A contactin 6 protein mutant and its recombinant expression vector, transformant and application

Abstract

The present invention relates to a contactin 6 protein mutant, its recombinant expression vector, transformant and application, belonging to the field of biomedical technology. The present invention uses immunoprecipitation technology to determine the key amino acid sites mediating homologous interaction in the contactin 6 protein, which are glutamic acid at position 125 and arginine at position 217 of the contactin 6 protein. The PCR technology is used to amplify the contactin 6<supgt;E125A< / supgt; and contactin 6<supgt;R217A< / supgt> mutant fragments, and the recombinant expression vectors and transformants of contactin 6<supgt;E125A< / supgt> and contactin 6<supgt;R217A< / supgt> are constructed. Experiments show that the transformants of contactin 6<supgt;E125A< / supgt> and contactin 6<supgt;R217A< / supgt> mutants have the advantages of high expression efficiency, stable expression, high transfection efficiency, etc. in identifying the amino acids and functions mediating the homologous interaction of contactin 6, and have good application value.

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to a contactin 6 protein mutant and a recombinant expression vector, a transformant and application thereof. Background Art

[0002] Spinal cord injuries caused by various diseases and traumas (traffic accidents, violence, falls, etc.) damage the sensory motor nerve pathways of the spinal cord to varying degrees, causing serious dysfunction of important sensory and motor nerve functions below the spinal cord injury plane, or even complete loss of function and paraplegia. After spinal cord injury, it is difficult for the damaged nerve axons to pass through the scar tissue at the injury site and re-establish synaptic connections with the target neurons below the injury plane, so it is impossible to rebuild the sensory motor nerve circuit. At present, basic and clinical research on the treatment of spinal cord injury has made important progress in gene regulation to improve the injury environment, improve the intrinsic regeneration ability of neurons, transplant neural stem cells with strong regeneration ability or transplant tissue engineering scaffolds, etc., but there is still a lack of effective technical means or drugs for the treatment of paraplegia after spinal cord injury at home and abroad. Therefore, how to effectively promote axon regeneration after spinal cord injury, rebuild the spinal cord sensory motor nerve circuit, and help spinal cord injury patients get rid of the dilemma of sensory motor function loss is a medical problem that urgently needs to be overcome.

[0003] The applicant's previous study found that the expression of the neural recognition molecule contactin 6 (NB-3) in the spinal cord injury area increased significantly after spinal cord injury, and the damaged nerve axons and the astrocytes that formed the glial scar interacted with each other through contactin 6 homology, mediating the inhibitory regeneration signal in the corticospinal neurons, thereby inhibiting the regeneration of the corticospinal axons (Huang et al, 2016. EMBO J). CN114478741A revealed that the IgG2, IgG3 and IgG2-3 domains of the contactin 6 protein mediated the homology interaction of contactin 6, but the precise target of this effect was not found, and precise intervention could not be achieved. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides a contactin 6 protein mutant and its recombinant expression vector and transformant, which can be used to screen and accurately block the homologous interaction of contactin 6. The present invention analyzes and finds that the crystal structure of the complex between the immunoglobulin domains IgG2-3 of contactin 6 interacts, and uses the immunoprecipitation method to determine that the 125th glutamic acid and the 217th arginine of the contactin 6 protein are key amino acid sites, which affect the stability of the interaction between the IgG2-3 domains, thereby mediating the homologous interaction of contactin 6.

[0005] The first object of the present invention is to provide a contactin 6 protein mutant, which is obtained by mutating the 125th glutamic acid of the contactin 6 protein to alanine, or mutating the 217th arginine to alanine.

[0006] Furthermore, the amino acid sequence of contactin 6 protein is shown in SEQ ID NO.1.

[0007] Furthermore, the amino acid sequence of the mutant is shown in SEQ ID NO.2 or SEQ ID NO.3.

[0008] The second object of the present invention is to provide a gene encoding the above-mentioned contactin 6 protein mutant.

[0009] The third object of the present invention is to provide a recombinant expression vector carrying the above encoding gene.

[0010] The fourth object of the present invention is to provide a transformant expressing the above-mentioned contactin 6 protein mutant.

[0011] The fifth object of the present invention is to provide a drug for treating spinal cord injury, targeting the 125th and 217th amino acids of the contactin 6 protein.

[0012] Furthermore, the above-mentioned drug mutates or silences the 125th and 217th amino acids of the contactin 6 protein.

[0013] Furthermore, the above-mentioned drug causes the 125th glutamic acid of the contactin 6 protein to mutate into alanine, and the 217th arginine to mutate into alanine.

[0014] The sixth object of the present invention is to provide a use of the above-mentioned contactin 6 protein mutant or the above-mentioned recombinant expression vector or the above-mentioned transformant in mediating contact inhibition caused by homologous interactions of contactin 6 proteins.

[0015] The above technical solution of the present invention has the following advantages compared with the prior art:

[0016] Amplification of contactin 6 by PCR E125A and contactin 6 R217A Mutated fragments to construct contactin 6 E125A 、contactin 6 R217A The recombinant expression vector of contactin 6 E125A 、contactin6 R217A The mutant recombinant expression vector has the advantages of high expression efficiency, stable expression, high transfection efficiency, etc. in identifying the amino acids mediating contactin 6 homology interactions and their functions, and has good application value. It can be used to screen specific monoclonal antibodies or small molecule drugs that accurately block contactin 6 homology interactions and promote axon regeneration and functional repair after spinal cord injury. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] In order to make the content of the present invention more clearly understood, the present invention is further described in detail below according to specific embodiments of the present invention in conjunction with the accompanying drawings, wherein

[0018] Figure 1 The contactin 6 interaction domain and amino acid site prediction in Example 1;

[0019] Figure 2 is a schematic diagram of the steps of constructing a recombinant expression vector using the seamless cloning method in Example 1;

[0020] Figure 3 is the result of the immunoprecipitation experiment for detecting amino acids mediating contactin 6 homologous interactions in Example 2;

[0021] Figure 4 The expression vector, contactin 6, and contactin 6 in Example 2 E125A 、contactin 6 R217A HEK-293 cell aggregation results;

[0022] Figure 5 The expression of contactin 6 and contactin 6 in Example 2 E125A 、contactin 6 R217A Immunofluorescence staining results of HEK-293 cells co-cultured with neurons and statistical analysis results of neuronal axon length. DETAILED DESCRIPTION

[0023] The present invention is further described below in conjunction with the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it, but the embodiments are not intended to limit the present invention.

[0024] Solution preparation:

[0025] Preparation of 1× PBS solution: weigh 0.335 g of NaH 2 PO 4 ·2H 2 O, 2.902g of Na 2 HPO 4 12H 2 O, 8g NaCl and 0.2g KCl, add 600mL ultrapure water to dissolve, and then make up to 1L with ultrapure water, and use after high pressure sterilization.

[0026] Preparation of 1× blocking buffer solution: Add 500μL of Tween20 to 500mL of 1× PBS and mix well.

[0027] Preparation of 10% SDS solution: weigh 50 g of sodium dodecyl sulfate (SDS) powder in a fume hood, add ultrapure water to dissolve and make up to 500 mL.

[0028] Preparation of 5% skim milk: weigh 2.5 g of skim milk powder, dissolve it in 1× blocking buffer and make up to 50 mL.

[0029] Preparation of 10× running buffer solution: weigh 30.2 g of tris(hydroxymethyl)aminomethane and 144 g of glycine, dissolve in ultrapure water and make up to 1 L.

[0030] Preparation of electrophoresis buffer: Pour 50 mL of 10× running buffer and 5 mL of 10% SDS solution into a beaker, add ultrapure water to make up to 500 mL, and mix well.

[0031] Preparation of transfer buffer: Pour 100 mL of 10× running buffer, 100 mL of anhydrous methanol into a beaker, and add ultrapure water to make up to 1 L, and mix well.

[0032] Preparation of 1×PBST solution: Add 250 μL of Tween 20 to 500 mL of 1×PBS and mix well.

[0033] Example 1: Construction of recombinant expression vector

[0034] 1. Prediction of contactin6 interaction domains and amino acid sites

[0035] 1. Query and download the crystal structure of the complex between the carbonic anhydrase-like domain of PTPRG and the immunoglobulin domain IgG2-3 of contactin6 published in the PDB database (number 5E5U). Chimera software analysis showed that there were two IgG2-3 domains in the tetramer and they interacted with each other;

[0036] 2. The contact surface of dimer IgG2-3 was further analyzed by Chimera, and the analysis results showed 142 amino acid residues at the contact surface ( Figure 1 a);

[0037] 3. The contribution of these amino acid residues to the dimer formation of the IgG2-3 domain of the contactin6 protein was analyzed by MM / GBSA binding free energy calculation. The smaller the binding free energy, the greater the contribution to the interaction. The top five amino acid residues in terms of contribution are: T128, S130, T131, S133, and R217. At the same time, the contact surface analysis showed that glutamic acid at position 125 (E125) is relatively close to arginine at position 217 (R217). It is speculated that there may be a salt bridge between the two. Therefore, a total of 6 amino acid residues, including T128, S130, T131, S133, R217, and E125, were selected for subsequent research ( Figure 1 b).

[0038] 2. Contactin 6 E125A 、contactin 6 T128A 、contactin 6 S130A 、contactin 6 T131A 、contactin 6 S133A 、contactin 6 R217A Vector construction

[0039] 1. PCR primer design and target fragment amplification and recovery

[0040] The primers F1, R1 and F2, R2 for the following 6 amino acid mutants were designed respectively. The primers were synthesized by Hongxun Biotechnology Co., Ltd. Principle: Primers with complementary ends are used to form overlapping chains of PCR products, so that in the subsequent amplification reaction, the amplified fragments from different sources are overlapped and spliced ​​together by extending the overlapping chains (such as Figure 2 shown).

[0041] Contactin 6 E125A -F1: 5'-CAGATATCCAGCACAGTGGCGGCCGCTCGAGATGAGGTTGCTATGGAAACTGG-3';

[0042] contactin 6 E125A -R1:5’-CAGATACTGTGCTTCTGGTTTTGGTGGCAAAGTCTTCAATATATGCAAACTGT-3’;

[0043] contactin 6 E125A -F2:5’-ACAGTTTGCATATATTGAAGACTTTGCCACCAAAACCAGAAGCACAGTATCTG-3’;

[0044] contactin 6 E125A -R2:5’-AGCGGGTTTAAACGGGCCCTCTAGACTCGAGCTATCTCGAAAGTGGGTGAATA-3’;

[0045] contactin 6 T128A -F1:5’-CTTCTCGGACAGATACTGTGCTTCTGGCTTTGGTTTCAAAGTCTTCAATATAT-3’;

[0046] contactin 6 T128A -R1:5’-ATATATTGAAGACTTTGAAACCAAAGCCAGAAGCACAGTATCTGTCCGAGAAG-3’;

[0047] contactin 6 T128A -F2:5’-CTTGACCTTCTCGGACAGATACTGTGGCTCTGGTTTTGGTTTCAAAGTCTTCA-3’;

[0048] contactin 6 T128A -R2:5’-TGAAGACTTTGAAACCAAAACCAGAGCCACAGTATCTGTCCGAGAAGGTCAAG-3’;

[0049] contactin 6 S130A -F1:5’-CAGATATCCAGCACAGTGGCGGCCGCTCGAGATGAGGTTGCTATGGAAACTGG-3’;

[0050] contactin 6 S130A-R1:5’-CTTGACCTTCTCGGACAGATACTGTGGCTCTGGTTTTGGTTTCAAAGTCTTCA-3’;

[0051] contactin 6 S130A -F2:5’-TGAAGACTTTGAAACCAAAACCAGAGCCACAGTATCTGTCCGAGAAGGTCAAG-3’;

[0052] contactin 6 S130A -R2:5’-AGCGGGTTTAAACGGGCCCTCTAGACTCGAGCTATCTCGAAAGTGGGTGA ATA;

[0053] contactin 6 T131A -F1:5’-CAGATATCCAGCACAGTGGCGGCCGCTCGAGATGAGGTTGCTATGGAAACTGG-3’;

[0054] contactin 6 T131A -R1:5’-CTCCTTGACCTTCTCGGACAGATACGGCGCTTCTGGTTTTGGTTTCAAAGTCT-3’;

[0055] contactin 6 T131A -F2:5’-AGACTTTGAAACCAAAACCAGAAGCGCCGTATCTGTCCGAGAAGGTCAAGGAG-3’;

[0056] contactin 6 T131A -R2:5’-AGCGGGTTTAAACGGGCCCTCTAGACTCGAGCTATCTCGAAAGTGGGTGAATA-3’;

[0057] contactin 6 S133A -F1:5’-CAGATATCCAGCACAGTGGCGGCCGCTCGAGATGAGGTTGCTATGGAAACTGG-3’;

[0058] contactin 6 S133A -R1:5’-GTACCACTCCTTGACCTTCTCGGACGGCTACTGTGCTTCTGGTTTTGGTTTC-3’;

[0059] Contactin 6 S133A -F2: 5'-GAAACCAAAACCAGAAGCACAGTAGCCGTCCGAGAAGGTCAAGGAGTGGTAC-3';

[0060] Contactin 6 S133A -R2: 5'-AGCGGGTTTTAAACGGGCCCT CTAGACTCGA GCTATCTCGAAAGTGGGTGA ATA;

[0061] Contactin 6 R217A -F1: 5'-CAGATATCCAGCACAGTGGCGGCCGCTCGAGATGAGGTTGCTATGGAAACTGG-3';

[0062] Contactin 6 R217A -R1: 5'-GGTCCACCTACGCCTTTAGTGCTGGCCACTGATGGTGTCATGGGGGAATATG-3';

[0063] Contactin 6 R217A -F2: 5'-ATATATTGAAGACTTTGAAACCAAAGCCAGAAGCACAGTATCTGTCCGAGAAG-3';

[0064] Contactin 6 R217A -R2: 5'-CATATTCCCCCATGACACCATCAGTGGCCAGCACAAAAGGCGTAGGTGGACC-3';

[0065] The plasmid containing the full-length contactin 6 coding sequence (from Professor Ye Haihong of Capital Medical University; Ye et al, 2011. J. Biol. Chem.) was used as a template for PCR amplification. The reaction system (NEB) was as follows:

[0066] 5×Phusion GC Buffer 10μL;

[0067] 10mM dNTPs 1μL;

[0068] 10μM Forward Primer 2.5μL;

[0069] 10μM Reverse Primer 2.5μL;

[0070] Template DNA <250ng;

[0071] DMSO 1.5 μL;

[0072] Phusion DNA Polymerase 0.5μL;

[0073] Nuclease-free water to 50μL.

[0074] Reaction conditions:

[0075] (1) 95°C, 30 seconds;

[0076] (2) 95°C, 15 seconds; 60°C, 30 seconds;

[0077] (3) 72°C, 1.5 min;

[0078] (4) 35 cycles;

[0079] (5) Store at 4℃.

[0080] 3. Agarose gel electrophoresis of PCR products and recovery of target gene

[0081] 1. Gel electrophoresis of amplified products

[0082] (1) Weigh 0.6 g of agarose;

[0083] (2) Dissolve in 50 mL of 1×TAE solution and heat in a microwave oven until agarose is completely dissolved;

[0084] (3) When the solution cools to 60°C, add 5 μL of EB, mix well and pour into the groove, immediately insert the sample well comb, and let it stand to cool and solidify;

[0085] (4) After cooling and solidification, remove the comb and place the groove into the electrophoresis tank. Use 1×TAE solution as the electrophoresis buffer. Add 20 μL of PCR product and 2 μL of loading buffer to each well and run the electrophoresis at 120 V for 30 min.

[0086] 2. Gel excision and recovery of target gene

[0087] The gel recovery kit (Novagen Biotech Co., Ltd.) was used, and the specific steps were as follows:

[0088] (1) Under ultraviolet light, carefully cut the target band of the PCR product from the agarose gel using a clean blade.

[0089] (2) Weigh the gel and place it in a 1.5 mL EP tube. Add an equal volume of Buffer GDP (100 mg of gel is equivalent to 100 μL volume). Place in a 50-55°C water bath for 7-10 min to ensure that the gel is completely dissolved. Invert and mix twice during the water bath to accelerate the dissolution.

[0090] (3) Briefly centrifuge to collect droplets on the tube wall. Place the FastPure DNA Mini Columns-G adsorption column in the Collection Tubes 2mL collection tube, transfer <700μL of the sol solution to the adsorption column, and centrifuge at 13,400×g for 30-60 seconds.

[0091] (4) Discard the filtrate and place the adsorption column in a collection tube. Add 300 μL of Buffer GDP to the adsorption column. Let stand for 1 min and centrifuge at 13,400 × g for 30-60 seconds.

[0092] (5) Discard the filtrate and place the adsorption column in a collection tube. Add 700 μL of Buffer GW (with anhydrous ethanol) to the adsorption column and centrifuge at 13,400 × g for 30-60 seconds.

[0093] (6) Repeat step 5.

[0094] (7) Discard the filtrate and return the adsorption column to the collection tube. Centrifuge at 13,400 × g for 2 min.

[0095] (8) Place the adsorption column in a 1.5 mL sterile centrifuge tube, add 20-30 μL Elution Buffer to the center of the adsorption column, and place it for 2 minutes. Centrifuge at 13,400 × g for 1 minute. Discard the adsorption column and save the DNA.

[0096] (9) Conduct concentration measurement.

[0097] IV. Transformation of Competent Bacteria

[0098] After verification by agarose gel electrophoresis, the transformation experiment was performed. The experimental steps are as follows:

[0099] 1. Take out 100 mL of DH5α competent bacterial suspension from the -80℃ freezer, thaw it at room temperature, and place it on ice immediately after thawing.

[0100] 2. Add all 10 μL of ligation product, shake gently, and place on ice for 30 minutes.

[0101] 3. Place in a 42°C water bath for heat shock for 90 seconds, then quickly cool on ice for 5 minutes.

[0102] 4. Add 800 μL of pre-warmed antibiotic-free LB liquid medium to the tube, mix gently, and culture at 37°C with shaking at 100 rpm for 1 h.

[0103] 5. Centrifuge the above bacterial solution at 4000rpm for 5min, remove 850μL of supernatant, mix the remaining liquid and apply it to the plate, invert the culture dish and culture it in a 37℃ biochemical incubator for 12-16h. At the same time, make two controls: control group A: use the same volume of sterile water instead of the ligation product for transformation experiment, and apply it on the plate without antibiotics to determine whether there is any problem with the competent E. coli; control group B: use the same volume of sterile ddH 2 O was used instead of the ligation product for transformation experiments and spread on plates containing antibiotics to determine whether there was a problem with the antibiotic-containing plates and whether there was contamination by E. coli.

[0104] 5. Extraction of plasmid DNA in small quantities

[0105] Take 5 μL of the bacterial solution that is positive after colony PCR identification and add it to 5 mL of LB liquid culture medium containing antibiotics. Shake and culture at 37°C and 200 rpm for 12-16 hours to extract the plasmid in small quantities. Add glycerol to the remaining bacterial solution to a concentration of 20% and store it at -80°C for later use. The steps for using the plasmid mini-extraction kit are as follows:

[0106] 1. Column equilibration: Add 500 μL of equilibration solution BL to the adsorption column CP3 (the adsorption column is placed in the collection tube), centrifuge at 12,000 rpm for 1 min, pour out the waste liquid in the collection tube, and put the adsorption column back into the collection tube;

[0107] 2. Take 1-5 mL of overnight cultured bacterial solution, add it to a centrifuge tube, use a regular desktop centrifuge, centrifuge at 12,000 rpm for 1 min, and remove the supernatant as much as possible;

[0108] 3. Add 250 μL of solution P1 (with RNase A added) to the centrifuge tube containing the bacterial pellet and use a pipette or vortex oscillator to thoroughly suspend the bacterial pellet;

[0109] 4. Add 250 μL of solution P2 to the centrifuge tube and gently invert it upside down 6-8 times to fully lyse the bacteria;

[0110] 5. Add 350 μL of solution P3 to the centrifuge tube and gently invert it 6-8 times to mix thoroughly. A white flocculent precipitate will appear. Centrifuge at 12,000 rpm for 10 min.

[0111] 6. Use a pipette to transfer the supernatant collected in the previous step to the adsorption column CP3 (the adsorption column is placed in the collection tube). Be careful not to suck out the precipitate. Centrifuge at 12,000 rpm for 30-60 seconds, pour out the waste liquid in the collection tube, and place the adsorption column CP3 in the collection tube;

[0112] 7. Add 600 μL of rinse solution PW to the adsorption column CP3 (please check whether anhydrous ethanol has been added first), centrifuge at 12,000 rpm for 30-60 seconds, pour out the waste liquid in the collection tube, and place the adsorption column CP3 in the collection tube;

[0113] 8. Repeat step 7;

[0114] 9. Place the adsorption column CP3 into the collection tube and centrifuge at 12,000 rpm for 2 min to remove the remaining rinse solution in the adsorption column;

[0115] 10. Place the adsorption column CP3 in a clean centrifuge tube, add 50-100 μL of elution buffer EB to the middle part of the adsorption membrane, leave it at room temperature for 2 minutes, and centrifuge it at 12,000 rpm for 2 minutes to collect the plasmid solution into the centrifuge tube;

[0116] 11. Determine the concentration.

[0117] VI. Sequence Analysis and Identification of Recombinant Plasmids

[0118] The small-scale plasmid was sequenced and identified by Suzhou Jinweizhi Biotechnology Co., Ltd. The sequence was completely correct and contactin 6 was obtained. E125A 、contactin 6 T128A 、contactin 6 S130A 、contactin 6 T131A 、contactin 6 S133A 、contactin 6 R217A of the recombinant plasmid.

[0119] Example 2: Application to Identification of Amino Acid Residues Mediating Homologous Interactions of Contactin 6 I. Co-immunoprecipitation

[0120] 1. Prepare 293T cells for culture:

[0121] (1) 24 hours before transfection, inoculate an appropriate amount of cells. The cell density at the time of transfection should be 40-60% (80-90% is also acceptable).

[0122] (2) 1 h before transfection, replace with fresh complete culture medium and place at 37°C, 5% CO 2 Medium cultivation.

[0123] Prepare transfection working solution: (6-well plate or 35 mm dish, 2 mL culture medium)

[0124] (3) Take 5-8 μg of DNA (starting amount: 5 μg), add it to the diluent to a total volume of 100 μL, mix gently, and leave at room temperature.

[0125] (4) Take 1-4 μL (initial amount 2 μL) of VigoFect (purchased from Vigolas) and add it to the diluent to a total volume of 100 μL. Mix gently and let it stand at room temperature for 5 min.

[0126] (5) Add the diluted VigoFect dropwise into the diluted DNA solution and mix gently. The resulting transfection working solution is placed at room temperature for 15 minutes.

[0127] (6) Gently mix the transfection working solution, add dropwise to 2 mL of culture medium, gently mix the culture medium, and place at 37°C and 5% CO 2 Cells were cultured under the following conditions.

[0128] (7) After 24-48 hours, observe or harvest the cells.

[0129] 2. Co-transfect the following plasmids into 293T cells (10 cm culture dish):

[0130] (1) 19.2 μg empty plasmid (Vector); 9.6 μg Vector + 9.6 μg contactin 6-HA; 9.6 μg Vector + 9.6 μg contactin 6-Myc plasmid; 9.6 μg contactin 6-HA + 9.6 μg contactin 6-Myc plasmid;

[0131] (2) 19.2 μg empty plasmid (Vector); 9.6 μg Vector + 9.6 μg contactin 6-HA; 9.6 μg Vector + 9.6 μg recombinant plasmid; 9.6 μg contactin 6-HA + 9.6 μg recombinant plasmid;

[0132] 3.293T cells were lysed two days after transfection: 1 mL of RIPA lysis buffer containing protease inhibitors was added and lysed at 4°C for 30 min;

[0133] 4. Centrifuge at 16,400 rpm, 4°C for 15 min and collect the supernatant;

[0134] 5. Take 100 μL of lysate, add 100 μL of protein loading buffer, add 20 μL of 5× loading buffer, boil at 95℃ for 10 min as input for Western blot analysis;

[0135] 6. Add 10-20 μL anti-Myc Affinity Gel or anti-HA Affinity Gel (Shanghai Yisheng Technology Co., Ltd.) to the remaining lysate, incubate slowly with shaking at 4°C for more than 2 h, and wash the gel three times with 1× PBS, each time for 10 min;

[0136] 7. Add 50 μL of 2× loading buffer, incubate at 95°C for 10 min, cool on ice and store at -20°C;

[0137] 8. Western blot detection of co-immunoprecipitation samples.

[0138] like Figure 3 As shown, contactin 6-HA and contactin 6-Myc full-length proteins or contactin 6 recombinant plasmid mutants were co-expressed in 293T cells, and immunoprecipitation and anti-HA antibody detection were performed using anti-Myc Affinity Gel, showing that contactin 6-Myc can be co-precipitated with contactin 6-HA, while contactin 6 E125A -Myc and contactin 6 R217A -Myc cannot co-precipitate with contactin 6-HA; immunoprecipitation with anti-HA Affinity Gel and detection with anti-Myc antibody showed that contactin 6-Myc can co-precipitate with contactin 6-HA, while contactin6 E125A 、contactin6 R217A It cannot co-precipitate with contactin 6-HA, indicating that the glutamic acid mutation at position 125 and the arginine mutation at position 217 of contactin 6 destroyed the contactin 6 homologous interaction, so glutamic acid at position 125 and arginine at position 217 are important amino acids mediating the contactin 6 homologous interaction.

[0139] Second, 293T cells expressing the full-length contactin 6 protein have aggregation, and mutations at positions 125, glutamic acid, and 217, arginine, disrupt cell aggregation (e.g. Figure 4 )

[0140] 1.293T transfected with contactin 6, contactin 6 E125A and contactin 6 R217A After 24 hours of plasmid incubation, cells were collected for aggregation reaction. Each dish was washed twice with 1xPBS. A PBS solution containing 10 mM EDTA was added to each dish to separate the cell-cell interactions and incubated at 37°C for 5 min.

[0141] 2. Tap the culture dish to gently separate the cells, then add complete culture medium. Collect the cells from each dish into the corresponding 15ml centrifuge tube, and then centrifuge at 1000rpm for 5 minutes at room temperature;

[0142] 3. After centrifugation, prepare the corresponding centrifuge tubes as incubation tubes. Mark the corresponding group on the top of each centrifuge tube, namely NB-3, NB-3 E125A and NB-3 R217A After labeling, remove the supernatant from the centrifugation and resuspend the cells in 500 μL of 10 mM CaCl 2 and 10 mM MgCl 2 Complete medium was heated to 37°C. Meanwhile, the number of cells in each 15 mL centrifuge tube was counted and 4 × 10 5 Place cells into the corresponding incubation tubes and add the volume to 500 μL;

[0143] 4. Incubate the cells at room temperature in a slow tube rotator. Pipette the cell suspension at 0 min and 120 min of incubation and drop it onto the coverslip. Observe cell aggregation under an upright fluorescence microscope.

[0144] 3. In the co-culture system of primary neurons and 293T or astrocytes, glutamate at position 125 and arginine at position 217 mediated the contact inhibition of neuronal axons caused by homologous interactions of contactin 6

[0145] 1. Cultivate 293T cells according to the above steps;

[0146] 2. Primary Cortical Neuron Culture

[0147] (1) After coating 24-well plates with 1× PDL for 3 h, the plates were washed three times with 1× PBS;

[0148] (2) The sensorimotor cortex of CD1 strain E18.5 fetal mice was sterilized with alcohol and washed once with 1× PBS;

[0149] (3) 0.125% TE, digestion in a water bath at 37°C for 10 min;

[0150] (4) Add 1 mL of culture medium (Neurobasal + 5% FBS + 1% PS + 1% B27 + 1% glutamine) to terminate digestion and gently blow away tissue chunks;

[0151] (5) Filter the supernatant through a 70 μm filter, centrifuge at 1000 rpm for 5 min, and discard the filtrate;

[0152] (6) Resuspend the cells, filter through a 70 μm filter, count the cells using a counting plate, and co-culture with 293T cells.

[0153] like Figure 5 As shown, primary cortical neurons were co-cultured with 293T cells transfected with pcDNA3.1-contactin 6-Myc and different mutant protein recombinant plasmids for 12 hours, and then immunofluorescence staining was performed using DAPI / Myc / Tuj1 antibodies. The total length of cortical neuron axons and the length of axons extending to the surface of 293T cells were measured by Image J, and the percentage of the length of cortical neuron axons overlapping with 293T cells to the total length of the cortical neuron axons was calculated. The differences between the data of each group were compared by One-way ANOVA, ***p<0.001, ns, no statistical significance. The statistical data came from 3 independent experiments, and no less than 30 neurons were counted in each group each time. This experiment shows that the axons of cortical neurons expressing contactin 6 no longer grow and extend to the surface of 293T cells expressing contactin 6, suggesting that contactin 6 mediates the contact inhibition between the two. However, the axons of cortical neurons expressing contactin 6 no longer grow and extend to the surface of 293T cells expressing contactin 6 after contacting contactin6. E125A 、contactin 6 R217A After being infected with 293T cells, they tend to grow and extend toward their surface, suggesting that the mutations at positions 125, glutamic acid, and 217, arginine, destroyed the homologous interaction between contactin 6 and relieved the contact inhibition mediated by contactin 6.

[0154] Obviously, the above embodiments are merely examples for clear explanation and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived from these are still within the protection scope of the invention.

Claims

1. A contactin 6 protein mutant, Features: The contactin 6 protein mutant is obtained by mutating the 125th glutamic acid of the contactin 6 protein to alanine, or mutating the 217th arginine to alanine. The amino acid sequence of the contactin 6 protein is shown in SEQ ID NO.

1.

2. The contactin 6 protein mutant according to claim 1, Features: The amino acid sequence of the mutant is shown in SEQ ID NO.2 or SEQ ID NO.

3.

3. A gene encoding the contactin 6 protein mutant according to claim 1 or 2.

4. A recombinant expression vector carrying the coding gene according to claim 3.

5. A transformant expressing the contactin 6 protein mutant according to claim 1 or 2, wherein the transformant comprises a virus, a bacterium or a fungus.

6. Use of the contactin 6 protein mutant according to claim 1 or 2, the recombinant expression vector according to claim 4, or the transformant according to claim 5 in the preparation of a drug for promoting spinal axon regeneration.

Images