A molecular marker related to wheat cold resistance, KSAP primer combination and its application

Abstract

The present invention discloses a molecular marker related to wheat cold resistance, a KSAP primer combination and its application, and belongs to the field of biotechnology. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, and the 51st bp of the nucleotide sequence is a SNP site with an A / G mutation; the genotype of the SNP site includes AA, AG and GG genotypes. Based on this, the present invention has developed a KASP primer combination for detecting the molecular marker, and tested it using multiple wheat materials, confirming the effectiveness and reliability of the KASP primer combination in detecting or assisting in the identification of wheat cold resistance. It can be used for molecular marker-assisted breeding and has important application value in the research of mining and screening cold-resistant wheat germplasm resources or lines.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a molecular marker related to wheat cold resistance, a KSAP primer combination and applications thereof. Background Art

[0002] Wheat is one of the most widely cultivated crops in the world and my country's second-largest staple food crop after rice. It is crucially important for national food security, sustainable agricultural development, and human well-being. The Huanghuai region, the primary winter wheat-producing region in my country, experiences low winter temperatures, harsh wintering conditions for wheat, and frequent late spring cold snaps. Low temperatures, a significant environmental stress in this wheat-growing region, severely impact wheat growth and yield, hindering agricultural development. Therefore, cold tolerance is a crucial consideration in wheat production and breeding in the Huanghuai region.

[0003] DNA molecular markers are genetic markers based on DNA sequence polymorphisms. Their most significant feature is that they map changes in an organism's genetic material at the DNA level, are unaffected by the external environment, and can be detected at all stages and in all parts of the plant. DNA molecular markers enable early selection of genotypes, shorten breeding cycles, and achieve efficient breeding, making them an emerging technology in wheat cold resistance research. Currently, developed molecular marker technologies fall into three categories: those centered around molecular hybridization, such as restriction fragment length polymorphisms (RFLPs); those centered around PCR, including randomly amplified polymorphic DNA (RAPDs) and simple sequence repeats (SSRs); and those centered around single nucleotide variations, such as single nucleotide polymorphisms (SNPs). SNPs primarily refer to DNA sequence polymorphisms at the genomic level caused by single nucleotide deletions, insertions, transitions, or transversions. SNP markers have been widely used in many aspects such as genetic diversity analysis of crops, construction of linkage maps and molecular marker-assisted selection breeding due to their large number, wide distribution, high genetic stability, high polymorphism, rapid detection and easy automation analysis.

[0004] At present, commonly used SNP detection methods include direct sequencing, gene chip technology, mass spectrometry detection and KASP technology (competitive allele-specific PCR). KASP is a high-throughput fluorescence-based SNP genotyping technology developed by the British company LGC. KASP technology requires the design of two competitive allele-specific forward primers and a reverse primer based on the sequence before and after the target SNP site. By adding different fluorescent groups to the 5' end of the forward primer, the genotype of the target site is determined based on the reading of the PCR terminal fluorescence signal. Compared with other SNP detection methods, KASP technology is more flexible, has a wider range of applications, is lower in cost, and has higher accuracy of results. It can simultaneously meet the requirements of low, medium and high throughput genotyping. KASP molecular markers provide strong technical support for the identification of crop germplasm resources, genetic diversity analysis and molecular marker-assisted breeding. Therefore, exploring SNP sites related to wheat cold resistance and developing KASP molecular markers for identifying SNP site genotypes not only provide an effective detection method for breeding cold-resistant wheat varieties and screening cold-resistant wheat germplasm resources, but also have important significance for improving my country's wheat breeding efficiency, ensuring people's quality of life and sustainable agricultural development. Summary of the Invention

[0005] The present invention aims to provide a molecular marker associated with wheat cold resistance, a KSAP primer combination, and its application to address the above-mentioned problems in the prior art. The KSAP primer combination for detecting this molecular marker can be used for identification or auxiliary identification of wheat cold resistance, detection or screening of cold-resistant wheat germplasm resources, and molecular marker-assisted breeding for wheat cold resistance.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a molecular marker related to wheat cold resistance. The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1. The 51 bp position of the nucleotide sequence is a SNP site with an A / G mutation. The genotype of the SNP site includes AA, AG and GG genotypes.

[0008] The present invention also provides a KASP primer combination for detecting the molecular marker, comprising an upstream primer KASP_PIEP-F as shown in SEQ ID NO.2, an upstream primer KASP_PIEP-H as shown in SEQ ID NO.3, and a downstream primer KASP_PIEP-R as shown in SEQ ID NO.4.

[0009] The primer combination may also be a primer combination consisting of positions 22-41 of the sequence shown in SEQ ID NO.2, positions 22-41 of the sequence shown in SEQ ID NO.3, and the single-stranded DNA shown in SEQ ID NO.4.

[0010] The primer composition may or may not be labeled with a label. The label refers to any atom or molecule that can be used to provide a detectable effect and can be attached to a nucleic acid. Labels include, but are not limited to, dyes; radioactive labels such as 32 P; a binding moiety such as biotin; a hapten such as digoxigenin (DIG); a luminescent, phosphorescent or fluorescent moiety; and a fluorescent dye alone or in combination with a moiety that can inhibit or shift the emission spectrum by fluorescence resonance energy transfer (FRET). The label can provide a signal that can be detected by fluorescence, radioactivity, colorimetry, gravimetry, X-ray diffraction or absorption, magnetism, enzymatic activity, etc. The label can be a charged moiety (positive or negative) or, alternatively, can be charge neutral. The label can include a nucleic acid or protein sequence or a combination thereof, as long as the sequence comprising the label is detectable. In some embodiments, the nucleic acid is directly detected (e.g., directly reading the sequence) without a label.

[0011] The present invention also provides a kit for detecting the molecular marker, comprising the KASP primer combination.

[0012] The present invention also provides the use of the KASP primer combination or the kit in identifying the cold resistance of wheat.

[0013] The present invention also provides a method for identifying the cold resistance of wheat, comprising the following steps:

[0014] Using the genomic DNA of the wheat sample to be tested as a template, the template is amplified by fluorescent quantitative PCR using the KASP primer combination or the kit, after the PCR amplification is completed, the fluorescent signal is read, the fluorescent signal is analyzed and converted, the genotype is identified, and the cold resistance of the wheat to be tested is determined according to the genotype;

[0015] If the identified genotype is AA, it is judged that the cold resistance of the wheat sample to be tested is strong; if the identified genotype is GG, it is judged that the cold resistance of the wheat sample to be tested is weak.

[0016] Furthermore, the program of the fluorescent quantitative PCR amplification is: pre-denaturation at 95°C for 10 minutes; 95°C for 15 seconds, annealing at 61-55°C for 60 seconds, decreasing 0.6°C in each cycle, 10 cycles; denaturation at 95°C for 15 seconds, annealing at 55°C for 1 minute, 32 cycles.

[0017] Furthermore, the fluorescent quantitative PCR amplification system is: 1 μL DNA template; 2×FLu-Arm PCRMix 2.5 μL; KASP_PIEP-F 0.05 μL; KASP_PIEP-H 0.05 μL; KASP_PIEP-R 0.15 μL; ddH2O 1.25 μL.

[0018] The present invention also provides the use of the KASP primer combination or the kit in screening wheat varieties or strains with strong cold resistance.

[0019] The present invention also provides the use of the KASP primer combination or the kit in molecular marker-assisted breeding for the trait of wheat cold resistance.

[0020] Furthermore, the KASP primer combination or the kit is used to identify the cold resistance of wheat, and wheat with strong cold resistance is selected as a parent for breeding; the genotype of the wheat with strong cold resistance is AA.

[0021] The present invention discloses the following technical effects:

[0022] The present invention discovered a molecular marker related to wheat cold resistance and developed a KASP primer combination for detecting the molecular marker based on the discovery. The results of tests using multiple wheat materials confirmed the effectiveness and reliability of the KASP primer combination in detecting or assisting in identifying wheat cold resistance.

[0023] The present invention can be used for molecular marker-assisted breeding and has important application value in the research of mining and screening cold-resistant wheat germplasm resources or strains.

[0024] The method established by the present invention directly uses wheat genomic DNA as a template, and the SNP site genotype can be detected in various tissues and developmental stages of wheat, thereby realizing early detection of wheat genotypes, which is conducive to convenient, efficient and high-throughput prediction of wheat cold resistance. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0026] Figure 1 This is the genotype map of 96 wheat materials detected by KASP_PIEP molecular markers;

[0027] Figure 2The bar graph shows the statistical analysis of KASP_PIEP genotype and cold-resistance phenotype, with * indicating significant difference at P < 0.05. DETAILED DESCRIPTION

[0028] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0029] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0030] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0031] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0032] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0033] The wheat germplasms in the embodiments of the present invention are all stored and provided by the Wheat Center of the Institute of Cereals and Oils Crops, Hebei Academy of Agricultural and Forestry Sciences.

[0034] Example 1 Design of SNP sites and KASP marker primers related to wheat cold resistance

[0035] 1. SNP loci associated with wheat cold resistance

[0036] The present invention screened for a single nucleotide polymorphism (SNP) associated with cold resistance in wheat. This SNP is located in the 3' untranslated region of the wheat cold resistance-associated gene TaPIEP1 and is physically located at bp 613,543,206 of wheat chromosome 4A (http: / / plants.ensembl.org / index.html). The sequence containing this SNP was converted into a KASP molecular marker, designated KASP_PIEP, and used for genotyping and molecular-assisted selection breeding. The nucleotide sequence of the molecular marker KASP_PIEP is shown in SEQ ID NO. 1. The SNP is located at base 51, where the nucleotide type is either A or G (N represents A or G).

[0037] SEQ ID NO.1:

[0038] TACAAGGGATTGATTGATTGTTTGTTGCTAGCTTTGTGGTTGACGGGTGANGTGGAA TGGAGCTTTCCGTGCGTGGGCGCTGACGATGCAGAAGCGGGAATACATGCATGTCCTGA TTGACCAGGTCAAGAGTCCAAAACTTCATGCAAATTTATTTTTGAAAGGATATGC.

[0039] The following AA genotype indicates that the nucleotide type of the SNP site is the homozygous type of A; the GG genotype indicates that the nucleotide type of the SNP site is the homozygous type of G; and the AG genotype indicates that the nucleotide types of the SNP site are the heterozygous type of A and G.

[0040] 2. Design of KASP primers for detecting KASP_PIEP

[0041] The SNP genotyping system based on KASP technology includes three primers: two allele-specific forward primers and a universal reverse primer. The last base at the 3' end of each forward primer corresponds to a different base type at the SNP site.

[0042] The flanking sequences of 150 bp upstream and downstream of the SNP site were obtained, and three KASP primers were designed using a combination of DANMAN software and the online tool Primer3. The primers were synthesized at General Biotechnology Co., Ltd. The specific primer sequences are shown in Table 1. The underlined sequences in Table 1 are universal adapter sequences, the bolded sequences are typing site sequences, and the rest are common amplification sequences.

[0043] Table 1 KASP marker primer sequence list

[0044] Primer name Primer sequence (5'-3') SEQ ID NO. KASP_PIEP-F <![CDATA[ GAAGGTGACCAAGTTCATGCT ctttgtggttgacgggtgaa]]> 2 KASP_PIEP-H <![CDATA[ GAAGGTCGGAGTCAACGGATT ctttgtggttgacgggtgag]]> 3 KASP_PIEP-R tgcatgaagttttggactcttga 4

[0045] KASP technology uses fluorescent groups added to the 5' end of the forward primer to determine the genotype of the target locus based on the fluorescence signal read at the end of the PCR reaction. Primer KASP_PIEP-F has a FAM fluorescent tag sequence (the uppercase portion of the primer sequence) at its 5' end. KASP_PIEP-F and KASP_PIEP-R amplify DNA fragments with an A SNP, generating a FAM fluorescent signal. Primer KASP_PIEP-H has a HEX fluorescent tag sequence (the uppercase portion of the primer sequence) at its 5' end. KASP_PIEP-H and KASP_PIEP-R amplify DNA fragments with a G SNP, generating a HEX fluorescent signal.

[0046] Example 2 Method for detecting SNP genotypes in wheat KASP_PIEP using KASP primers

[0047] 1. DNA extraction

[0048] Genomic DNA was extracted from wheat leaves using the CTAB method, and DNA quality and concentration were determined using a NanoDrop-1000 UV spectrophotometer. High-quality genomic DNA should have an A260 / 230 ratio between 1.8 and 2.2, and an A260 / 280 ratio between 1.8 and 2.0. The DNA was diluted to 50 ng / μL and used as a template for KASP assays and stored at -20°C until use.

[0049] 2. PCR reaction

[0050] The PCR reaction was performed according to the instructions of the KASP labeling kit. Wheat genomic DNA was used as the template, and four blank controls (NTCs) without DNA template were set up.

[0051] Primer dilution: Dilute the three KASP primers to 10 μM with ddH2O and store at -20°C until use.

[0052] The PCR reaction was prepared on ice in a total volume of 5 μL according to Table 2.

[0053] Table 2 PCR reaction system

[0054] Components Volume (μL) DNA template 1 μL 2xFLu-Arm PCR Mix 2.5 μL KASP_PIEP-F 0.05μL KASP_PIEP-H 0.05μL KASP_PIEP-R 0.15μL <![CDATA[ddH2O]]> 1.25 μL Total volume 5μL

[0055] Perform the PCR reaction according to the procedure in Table 3.

[0056] Table 3 PCR reaction procedure

[0057]

[0058] 3. Fluorescence signal reading

[0059] After the PCR reaction, the plate was read on a fluorescence quantitative PCR instrument (BIO-RAD CFX Master) at 30°C for 1 minute to obtain fluorescence data. Fluorescence data is displayed graphically. Wheat germplasm with the AA KASP_PIEP genotype carries the FAM fluorophore, and the fluorescence signal is distributed near the X-axis. Wheat germplasm with the GG KASP_PIEP genotype carries the HEX fluorophore, and the fluorescence signal is located near the Y-axis. Fluorescence signals located in the middle of the coordinate axis indicate that the KASP_PIEP genotype of the wheat germplasm being tested is AG. Fluorescence signals located near the origin of the coordinate axis represent blank controls without DNA template.

[0060] Example 3 Application of KASP_PIEP molecular marker in identifying wheat cold resistance assisted breeding

[0061] 1. Field survey on cold resistance of 96 wheat germplasms

[0062] The 96 accessions were planted in the autumn of 2022 at the Dishang Experimental Station of the Institute of Cereals and Oils Crops, Hebei Academy of Agricultural and Forestry Sciences. After the seeds returned to green in the spring of 2023, their cold hardiness was assessed based on the extent of frost damage to the aboveground parts. The criteria for grading wheat cold hardiness are shown in Table 4.

[0063] Table 4 Classification standards for wheat cold resistance

[0064] grade Identification standards Level 1 No frost damage Level 2 Yellowing of leaf tips due to frost Level 3 Half of the leaves are frozen to death Level 4 All leaves are dry Level 5 The plant or most of the tillers are frozen to death

[0065] Note: Level 1-2 has good cold resistance, level 3 has medium resistance, and level 4-5 has poor cold resistance.

[0066] According to the field cold resistance survey, the cold resistance results of 96 materials are shown in Table 5.

[0067] Table 5 Survey of 96 wheat germplasm genotypes and cold resistance

[0068]

[0069]

[0070]

[0071] Note: NA means no detected signal.

[0072] 2. KASP primer detection of SNP genotype in KASP_PIEP

[0073] The genomic DNA of 96 wheat germplasms to be tested was extracted according to the method described in Example 2, and the genotype of the SNP site in the KASP_PIEP of the wheat to be tested was detected using KASP primers.

[0074] KASP test results are as follows Figure 1 As shown in Table 5, AA indicates that the genotype of the SNP site in the wheat material KASP_PIEP is the homozygous type of A, GG indicates that the genotype of the SNP site in the wheat material KASP_PIEP is the homozygous type of G, and AG indicates that the genotype of the SNP site in the wheat material KASP_PIEP is the heterozygous type of A and G.

[0075] The KASP detection results showed that among the 96 wheat materials, the KASP_PIEP genotype of 22 wheat germplasms was AA, the KASP_PIEP genotype of 63 wheat germplasms was GG, the KASP_PIEP genotype of 8 wheat germplasms was AG, and no fluorescence signal was detected in 3 wheat germplasms.

[0076] 3. Statistical analysis of wheat germplasm KASP_PIEP genotype and cold resistance phenotype

[0077] Based on the KASP test results and cold resistance survey, the two-tailed t-test method was used to statistically analyze the KASP_PIEP genotype and cold resistance phenotype of 96 wheat germplasm materials (germplasm materials without fluorescent signals were not analyzed). The analysis results showed that the cold resistance of wheat germplasm with KASP_PIEP genotype AA was stronger than that of wheat germplasm with genotype GG, and the difference in cold resistance between the two groups reached a significant level; the difference in cold resistance between wheat germplasm with KASP_PIEP genotype AG and the other two groups of wheat germplasm genotypes did not reach a significant level ( Figure 2 )(P<0.01 indicates extremely significant difference, P<0.05 indicates significant difference).

[0078] This indicates that the KASP molecular marker is significantly associated with wheat cold resistance and has high reliability in predicting and assisting with wheat cold resistance identification. Furthermore, in guiding the application of this molecular marker in wheat breeding, materials with the KASP_PIEP genotype AA were selected as parents for breeding to screen and obtain offspring lines with good cold resistance.

[0079] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A molecular marker related to wheat cold resistance, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.

1. The 51 bp position of the nucleotide sequence is a SNP site with an A / G mutation. The genotypes of the SNP site include AA, AG and GG genotypes.

2. A KASP primer combination for detecting the molecular marker according to claim 1, characterized in that: It includes an upstream primer KASP_PIEP-F as shown in SEQ ID NO.2, an upstream primer KASP_PIEP-H as shown in SEQ ID NO.3, and a downstream primer KASP_PIEP-R as shown in SEQ ID NO.

4.

3. A kit for detecting the molecular marker according to claim 1, characterized in that: Comprising the KASP primer combination according to claim 2.

4. Use of the KASP primer combination according to claim 2 or the kit according to claim 3 in identifying the cold resistance of wheat.

5. A method for identifying the cold resistance of wheat, characterized in that: The following steps are involved: Using the genomic DNA of the wheat sample to be tested as a template, performing fluorescent quantitative PCR amplification on the template using the KASP primer combination described in claim 2 or the kit described in claim 3, reading the fluorescent signal after the PCR amplification is completed, analyzing and converting the fluorescent signal, identifying the genotype, and judging the cold resistance of the wheat to be tested based on the genotype; If the identified genotype is AA, it is judged that the cold resistance of the wheat sample to be tested is strong; if the identified genotype is GG, it is judged that the cold resistance of the wheat sample to be tested is weak.

6. The method according to claim 5, characterized in that The program of the fluorescent quantitative PCR amplification is as follows: pre-denaturation at 95°C for 10 min; 95°C for 15 s, annealing at 61-55°C for 60 s, decreasing the temperature by 0.6°C per cycle, for 10 cycles; denaturation at 95°C for 15 s, annealing at 55°C for 1 min, for 32 cycles.

7. The method according to claim 5, characterized in that The fluorescent quantitative PCR amplification system is as follows: 1 μL DNA template; 2×FLu-Arm PCR Mix 2.5 μL; KASP_PIEP-F 0.05 μL; KASP_PIEP-H 0.05 μL; KASP_PIEP-R 0.15 μL; and 1.25 μL ddH2O.

8. Use of the KASP primer combination according to claim 2 or the kit according to claim 3 in screening wheat varieties or lines with strong cold resistance.

9. Use of the KASP primer combination according to claim 2 or the kit according to claim 3 in molecular marker-assisted breeding for the trait of strong or weak cold resistance in wheat.

10. The use according to claim 8 or 9, characterized in that: The KASP primer combination according to claim 2 or the kit according to claim 3 is used to identify the cold resistance of wheat, and wheat with strong cold resistance is selected as a parent for breeding; the genotype of the wheat with strong cold resistance is AA.

Images