 25 μm) and yeast transcriptional activation activity analysis.

[0026] Figure 7 The results of RT-qPCR detection of Kyoho grapes after interference and the analysis of their resistance to anthracnose; A: RT-qPCR detection of the interference efficiency of grapes; B: The phenotype of Kyoho fruit with virus-induced gene-silenced VdERF054 5 days after inoculation with anthracnose (the left is the control, the right is the silenced VdERF054), where the white part is the inoculated fungus block and the part circled by red circles is the lesion. DETAILED DESCRIPTION

[0027] The present invention is described in detail below through embodiments in conjunction with the accompanying drawings, but the present invention is not limited thereto and is only described as an example.

[0028] Unless otherwise specified, the test methods used in the following examples are conventional methods.

[0029] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0030] Bacterial species and plasmids used in the examples:

[0031] The overexpression vector pCambia2300-GFP, interference vector pTRV2-GATEWAY and yeast self-activation vector PGBKT7 used in the experiment; the infecting Agrobacterium used in tobacco epidermal cell localization analysis and virus-induced gene silencing experiments was the GV3101 (p19+pSoup) strain; the Escherichia coli Top10 competent cells used were purchased from TianGen.

[0032] The main reagents used in the examples include reverse transcription kit, RT-qPCR supperMix (Transgen), plasmid extraction kit, plant RNA extraction kit, gel recovery kit, LA high-fidelity enzyme, sucrose, MS powder, Tris, agar powder, CTAB, 75% ethanol, and anhydrous ethanol.

[0033] The culture medium during the induction experiment in the example: 1 / 2MS liquid culture medium.

[0034] Example 1 EFR054 CDS sequence cloning and vector construction

[0035] 1. Use the following primers to clone the full-length and specific fragments of ERF054 from the Vitis thornysis cDNA library.

[0036] SEQ ID No.3:

[0037] p2300-VdERF054-BamHI-F:

[0038] tcggtacccggggatccATGGATGCAGCTAAGGACGGTG

[0039] SEQ ID No.4:

[0040] p2300-VdERF054-SalI-R:

[0041] gctcaccatggtgtcgacCTTTTGGAGGGATCAAGATCAAGAT

[0042] SEQ ID No.5:

[0043] Attb1-VdERF054:

[0044] ggggacaagtttgtacaaaaaagcaggcttc GAACCAGCCTCAACAAGCTC

[0045] SEQ ID No.6:

[0046] Attb2-VdERF054:

[0047] ggggaccactttgtacaagaaagctgggtcAAACCGACTCTGGTGGTGAC

[0048] Note: The lowercase sequence is the adapter primer (vector sequence), and the uppercase sequence is the gene sequence.

[0049] 2. Construction of vector

[0050] Refer to the seamless cloning kits of Bomed and Invitrogen for homologous recombination reaction (such as Figure 2 ), the gel recovery product obtained above was mixed with the linearized vector (pCambia2300-GFP and pTRV2 vector), and the reaction solution was added at the same time. The reaction system was 10μL / 1μL, and the reaction was carried out at 37℃ / 250℃ for 60min, and the ice water bath was used for subsequent reactions. The correct sequence could be used for subsequent experiments after PCR verification and sequencing detection.

[0051] Example 2 Bioinformatics Analysis of VdERF054

[0052] The amino acid sequence of VdERF054 was placed on the BLAST website for sequence comparison, and homologous sequences from different species were downloaded to construct a phylogenetic tree ( Figure 1 The amino acid sequence similarity of VdERF054 was compared using MEGA6. The V. spinulosa VdERF054 gene is located on chromosome 12 of V. spinulosa ( Figure 4 ), distributed in the region 5138849-5140246. The phylogenetic tree was constructed using the maximum likelihood method (NJ). The amino acid sequence of VdERF054 was compared with that of Vitis vinifera, Arabidopsis thaliana, rice, tobacco, tomato and soybean using the Clustw program. Figure 3 As shown, VdERF054 is 1498 bp in length and encodes 465 amino acids.

[0053] Example 3 Analysis of the expression pattern of VdERF054 gene

[0054] The thorny grapes were inoculated with anthracnose (Colletosporium spp.) by needle puncture, and the grape skins after inoculation with anthracnose were collected as test materials. RT-qPCR was performed and the expression pattern of the VdERF054 gene was analyzed. The results are shown in Figure 5 As shown in the figure, the expression level of VdERF054 in the peel of thorny grapes at 0d, 1d, 2d, 4d and 6d after inoculation with grape anthracnose reached the lowest value on the 6th day as the infection progressed, indicating that VdERF054 can be induced to express in response to grape anthracnose.

[0055] Example 4 Analysis of tobacco subcellular localization and transcriptional autoactivation

[0056] The correctly sequenced recombinant plasmid was transferred into Agrobacterium GV3101 using the electroporation method. The correct bacterial solution was expanded in 10mL LB liquid culture medium containing the same antibiotics. Centrifuge at 5000rpm for 5min, discard the supernatant, resuspend the bacteria with a resuspension solution (MES2.130g / L+MgCl 22.03g / L+sucrose 20g / L) and wash 3 times. Dilute the resuspended bacterial solution to OD600=0.4, then add AS (200mmol·L-1) and stand at room temperature for 3h in a dark place to activate Agrobacterium. Use a 1mL syringe without a needle to inject the resuspended bacterial solution on the back of a healthy Nicotiana benthamiana leaf, culture it in a light incubator for 72h, observe the distribution of GFP fusion protein in tobacco leaves under a laser confocal microscope (Leica TCSSP8), and save the picture. The results are as follows Figure 6 As shown, it was shown that the VdERF054-GFP protein was localized in the cell nucleus.

[0057] In order to verify whether VdERF054 has transcriptional activation activity, the present invention uses a yeast system to verify transcriptional activation activity. The CDS of the full-length VdERF054 and five fragments of different lengths were constructed into the pGBKT7 vector, transformed into the yeast strain Y2H Gold and grown on a medium lacking tryptophan, and the full-length VdERF054 and those fragments were tested for their ability to activate the expression of reporter genes ADE2 and HIS3. The empty pGBKT7 was used as a negative control (expressing the binding region of GAL4 alone). The results showed that fragments 2 and 4 had no self-activation activity, fragments 1, 3, and 5 were inhibited from self-activation activity at 10mM 3-AT, and the full-length VdERF054 was inhibited from self-activation activity at 35mM 3-AT.

[0058] Example 5 Analysis of virus-induced gene silencing VdERF054 in grapes and resistance to anthracnose

[0059] The gene silencing used in the present invention is VIGS mediated by tobacco mosaic virus (TRV), that is, by designing a specific fragment of the gene, the specific partial fragment of VdERF054 across 3-UTR is finally connected to the pTRV2 vector using the Gateway vector construction method. Through Agrobacterium transformation, a single clone is picked for verification and the bacteria are shaken. The concentration of the final resuspended Agrobacterium is adjusted to about OD600=1, and then the empty pTRV2 and the pTRV2 carrying the target gene VdERF054 are mixed with pTRV1 at a ratio of 1:1, and mixed at 28°C, 80-100rpm, for 3-4h. Subsequently, the Kyoho grape fruit 2-3 weeks after the color change is immersed in a separate mixture of pTRV1 and pTRV2-ERF054, and vacuum infiltrated for 10 minutes. The co-infiltration of the empty pTRV2 and pTRV1 vectors is used as a negative control experiment. Wipe the surface of the grape fruit with clean absorbent paper to remove any residual bacterial solution, incubate for 24 hours under dark conditions at 26°C and 60% relative humidity, and then culture for 3 days at 26°C, 100 μmol m-2s-1, 16 / 8h (light / darkness) before subsequent tests. The fruit was inoculated with a 5mm diameter spore-like disc spore block inoculated at the puncture site, and placed in a 25°C constant temperature incubator and maintained in humidity. After 5 days, observe the symptoms of the grape fruit and the size of the lesions on the fruit to evaluate the incidence of anthracnose in grapes.

[0060] In order to gain a deeper understanding of the resistance of VdEFRO54 to pathogens in grapes, we used virus-induced gene silencing of VdEFRO54 in Kyoho grapes after color change. RT-qPCR results showed that the expression level of VdEFRO54 in the silenced plants (TRV::EFRO54) was significantly decreased ( Figure 7 Middle A); The results of inoculating the silenced and control grape berries with anthracnose for 5 days showed that compared with the control (TRV::00), the TRV::EFRO54 silenced berries had less obvious lesions ( Figure 7 (B), indicating that silencing TRV::EFRO54 can enhance the resistance of grape fruit to anthracnose.

[0061] Although the specific implementation modes of the present invention are described above, those skilled in the art should understand that the specific implementation modes described are only illustrative and are not intended to limit the scope of the present invention. Equivalent modifications and changes made by those skilled in the art in accordance with the spirit of the present invention should be included in the scope of protection of the claims of the present invention.

Claims

1. A thorny grape VdERF054 The use of a gene in improving plant resistance to pathogens after silencing, characterized in that: The thorny grape VdERF054 The nucleotide sequence of the gene is shown in SEQ ID No. 1; the pathogen is pathogenic anthracnose, and the plant is Kyoho grape.

2. The use according to claim 1, characterized in that: Its amino acid sequence is shown in SEQ ID NO.2.

Images