Corn NAC transcription factor and application thereof in enhancing disease resistance

Abstract

The invention discloses a corn NAC transcription factor and application thereof in enhancing disease resistance. The corn NAC transcription factor can endow transgenic rice with wide resistance and does not affect the rice yield, and the amino acid sequence of the corn NAC transcription factor is SEQ ID No.2. The sequence of the coding gene of the gene is SEQ ID No.1. Research shows that the corn NAC transcription factor is located in a cell nucleus, the resistance of rice to rice blast caused by magnaporthe oryzae and rice bacterial leaf blight caused by Xanthomonas oryzae can be improved by overexpression of the corn NAC transcription factor in rice, meanwhile, the agronomic traits of the rice are evaluated, it is found that the gene does not affect the ear length and the grain length of the rice, and the corn NAC transcription factor can be used for improving the rice resistance to rice blast caused by magnaporthe oryzae and the rice bacterial leaf blight caused by Xanthomonas oryzae. Thousand seed weight and single plant yield.

Description

Technical Field

[0001] The invention belongs to the technical field of genetic engineering, and in particular relates to a corn NAC transcription factor gene and an application thereof in enhancing plant disease resistance. Background Art

[0002] Rice (Oryza sativa L.) is one of the three major staple crops along with wheat (Triticum aestivum L.) and maize (Zea mays L.), providing food for more than half of the world's population. Sustainable rice production is therefore crucial to global food security. However, rice production faces increasing threats from various diseases, particularly rice blast caused by the ascomycete Magnaporthe oryzae (of the same genus Pyricularia oryzae Sacc.) and bacterial leaf blight caused by the Gram-negative pathogen Xanthomonas oryzae pv. oryzae (Savary S, Willocquet L, Pethybridge SJ, Esker P, McRoberts N, Nelson A (2019) The global burden of pathogens and pests on major food crops. Nature Ecology & Evolution 3(3):430–439). The use of resistant cultivars is a cost-effective and environmentally sustainable strategy for controlling these diseases. However, limited genetic diversity among rice cultivars often compromises long-term resistance as pathogens rapidly adapt and evolve to overcome plant defenses. In addition, introduction of disease resistance genes such as nucleotide-binding leucine-rich repeat receptors (NLRs) often results in yield losses, further complicating disease management efforts. Expanding the genetic base of rice by integrating non-NLR resistance genes from different species offers a promising approach to enhance disease resistance in a sustainable and environmentally friendly manner.

[0003] NAC domain-containing proteins (hereafter referred to as NAC proteins) are plant-specific transcription factors, and their abbreviation NAC is derived from the names of three proteins: the abbreviation NAC is derived from the names of three proteins: NAM (no apical meristem) in Petunia hybrids, ATAF1 / 2 (Arabidopsis transcription activator 1 / 2) and CUC2 (cup-shaped cotyledon 2) in Arabidopsis (Souer E, van Houwelingen A, Kloos D, Mol J, Koes R (1996) The no apical meristem gene of Petunia is required for pattern formation in embryos and flowers and is expressed at meristem and primordia boundaries. Cel 85:159–170; Aida M, Ishida T, Fukaki H, Fujisawa H, Tasaka M (1997) Gene involved in organ separation in Arabidopsis: an analysis of the cup-shaped cotyledon mutant. Plant Cel 9:841–857).

[0004] NAC proteins are known to regulate a variety of plant processes, including development, senescence, secondary cell wall formation, and responses to various biotic and abiotic stresses (Olsen AN, Ernst HA, Lo Leggio L, Skriver K (2005), NAC transcription factors: structurally distinct, functionally diverse, Trends Plant Science 10: 1360–1385; Nakashima K, Takasaki H, Mizoi J, Shinozaki K, Yamaguchi-Shinozaki K (2012) NAC transcription factors in plant abiotic stress responses. Biochimica et Biophysica Acta 1819(2): 97–103; Shao H, Wang H, Tian X (2015) NAC transcription factors in plant multiple abiotic stress responses: progress and prospects. Frontiers in Plant Science 6: 902). The genome of the maize inbred line B73 encodes 116 NAC proteins. It was reported that among them, ZmNAC15, NAC36, ZmNAC38, ZmNAC41, ZmNAC41 and ZmNAC100 were induced after infection of B73 plants with Coletotrichum graminicola and Ustilago maydis, indicating that they have potential roles in responding to fungal pathogens (Voitsik AM, Muench S, Deising HB, Voll LM (2013) Two recently duplicated maize NAC transcription factor paralogs are induced in response to Coletotrichum graminicola infection. BMC Plant Biology 13:85).For example, the wheat NAC2 gene TaNAC2 negatively regulates resistance to stripe rust, and TaNAC2-silenced wheat lines have enhanced resistance to stripe rust Puccinia striformis (Zhang X, Zhang Q, Pei C, Li X, Huang X, Chang C, Wang X, Huang L, Kang Z (2018) TaNAC2 is a negative regulator in the wheat-stripe rust fungus interaction at the early stage. Physiological and Molecular Plant Pathology 102: 144–153). Interestingly, OsNAC2 negatively regulates resistance to bacterial blight by inhibiting salicylic acid (SA) signaling and forming a stable interaction with the ethylene-responsive transcription factor OsEREBP1 (Zhong Q, Yu J, Wu Y, Yao X, Mao C, Meng X, Ming F (2024) Rice transcription factor OsNAC2 maintains the homeostasis of immune responses to bacterial blight. Plant Physiology 195:785–798) ORE1 is a NAC2 protein in Forsythia suspensa that plays a key role in regulating leaf senescence, as evidenced by accelerated senescence in ORE1-overexpressing strains and delayed senescence in ORE1-knockout strains. ORE1 directly binds to the promoter of the ACS6 gene encoding 1-aminocyclopropane-1-carboxylic acid synthase and upregulates its expression, thereby enhancing the biosynthesis of ethylene, a key hormone for senescence. Under normal conditions, the E3 ubiquitin ligase NITROGEN LIMITATION ADAPTATION (NLA) interacts with ORE1 and promotes its degradation through polyubiquitination, which effectively prevents premature senescence. Interestingly, the vascular wilt pathogen Verticilium dahliae is a necrotic fungus that manipulates this regulatory pathway by secreting the effector protein PevD1 into host cells and directly binding to ORE1. This interaction interferes with the binding of ORE1 to NLA, thereby stabilizing ORE1 and causing premature leaf senescence.This induced senescence enables the pathogen to obtain nutrients from dying tissues, supporting its growth and reproduction on the host (Zhang Y, Gao Y, Wang H, Kan C, Li Z, Yang X, Yin W, Xia X, et al. (2021) Verticilium dahliae secretory effector PevD1 induces leaf senescence by promoting ORE1-mediated ethylene biosynthesis. Molecular Plant 14(11): 1901–1917).

[0005] Here, we report that the non-NLR gene ZmNAC2 from the maize inbred line Yek 478 (GenBank accession number Zm00102aa021658) was transferred into rice to confer resistance to rice blast and rice leaf blight without affecting yield. This study demonstrates that the non-NLR gene ZmNAC2 from maize was transferred into rice to confer broad-spectrum resistance to major rice diseases such as rice blast and bacterial leaf blight. This study highlights the potential of using maize genetic diversity to improve rice resistance to epidemic diseases, thereby promoting sustainable food production and ensuring global food security. Summary of the invention

[0006] The purpose of the present invention is to expand the genetic basis of rice through cross-species transfer of disease resistance genes, providing a promising, sustainable and environmentally friendly method for enhancing rice disease resistance.

[0007] Based on this, the present invention provides an application of a maize NAC transcription factor (NAC2), which can impart broad resistance to transgenic rice without affecting rice yield, and can be used as a candidate gene to provide elements for disease-resistant breeding.

[0008] Specifically, the present invention provides a use of a maize NAC transcription factor (NAC2) or a gene encoding it in enhancing plant disease resistance, wherein the maize NAC transcription factor (NAC2) protein is a protein as shown in 1) or 2) below:

[0009] 1) A protein consisting of the amino acid residue sequence of SEQ ID No. 2 in the sequence listing;

[0010] 2) A protein derived from SEQ ID No. 1 having the function of maize NAC transcription factor (NAC2) by replacing and / or deleting and / or adding one or more amino acid residues in the amino acid residue sequence of SEQ ID No. 2 in the sequence list.

[0011] Wherein, the cDNA nucleotide sequence of the coding gene is shown in 1), 2) or 3) as follows:

[0012] 1) the nucleotide sequence of SEQ ID No.: 1 in the sequence listing;

[0013] 2) a nucleotide sequence that can hybridize with the DNA sequence described in 1) under stringent conditions;

[0014] 3) A nucleotide sequence having more than 90% homology with the nucleotide sequence of SEQ ID No. 1 in the sequence list and encoding a protein having the function of the maize NAC transcription factor (NAC2) gene.

[0015] The plant is preferably rice.

[0016] The disease resistance is the resistance of rice to rice blast caused by Magnaporthe oryzae and / or rice bacterial blight caused by Xanthomonas oryzae.

[0017] The present invention also provides a method for improving plant disease resistance, which comprises transferring the coding gene of the corn transcription factor NAC2 shown in SEQ ID No. 2 into plants, and screening to obtain transgenic plants with improved disease resistance.

[0018] Wherein, the plant is rice, and the disease resistance is the resistance of rice to rice blast caused by Magnaporthe oryzae and / or rice bacterial blight caused by Xanthomonas oryzae.

[0019] The invention clones a maize NAC transcription factor (NAC2) gene (GenBank No. Zm00102aa021658) from maize and names it as ZmNAC2 gene. The cDNA of the gene is 1119 bp, and its nucleotide sequence is shown in the sequence table SEQ ID NO:1; it encodes a 372aa protein, and its amino acid sequence is shown in the sequence table SEQ ID NO:2. It contains a 154 amino acid NAC domain (also called NAM domain, Pfam PF02365) ( Figure 1 , Figure 2 ).

[0020] Since ZmNAC2 contains a nuclear localization signal ( Figure 1), we investigated whether ZmNAC2 is localized in the nucleus like typical transcription factors. We transfected maize protoplasts with ZmNAC2-GFP and labeled them with the fluorescent nuclear stain 4',6-diamidino-2-phenylindole (DAPI). The GFP signal from ZmNAC2-GFP overlapped with DAPI in maize protoplasts, confirming the localization of ZmNAC2 in the nucleus ( Figure 3 B). We further transiently expressed ZmNAC2-GFP in tobacco leaves under the control of the 35S promoter by agroinfiltration. The signal of ZmNAC2-GFP was mainly localized in the nuclei of tobacco epidermal cells ( Figure 3 A).

[0021] To evaluate the role of ZmNAC2 in cross-species disease resistance, we generated transgenic lines of japonica rice cultivar Zhonghua 11 stably expressing ZmNAC2 (from Zm00102aa021658), including OsZmNAC2-1 and OsZmNAC2-4 ( Figure 4 To verify whether ZmNAC2 expression affects the OsNAC2 transcript level in transgenic plants OsZmNAC2, we performed RT-qPCR analysis, and the results showed that OsNAC2 expression remained unchanged in the transgenic lines ( Figure 5 ). In addition, molecular docking based on AlphaFold3 showed that ZmNAC2 and OsNAC2 do not interact and are therefore unlikely to affect each other's functions. As recommended by Khaipho-Burch et al. (2023) and Wang et al. (2023), a comprehensive evaluation of the yield components of T2 transgenic rice lines and Zhonghua 11 was carried out using a randomized complete block design and three biological replicates. Comparative analysis of harvested crop yield indicators showed that the transgenic lines (OsZmNAC2-1 and OsZmNAC2-4) were significantly different from Zhonghua 11 in terms of ear length ( Figure 6 A) Grain size ( Figure 6 B, C), grain weight ( Figure 6 D) and grain weight per hill ( Figure 6 E) and other aspects were not significantly different (p>0.01). These results indicate that the expression of ZmNAC2 does not adversely affect the grain yield of transgenic rice lines. We further evaluated the resistance of transgenic lines to major fungal and bacterial diseases that affect rice production. We phenotypically analyzed the responses of OsZmNAC2-1, OsZmNAC2-4, and Zhonghua11 lines to the rice blast fungus M.oryzae strain SZ5 and the leaf blight pathogen X.oryzae pv.oryzae strain PXO99A. The transgenic lines showed quantitative resistance to rice blast ( Figure 7A). Six days after inoculation (dpi), the blast lesions on the inoculated leaves were significantly reduced (the lesion areas of OsZmNAC2-1 and OsZmNAC2-4 were 0.18 cm 2 and 0.21cm 2 , while the middle flower 11 is 0.35cm 2 )( Figure 7 B; p < 0.001). Similarly, transgenic lines showed quantitative resistance to bacterial wilt ( Figure 8 A), at 14 dpi, the wilt lesions were significantly smaller (the lesion lengths of OsZmNAC2-1 and OsZmNAC2-4 were 0.29 cm and 0.39 cm, respectively, while that of Zhonghua11 was 2.50 cm) ( Figure 8 B; p<0.001). These data confirm that ZmNAC2 can confer broad-spectrum, cross-species disease resistance to transgenic rice without causing yield loss.

[0022] Beneficial effects of the present invention

[0023] 1. Under the same conditions, when OsZmNAC2 transgenic rice plants were inoculated with rice blast fungus and oryzae Xanthomonas oryzae, the disease incidence was significantly reduced compared with the wild-type Zhonghua 11, and the lesion area and length were significantly reduced, indicating that this gene has a certain degree of broad resistance to rice pathogens.

[0024] 2. When evaluating the yield of OsZmNAC2 transgenic rice plants, there were no significant differences in rice panicle length, 1000-grain weight, grain weight per plant and grain length compared with the wild type Zhonghua 11, indicating that this gene does not affect rice yield. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 It is the ZmNAC2 protein domain.

[0026] Figure 2 Prediction of the 3D structure of ZmNAC2 protein.

[0027] Figure 3 Localization of ZmNAC2 in tobacco (A), Bars = 20 μm and protoplasts (B), Bars = 10 μm.

[0028] Figure 4 RT-PCR detection of transgenic rice expression efficiency.

[0029] Figure 5 RT-qPCR detection of rice NAC2 expression efficiency

[0030] Figure 6 Yield assessment of transgenic rice: (A) ear length; (B, C) grain size; (D) thousand-grain weight; (E) grain weight per hill Bars = 1 cm.

[0031] Figure 7 (A) Rice leaves inoculated with rice blast fungus and (B) lesion area measurement.

[0032] Figure 8 (A) Rice leaves inoculated with Xanthomonas oryzae and (B) lesion length measurement.

[0033] Fig. 9 Comparative sequence (A) and structural analysis (B) of ZmNAC2 and OsNAC2.

[0034] Fig.10 Phylogenetic tree of NAC2 from different species.

[0035] Fig.11 Interaction between ZmNAC2 (67-261aa; yellow chain) and OsNAC2 (13-170 and 253-287aa; blue chain). DETAILED DESCRIPTION

[0036] The following specific examples further illustrate the present invention for a better understanding of the present invention. Where specific techniques or conditions are not specified in the examples, the techniques or conditions described in the literature in the art or the product instructions are used. Where the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be obtained commercially.

[0037] Example 1. Obtaining NAC transcription factor (ZmNAC2) and its encoding gene.

[0038] The invention cloned the NAC transcription factor (GenBank No. Zm00102aa021658) from corn and named it ZmNAC2 gene. The cDNA of the gene is 1119 bp, and its nucleotide sequence is shown in the sequence table SEQ ID NO:1; it encodes a 372aa protein, and its amino acid sequence is shown in the sequence table SEQ ID NO:2. It contains a 154 amino acid NAC domain (also called NAM domain, Pfam PF02365) ( Figure 1 , Figure 2 ).

[0039] NAC2 homologs in multiple species were identified by BLAST search of the non-redundant protein database of NCBI using Zm NAC2 protein (Zm00102aa021658) as the query. Multiple sequence alignment of the identified NAC2 homologs was performed using MUSCLE, and a phylogenetic tree was constructed for neighboring sequences using the maximum likelihood method based on the JTT matrix model (Jones DT, Taylor WR, Thornton JM (1992) The rapid generation of mutation data matrices from proteinsequences. Computer Applications in the Biosciences 8: 275–282.). Evolutionary analysis was performed using MEGA16 (Tamura K, Stecher G, Kumar S (2021) MEGA 11: Molecular Evolutionary Genetics Analysis Version 11. Molecular Biology and Evolution 38 (7): 3022–3027). Domain analysis was performed using SMART (Letunic I, Khedkar S, Bork P (2021) SMART: recent updates, new developments and status in 2020. Nucleic Acids Research 49 (D1): D458–D460), and the results showed that all NAC homologs have a NAM domain ( Fig.10). Among them, the genes used in the phylogenetic tree are: Zea mays NAC2 (Zm00102aa021658), Oryza sativa NAC2 (Os04g0460600), Miscanthus lutarioriparius NAC2 (AIS74870.1), Sorghumbicolor NAC2 (AIA57772.1), Panicum virgatum NAC2 (XP_039827702.1), M. floridulus NAC2 (XP_066365423.1), Setaria italica NAC2 (XP_004981295.1), Panicum virgatum NAC2 (XP_039782027.1), Triticum aestivum NAC2 (XP_044399864.1), Leymus chinensisNAC2(WIW78741.1), Aegilops tauschii NAC2(XP_020174665.1), T.dicoccoides NAC2(XP_037444071.1), Hordeum vulgare NAC2(XP_044985633.1)and T.turgidum NAC2(VAI38856.1).

[0040] NAC proteins contain a highly conserved N-terminal NAC / NAM domain (for DNA binding) and a variable C-terminal region (for transcriptional regulation). The NAC / NAM domain has five subdomains (A to E) and adopts a unique folding pattern with three antiparallel β sheets sandwiched between two helices ( Figure 1 , Figure 2 ; Ernst HA, Olsen AN, Larsen S, Lo Leggio L (2004) Structure of the conserved domain of ANAC, a member of the NAC family of transcription factors. EMBO Reports 5(3): 297–303). The eight β-strands of the NAC / NAM domain of ZmNAC2 and OsNAC2 (Os04g0460600 [343aa]) are sandwiched between two helices, deviating from the typical antiparallel β-sheet of six β-sheets commonly found in NAC proteins (including OsNAC2), and were visualized using ESPript v3.0 ( Figure 2 , Fig. 9B, Robert X, Gouet P (2014) Deciphering key features in protein structures with the new ENDscript server. Nucleic Acids Research 42(W1): W320–W324). In addition, OsNAC2 (Os04g0460600 [343aa]) showed significant sequence differences from ZmNAC2, which was attributed to the lack of 75 amino acids in the N-terminal region and the variable C-terminal region ( Fig. 9 A, Fig. 9 B).

[0041] Leaves of maize strain Ye 478 were taken, frozen and ground with liquid nitrogen, and then the leaf RNA was extracted using TRNzol Universal Total RNA Extraction Reagent (DP424) from Tiangen Company; and the RNA was reverse transcribed into cDNA using HiScript III 1st Strand cDNA Synthesis Kit from Vazyme Company.

[0042] Using the above cDNA as a template, the target fragment was amplified by PCR: using F1: TacaccaaatcgactctagaATGACAGCGCAGAAC and R1: CCCTTGCTCACCATcccgggGAAGGGGCCCAACCC as primers, the pCAMBIA1300-ZmNAC2-eGFP fragment was amplified for constructing a positioning vector; using F2: TACTTCTGCACTAGGTACCATGACAGCGCAGAAC and R2: TTAGAATTCCCGGGGATCCGAAGGGGCCCAACCC as primers, the pCAMBIA1390U-ZmNAC2 fragment was amplified for constructing an overexpression vector.

[0043] The total PCR reaction system was 50uL, and the reaction system was as follows: 2×Phanta Max Master Mix 25μL, forward primer (10μM) 2μL, negative primer (10μM) 2μL, template 1μg, ddH 2 Add HO to 50 μL.

[0044] The PCR amplification program was as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 15 sec, annealing at 58°C for 15 sec, extension at 72°C for 2 min, 35 cycles; extension at 72°C for 5 min; and storage at 4°C.

[0045] The PCR amplification products were sequenced, and the results showed that the obtained pCAMBIA1300-NAC2-eGFP and pCAMBIA1390U-ZmNAC2 both contained the ZmNAC2 sequence shown in Sequence 1.

[0046] Example 2: Subcellular localization of ZmNAC2

[0047] To investigate whether ZmNAC2 localizes in the nucleus like typical transcription factors, we transiently co-expressed ZmNAC2-GFP and H in tobacco leaves under the control of the 35S promoter by agroinfiltration. 2 B-mCherry (plasma membrane marker).

[0048] The specific method is as follows:

[0049] 1. Construction of expression vector for subcellular localization

[0050] ZmNAC2 was amplified from the cDNA of the leaves of the maize cultivar Ye 478 and cloned into the pCAMBIA1300 plasmid. Specifically, the pCAMBIA1300-ZmNAC2 obtained in Example 1 was inserted between the XbaI and SmaI enzyme recognition sites of pCAMBIA1300 to obtain a recombinant expression vector for subcellular localization; the sequence was verified to be correct and named pCAMBIA1300-ZmNAC2.

[0051] 2. Subcellular localization in tobacco

[0052] The pCAMBIA1300-ZmNAC2-eGFP vector was transferred into Agrobacterium GV3101, and the transformed Agrobacterium was shaken in LB liquid medium (containing 50 mg / L kanamycin and 100 mg / L rifampicin) until OD 600 The concentration of the cells was about 0.6, and the cells were centrifuged at 5000 rpm for 5 min to collect the cells. 2 , 10 mM MES, 200 μM AS) solution to gently resuspend the cells and adjust the concentration of the bacterial solution to OD 600 = 0.6, and then placed at room temperature for 1-3 hours before injection into four-week-old tobacco leaves for transient expression. After 48 hours, fluorescence observation was performed using a confocal microscope (Leica SP8) and photographs were taken. The results showed that the GFP signal of ZmNAC2-GFP was expressed in the nuclei of tobacco epidermal cells ( Figure 3 A).

[0053] 3. Subcellular localization in maize

[0054] The pCAMBIA1300-ZmNAC2-eGFP plasmid was also used to transform maize protoplasts. The GFP signal of ZmNAC2-eGFP in protoplasts was captured using a laser scanning confocal microscope 16-20 hours after infiltration. DAPI was used as a nuclear marker in the confocal experiments.

[0055] We further transfected protoplasts of maize 478 with ZmNAC2-GFP and stained them with the fluorescent nuclear stain 4',6-diamidino-2-phenylindole (DAPI). ef -GFP signal overlaps with DAPI ( Figure 3 B), confirmed the localization of ZmNAC2 in the nucleus.

[0056] Example 3: Disease resistance detection of ZmNAC2 transfection

[0057] 1. Construction of ZmNAC2-transformed rice overexpression vector

[0058] Os ZmNAC2 was amplified from the cDNA of the leaves of the maize cultivar Ye 478 according to the method of Example 1 and cloned into the pCAMBIA1390U plasmid. Specifically, the pCAMBIA1390U-ZmNAC2 obtained in Example 1 was inserted between the KpnI and BamHI enzyme recognition sites of pCAMBIA1390U to obtain a recombinant expression vector for rice transformation; the vector was sequenced and verified to be correct, and named pCAMBIA1390U-ZmNAC2.

[0059] 2. Obtaining ZmNAC2 Transgenic Rice

[0060] Take 1 μL of plasmid pCAMBIA1390U-ZmNAC2 and add it to 50 μL EHA105 / GV3101 Agrobacterium competent cells. After thorough mixing, incubate in liquid nitrogen for 5 minutes, at 37°C for 5 minutes, and on ice for 5 minutes. After transformation, add 1 mL of LB liquid culture medium (without antibiotics) and mix thoroughly. Pipet it into a 1.5 mL centrifuge tube and culture it on a shaker at 30°C and 180 rpm for 3 hours. Pipet 100 μL of the activated Agrobacterium culture liquid and inoculate it on LB solid culture medium and culture it in the dark at 30°C for 48 hours.

[0061] Select rice grains without mold spots and with normal buds, disinfect them with 75% alcohol for 1 min, wash them with sterile water for 1 min each time, disinfect them with 15% sodium hypochlorite for 20 min, wash them with sterile water 3 times for 1 min each time, inoculate the disinfected Zhonghua 11 rice grains into the induction medium, and culture them at 26°C for 20 days. Pick Agrobacterium tumefaciens in the MMA infection solution and prepare the OD 600= 0.2 Agrobacterium resuspension, pick the callus into a triangular flask, add the Agrobacterium resuspension, infect for 10-15 minutes and then discard the bacterial solution. Inoculate the callus into the co-cultivation medium and co-cultivate at 20℃ for 48-72 hours. The cultured callus was inoculated into a hygromycin B medium and cultured at 26°C for 20-30 days. The positive callus was inoculated into a secondary screening medium. During the callus picking process, a single clone callus must be picked and cultured at 26°C for 7-10 days. The positive callus was inoculated into a differentiation medium and cultured at 25-27°C for 15-20 days under light. After the buds of 2-5 cm were differentiated, it was inoculated into a rooting medium and cultured at 30°C for 7-10 days under light. The leaves of the transgenic plants were taken to extract gDNA. hyg(481)F: CTGCCCGCTGTTCTACAACCGG and hyg(481)R: GGAGCATATACGCCCGGAGTC were used as detection primers. The correct transgenic plants verified by PCR were positive seedlings for subsequent seed breeding experiments.

[0062] For the identification of transgenic expression efficiency in T2 seedlings, RNA from rice leaves was extracted using the RNA extraction method described above and reversed into cDNA, and corresponding detection primers were synthesized: qZmNAC2-F: GCTAAGAAGGGGTCGCTCAG and qZmNAC2-R: GAGTGGGAGATGCTCACGTC as gene detection primers; qOsActin-F: TCCATCTTGGCATCTCTCAG and qOsActin-R: GTACCCTCATCAGGCATCTG as internal reference detection primers, and semi-quantitative RT-PCR was performed to verify the presence and expression of ZmNAC2 in T2 transgenic lines. Transgenic lines of the japonica rice cultivar Zhonghua 11 (ZH11) that overexpressed ZmNAC2 were obtained, including OsZmNAC2-1 and OsZmNAC2-4. At the same time, the expression of rice's own OsNAC2 was detected using primers OsNAC2-F: GAGAAGTCTGGCTGGGTCAT and OsNAC2-R: AACACCCACTCGTTGTTGGA to confirm that overexpression of ZmNAC2 did not affect the expression of rice's own OsNAC2 ( Figure 5 ). In addition, molecular docking based on AlphaFold3 showed that ZmNAC2 and OsNAC2 do not interact with each other and are therefore unlikely to affect each other's functions ( Fig.11 ).

[0063] Reagents used in the above transformation process:

[0064] Induction medium: N6max mother solution (10x) 100mL, N6min mother solution (100x) 10mL, 100xFe 2+-EDTA stock solution 10mL, 100x Vitamin stock solution 10mL, 2,4-D stock solution 2.5mL, Proline 0.6g, CH 0.8g, Sucrose 30g, Phytagel 3g, adjust to pH = 5.8 with KOH, add ddH 2 O to 1 L and sterilize by autoclave.

[0065] Suspension medium: N6max stock solution (10x) 12.5 mL, N6min stock solution (100x) 1.25 mL, Fe 2+ -EDTA stock solution (100x) 1.25 mL, Vitamin stock solution (100x) 2.5 mL, Proline 0.15 g, CH 0.2 g, 2,4-D stock solution 0.625 mL, Sucrose 5 g, adjust to pH = 5.2 with KOH, make up to 250 ml, autoclave, add 5 mL 50% glucose and 250 μL AS stock solution when using.

[0066] Co-culture medium: N6max stock solution (10x) 12.5 mL, N6min stock solution (100x) 1.25 mL, Fe 2+ -EDTA stock solution (100x) 1.25 mL, Vitamin stock solution (100x) 2.5 mL, 2,4-D stock solution 0.625 mL, Proline 0.15 g, CH 0.2 g, Sucrose 7.5 g, Agar powder 2 g, adjust to pH = 5.6 with KOH, make up to 250 ml, and sterilize by high pressure. Add 5 ml of 50% glucose and 250 μl of AS stock solution before use.

[0067] Screening medium: N6 mother solution (10x) 25mL, N6 mother solution (100x) 2.5mL, Fe 2+ -EDTA stock solution (100x) 2.5mL, Vitamin stock solution (100x) 2.5mL, 2,4-D stock solution 0.625mL, Proline 0.15g, CH 0.2g, Sucrose 7.5g Agar powder 2g First add 200mL distilled water, adjust to pH=6.0 with KOH, make up to 250mL, and sterilize by high pressure. When using, add 250μL Hn (50mg / mL) and 500μL Cn (250mg / mL).

[0068] Differentiation medium: MSmax stock solution (10x) 100ml MSmin stock solution (100x) 10ml Fe2+-EDTA stock solution (100x) 10ml Vitamin stock solution (100x) 10ml KT stock solution 2.0ml NAA stock solution 0.2ml Proline 0.6gCH 0.8gD-sorbitol 30gSucrose 30gPhytagel 3.0gFirst add 900ml distilled water, adjust to pH = 5.8 with KOH, make up to 1L, and sterilize by high pressure.

[0069] Rooting medium: MSmax mother solution (10x) 50 mL, MSmin mother solution (100x) 5 mL, Fe2+-EDTA stock solution (100x) 5 mL, Vitamin mother solution (100x) 5 mL, Sucrose 20 g, Phytagel 3 g. Adjust to pH = 5.8 with KOH, make up to 1 L, and sterilize by high pressure.

[0070] MSmax stock solution (10x): NH 4 NO 3 16.5g KH 2 PO 4 1.7g, KNO 3 19.0 g, MgSO 4 7H 2 O 3.7g, CaCl22H2O 4.4g, make up to 1L.

[0071] MSmin mother liquor (100x): MnSO 4 ·4H 2 O 2.23 g, ZnSO 4 7H 2 O 0.86 g, H 3 BO 3 0.62g, KI0.083gNa 2 MoO 4 ·2H 2 O 0.025g, CoCl 2 6H 2 O 0.0025g, CuSO 4 ·5H 2 O0.0025g, Na 2 MoO 4 ·2H 2 O to 1 L and store at room temperature.

[0072] N6max stock solution (10x): KNO 3 28.3g; KH 2 PO4 4.0g; (NH 4 ) 2 SO 4 4.63g; MgSO 4 7H 2 O1.85g; CaCl 2 ·2H 2 O 1.66g, make up to 1L.

[0073] N6 min Mother solution (100x): MnSO 4 ·4H 2 O 0.44g; ZnSO 4 7H 2 O 0.15g; H 3 BO 3 0.16g, KI 0.08g, dissolve them one by one, add ddH 2 O to make up to 1 L.

[0074] Fe2+-EDTA mother solution (100x): FeSO 4 7H 2 O 2.78 g dissolved in 300 mL ddH 2 O, and dissolve Na in 300 mL of 70 °C 2 EDTA·2H 2 O 3.73g, mix the two solutions, keep warm at 70℃ for 2h, make up to 1L, and store at 4℃ in the dark.

[0075] Vitamin mother solution (100x): Nicotinic acid 0.1g, Pyridoxine HCl (VB6) 0.1g, Thiamine HCl (VB1) 0.1g, Glycine 0.2g, Inositol 10g, dilute to 1L after dissolution, and store at 4℃.

[0076] 2,4-D mother solution (1 mg / mL): 100 mg of 2,4-D was added to 1 mL of 1 M KOH and stirred for 5 min, then 10 mL of ddH 2 O and stir until 2,4-D is completely dissolved, make up to 100 mL, and store at 4°C.

[0077] IAA mother solution (1 mg / mL): Add 100 mg of IAA to 1 mL of 1 M KOH and stir until IAA is completely dissolved. 2 O to 100 mL and store at 4°C in the dark.

[0078] NAA stock solution (1 mg / mL): Add 100 mg of NAA to 1 mL of 1 M KOH and stir until NAA is completely dissolved. 2 O to 100 mL and store at 4°C in the dark.

[0079] 1M KOH stock solution: KOH 5.6 g 100 mL ddH 2 O and store at room temperature.

[0080] 0.15% HgCl 2 :HgCl 2 1.5 g with ddH 2 After O is dissolved, dilute to 1000 mL, add 1,000 μL Tween 20, mix well, protect from light, and store at room temperature.

[0081] 200mM AS stock solution: Dissolve 0.39g AS in 10ml DMSO and store in aliquots at -20℃.

[0082] 250mg / ml Cn: Add sterile ddH2O to 2.5g Cn in a clean bench. 2 O to a final volume of 10 mL, completely dissolve, and store at -20°C. 50% glucose: add 50 g of glucose to ddHO 2 Dissolve in 4% 2% 2% NH 2 O, make up to 100 ml, sterilize at 121℃ for 15 min, and store at 4℃.

[0083] 3. Rice infection test

[0084] To evaluate the role of ZmNAC2 in cross-species disease resistance, we generated transgenic lines of the japonica rice cultivar Zhonghua 11 (ZH11) overexpressing ZmNAC2 under the control of the Ubi promoter, including OsZmNAC2-1 and OsZmNAC2-4 ( Figure 4 ). Two lines (T2) were subsequently evaluated further.

[0085] We evaluated the resistance of these transgenic lines to major fungal and bacterial diseases affecting rice production. We investigated the effects of strains ZH11, OsZmNAC2-1, and OsZmNAC2-4 on rice blast (Magnaporthe oryzae) strain SZ5 (kindly provided by Professor Youliang Peng, College of Plant Protection, China Agricultural University, Wang Y, Yue J, Yang N, Zheng C, Zheng Y, Wu X, Yang J, Zhang H, et al. (2023). An ERAD-related ubiquitin-conjugating enzyme boosts broad-spectrum disease resistance and yield in rice. Nature Food 4(9):774–787, publicly available from China Agricultural University) and Xanthomonas oryzae (Xanthomonas oryzae) strain PXO99A (kindly provided by Associate Professor Fuhao Cui, College of Plant Protection, China Agricultural University, Mou B, Zhao G, Wang J, Wang S, He F, Ning Y, Li D, Zheng X, Cui F, Xue F, Zhang S, Sun W. The responses of OsCPK17-OsPUB12-OsRLCK176 moduleregulates immune homeostasis in rice. Plant Cell 36(4):987–1006, publicly available from China Agricultural University) were phenotyped. The leaves of 28-day-old T2 transgenic lines (OsZmNAC2-1 and OsZmNAC2-4) and the parental line Zhonghua 11 (ZH11) of O. sativa cv. were sprayed with inoculation.

[0086] After SZ5 was cultured on OMA for 7-10 days, conidia were collected and centrifuged at 3000 g for 30 s. 2 After washing three times with O, count the conidia using a hemocytometer and prepare a conidia suspension (1×10 per ml). 5 The blast response was phenotyped at 6 days post inoculation (dpi). The lesion area was measured using ImageJ after 6 days.

[0087] The strain PXO99A was inverted and cultured on a NA plate at 28°C for 48 h. After shaking at 200 rpm for 12 h using NA liquid medium, the cells were collected at 8000 rpm for 2 min and then suspended in 10 mM MgCl 2 Before inoculation, adjust the concentration to OD 600=0.8. The leaf cutting method was used to evaluate the virulence. Rice leaves grown for 6 to 8 weeks were selected for inoculation. The scissors were immersed in the bacterial solution and the cut ends were inoculated. The disease of rice was observed regularly during the period. The lesion length was measured at 14 dpi, and the ratio of lesion length to total leaf length was calculated as described previously (Khaipho-Burch M, Cooper M, Crossa J, de Leon N, Holland J, Lewis R, McCouch S, Murray SC, et al. (2023) Genetic modification can improve crop yields-but stop overselling it. Nature 621(7979): 470–473.).

[0088] The transgenic lines showed quantitative resistance to rice blast, with fewer blast lesions on the inoculated leaves six days after inoculation ( Figure 7 A), the leaf area affected by rice blast was significantly reduced (the lesion area of ​​OsZmNAC2-1 and OsZmNAC2-4 was 0.18 cm 2 and 0.21cm 2 , while ZH11 is 0.35cm 2 )( Figure 7 B; p<0.001).

[0089] Likewise, transgenic lines showed quantitative resistance to bacterial wilt ( Figure 8 A), the lesion length was significantly reduced after 14 dpi (the lesion lengths of OsZmNAC2-1 and OsZmNAC2-4 were 0.29 cm and 0.39 cm, respectively, while that of ZH11 was 2.50 cm) ( Figure 8 B; p<0.001). These data confirm that OsZmPIPLC4 ef It can produce broad-spectrum, cross-species resistance without causing yield loss.

[0090] Example 3: Yield Evaluation

[0091] The yield components of the transgenic lines and ZH11 were rigorously evaluated following the randomized complete block design and related best practices outlined by Khaipho-Burch et al. (Khaipho-Burch M, Cooper M, Crossa J, de Leon N, Holland J, Lewis R, McCouch S, Murray SC, et al. (2023) Genetic modification can improve crop yields-but stop overselling it. Nature 621(7979):470–473) and Wang et al. (Wang Y, Yue J, Yang N, Zheng C, Zheng Y, Wu X, Yang J, Zhang H, et al. (2023). An ERAD-related ubiquitin-conjugating enzyme boosts broad-spectrum disease resistance and yield in rice. Nature Food 4(9):774–787). Mature seedlings of strains ZH11, OsZmNAC2-1 and OsZmNAC2-4 were randomly selected for measurement of yield components including ear length, 1000-grain weight and grain size. The experiment adopted a randomized complete design with three biological replicates.

[0092] Comparative analysis of the yield components of the harvested crops revealed that the transgenic lines (OsZmNAC2-1 and OsZmNAC2-4) were significantly different from ZH11 in terms of ear length ( Figure 6 A) Grain size ( Figure 6 B, C), thousand-grain weight ( Figure 6 D; p>0.01) and grain weight per hill ( Figure 6 E; p>0.01). These results indicate that the expression of ZmNAC2 does not have a negative impact on the grain yield of transgenic rice lines.

[0093] The specific embodiments of the present invention are described in detail above, but they are only examples, and the present invention is not limited to the specific embodiments described above. For those skilled in the art, any equivalent modification and substitution of the practical is also within the scope of the present invention. Therefore, the equalization transformation and modification made without departing from the spirit and scope of the present invention should be included in the scope of the present invention.

Claims

1. Application of maize NAC transcription factor in enhancing plant disease resistance, wherein the maize NAC transcription factor protein is the protein shown in 1) or 2) below: 1) A protein consisting of the amino acid residue sequence of SEQ ID No. 2 in the sequence listing; 2) A protein derived from SEQ ID No. 1 having the function of a maize NAC transcription factor by replacing and / or deleting and / or adding one or more amino acid residues in the amino acid residue sequence of SEQ ID No. 2 in the sequence list.

2. The use according to claim 1, characterized in that: The cDNA nucleotide sequence of the maize NAC transcription factor is shown in 1), 2) or 3) below: 1) the nucleotide sequence of SEQ ID No.: 1 in the sequence listing; 2) a nucleotide sequence that can hybridize with the DNA sequence described in 1) under stringent conditions; 3) A nucleotide sequence having more than 90% homology with the nucleotide sequence of SEQ ID No.: 1 in the sequence list and encoding a protein having the function of a maize NAC transcription factor.

3. The use according to claim 1 or 2, characterized in that: The plant is rice.

4. The use according to claim 3, characterized in that: The disease resistance is the resistance of rice to rice blast caused by Magnaporthe oryzae and / or rice bacterial blight caused by Xanthomonas oryzae.

5. A method for improving plant disease resistance, comprising transferring the gene encoding the maize NAC transcription factor shown in SEQ ID No. 2 into plants, and screening transgenic plants with improved disease resistance.

6. The method according to claim 5, wherein the plant is rice, and the disease resistance is resistance of rice to rice blast caused by Magnaporthe oryzae and / or rice bacterial blight caused by Xanthomonas oryzae.

Images