A ssDNA nucleic acid aptamer for specific recognition of grouper iridovirus and its application

Abstract

The present invention provides an ssDNA nucleic acid aptamer that specifically recognizes grouper iridovirus, and the nucleotide sequence thereof is shown in SEQ ID No: 1. The nucleic acid aptamer provided by the present invention has high affinity and specificity for grouper iridovirus. In addition, the nucleic acid aptamer has the advantages of being easy to prepare and label, having no toxic side effects on the body, having strong stability, and being easy to store. When the nucleic acid aptamer provided by the present invention is used to detect grouper iridovirus, the operation is simple, the time consumption is short, and the accuracy and sensitivity are high. Based on the nucleic acid aptamer, a kit or molecular probe that specifically recognizes grouper iridovirus can be constructed to facilitate the rapid diagnosis of grouper iridovirus, which has good application prospects in the green and healthy breeding of grouper.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and in particular relates to a ssDNA nucleic acid aptamer for specifically recognizing grouper iridovirus and an application thereof. Background Art

[0002] Grouper is a precious marine farmed fish with high economic and nutritional value. In recent years, with the vigorous development of the aquaculture industry, the scale of grouper farming has continued to expand, and various diseases have frequently broken out, causing huge economic losses to the grouper farming industry. Singapore grouper iridovirus (SGIV) is one of the infectious pathogens that is currently recognized as seriously endangering the healthy development of grouper farming, and its mortality rate can be as high as 90% or more. At present, the detection methods for grouper iridovirus are mainly based on antibody-based immunological detection, molecular biology-based polymerase chain reaction and real-time fluorescence quantitative nucleic acid amplification detection system. These methods have the advantages of high specificity, sensitivity and accuracy. However, the immunological method has the advantages of long preparation cycle and difficult preservation; polymerase chain reaction is time-consuming, cumbersome operation and insufficient sensitivity; although the real-time fluorescence quantitative nucleic acid amplification detection is highly sensitive, it is time-consuming and has high professional requirements for operators, so all methods have the disadvantage of being unsuitable for on-site use, and are therefore limited to sample detection in the laboratory. Therefore, it is extremely important for the grouper farming industry to develop a rapid detection technology that is easy to operate, low cost, short time consumption, and highly accurate to monitor the infection of grouper iridovirus.

[0003] Aptamers are a class of nucleotides with a size of 20 to 100 bases, which can be obtained by multiple rounds of rigorous specific screening for specific target substances through systematic evolution of ligands by exponential enrichment (SELEX). SELEX screening is to incubate a random oligonucleotide library with the target substance, and then obtain a single nucleic acid strand that can specifically bind to the target substance through membrane filtration, magnetic separation and other methods. After multiple rounds of screening, the single nucleic acid strand with the strongest specific binding ability to the target substance is finally obtained, namely the aptamer. Aptamers have the advantages of stable structure, high tolerance, and easy in vitro synthesis and modification. They are currently widely used by domestic and foreign scholars in the fields of pathogen or disease diagnosis and treatment. Therefore, the use of aptamers to develop products for accurate and rapid detection of grouper iridovirus has broad application prospects. Summary of the invention

[0004] The invention provides a ssDNA nucleic acid aptamer for specifically identifying grouper iridovirus and application thereof. The nucleic acid aptamer has high sensitivity and specificity to grouper iridovirus.

[0005] According to one aspect of the present invention, a ssDNA nucleic acid aptamer that specifically recognizes grouper iridovirus is provided, and its nucleotide sequence is shown in SEQ ID No: 1.

[0006] Preferably, the secondary structure of the above nucleotide sequence is as follows:

[0007]

[0008] Preferably, the nucleotide sequence is linked to a label.

[0009] Preferably, the label is selected from at least one of a biotin label, a luminescent label, and an enzyme label.

[0010] According to another aspect of the present invention, there is provided a use of the above-mentioned ssDNA nucleic acid aptamer that specifically recognizes grouper iridovirus in preparing a product that specifically recognizes grouper iridovirus.

[0011] Preferably, the product that specifically recognizes grouper iridovirus comprises the above-mentioned ssDNA nucleic acid aptamer that specifically recognizes grouper iridovirus.

[0012] According to another aspect of the present invention, a product for detecting grouper iridovirus is provided, comprising the above-mentioned ssDNA nucleic acid aptamer that specifically recognizes grouper iridovirus.

[0013] Preferably, the above-mentioned product is a molecular probe and / or a kit.

[0014] The nucleic acid aptamer provided by the present invention has high affinity and high specificity for grouper iridovirus. Compared with the existing immunological detection methods, the nucleic acid aptamer provided by the present invention has a small molecular weight, a short preparation cycle, is easy to obtain, and has strong stability. When the nucleic acid aptamer provided by the present invention is used to detect grouper iridovirus, the operation is simple, the time consumption is short, and it has high accuracy and sensitivity. Based on the nucleic acid aptamer, a product that specifically identifies grouper iridovirus can be constructed to facilitate the rapid diagnosis of grouper iridovirus, which has good application prospects in the green and healthy breeding of grouper. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 It is a predicted secondary structure diagram of the nucleic acid aptamer whose nucleotide sequence is shown as SEQ ID No: 1.

[0016] Figure 2This is the microscopic observation result after the nucleic acid aptamer as shown in SEQ ID No: 1 labeled with cyanine dye Cy5 in Test Example 1 was incubated with grouper spleen cells infected with grouper iridovirus and not infected with grouper iridovirus.

[0017] Figure 3 It is the flow cytometer test result after the nucleic acid aptamer as shown in SEQ ID No: 1 labeled with cyanine dye Cy5 in Test Example 2 was incubated with grouper spleen cells infected with grouper iridovirus, uninfected with grouper iridovirus, and infected with grouper neural necrosis virus.

[0018] Figure 4 It is the flow cytometer test result after the nucleic acid aptamer as shown in SEQ ID No: 1 labeled with cyanine dye Cy5 in Test Example 3 was incubated with the grinding solution of liver, spleen and kidney tissues infected with grouper iridovirus and not infected with grouper iridovirus. DETAILED DESCRIPTION

[0019] In order to enable those skilled in the art to better understand the solutions of the present invention, the technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work should fall within the scope of protection of the present invention.

[0020] Example 1

[0021] This embodiment provides a ssDNA nucleic acid aptamer that specifically recognizes grouper iridovirus, and the screening and preparation method thereof comprises the following steps:

[0022] S1. Construction of the first ssDNA library and synthesis of primers

[0023] The first ssDNA library Library 50 was designed and synthesized, and its nucleotide sequence was as follows: 5'-GACGCTTACTCAGGTGTGACTCG(50N)CGAAGGACGCAGATGAAGTCTC, wherein both ends were fixed sequences and the middle 50 nucleotides were random sequences.

[0024] The upstream primer includes the DNA sequence shown in SEQ ID No: 2 and is labeled with hydroxyfluorescein (FAM), and its specific nucleotide sequence is: 5'-FAM-GACGCTTACTCAGGTGTGACTCG-3'.

[0025] The downstream primer includes the DNA sequence shown in SEQ ID No: 3 and is labeled with biotin. The specific nucleotide sequence is: 5'-Biotin-GAGACTTCATCTGCGTCCTTCG-3'.

[0026] The first ssDNA library and primers were synthesized by Shanghai Sangon Biotechnology Co., Ltd.

[0027] S2. SELEX screening to obtain nucleic acid aptamers that specifically recognize grouper spleen cells (GS cells) infected with SGIV (positive screening)

[0028] S2.1 Dissolve 10 nmol of the first ssDNA library in 500 μL PBS, place in a 92°C constant temperature water bath for 5 min, then quickly insert into ice and place in an ice bath for 10 min. Incubate the treated first ssDNA library with SGIV-infected grouper spleen cells (GS) on ice for 1 h;

[0029] After S2.2 incubation and binding are completed, the supernatant is removed by centrifugation, and the SGIV-infected grouper spleen cells are washed with 10 mL of PBS, kept in a constant temperature water bath at 92°C for 10 min, and centrifuged at 12000g to collect the supernatant, which is the second ssDNA library that specifically recognizes SGIV.

[0030] S3. PCR amplification

[0031] Take 100 μL of the second ssDNA library obtained by screening and perform PCR amplification with the upstream primer and the downstream primer. The PCR reaction system is as follows (1000 μL): 10×Buffer 100 μL, dNTP Mix (2.5 mM) 80 μL, upstream primer 40 μL, downstream primer 40 μL, second ssDNA library 100 μL, rTaq enzyme 12.5 μL, ddH 2 O 627.5μL. Perform PCR amplification according to the following procedure: 92℃ for 5 minutes, 92℃ for 1 minute, 60℃ for 30 seconds, 72℃ for 1 minute, for 25 cycles; 72℃ for 5 minutes. The supernatant obtained after the first round of cycle screening should be used for subsequent PCR amplification to obtain the amplified dsDNA library.

[0032] S4. Preparation of the third ssDNA library

[0033] 100 μL of streptavidin-labeled magnetic beads were incubated with the dsDNA library at room temperature for 20 minutes. The dsDNA library was bound to the surface of the magnetic beads by the affinity between the biotin on the dsDNA library and the streptavidin on the magnetic beads. The supernatant was removed by a magnetic separator, and the magnetic beads were washed with 2 mL of PBS. Then 200 μL of NaOH solution (200 mM) was added to the EP tube and reacted at room temperature for 10 minutes to denature and melt the dsDNA library. One chain with biotin was bound to the streptavidin and remained on the magnetic beads. The single-stranded DNA bound to the magnetic beads was used as the third ssDNA library. The supernatant was recovered by a magnetic separation rack. After the desalting column was washed with 10 mL of sterile water, the supernatant was added to the desalting column and dripped naturally by gravity. 500 μL of PBS was added, and the collected solution was used for the next round of screening.

[0034] S5. Repeated screening

[0035] The third ssDNA library obtained in S4 was used to replace the first ssDNA library, and the positive screening process, PCR amplification and single-stranded DNA library preparation process shown in S2-S4 were repeated 12 times.

[0036] S6. Negative screening

[0037] In the second round of S5 and subsequent rounds of screening, normal grouper spleen cells were used as controls, and the ssDNA library obtained after S5 screening was negatively screened to improve the screening efficiency. The specific negative screening process is: the ssDNA library obtained by screening was dissolved, and incubated with normal grouper spleen cells on ice for 1 hour in a constant temperature water bath at 92°C. After the incubation is completed, the supernatant solution was collected by centrifugation, which is the ssDNA library that has undergone negative screening.

[0038] S7.12 rounds of screening

[0039] The supernatant containing the ssDNA library was collected in S6, and after PCR amplification in S3 and ssDNA library preparation in S4, the processes of S6, S2, S3 and S4 were repeated in sequence, and the change in the recognition ability of the obtained ssDNA library to SGIV-infected cells was detected by flow cytometry. The screening was repeated for 11 rounds, and the ssDNA library obtained at this time had the strongest recognition ability to SGIV-infected cells. The obtained amplified product was cloned and sequenced to finally obtain the nucleic acid aptamer that can be used to detect SGIV-infected cells in this embodiment, and its nucleotide sequence is:

[0040] CCCAACGGACAACTAAATAGTGGATCTCACCAGTGTTGGGATTTTATTTC (SEQ ID No: 1).

[0041] The secondary structure of SEQ ID No: 1 was predicted online using MFOLD software (http: / / mfold.rna.albany.edu / ?q=mfold / DNA-Folding-Form). The prediction results are as follows: Figure 1 As shown, the nucleic acid aptamer with a nucleotide sequence as shown in SEQ ID No: 1 forms a special stem-loop structure and a hairpin structure.

[0042] Example 2

[0043] In this embodiment, the nucleic acid aptamer (SEQ ID No: 1) is incubated and combined with GS cells infected with SGIV (GS cells are stained with Hoechst dye Hoechst 33342). The specific operation includes the following steps: 500nmol of nucleic acid aptamer (SEQ ID No: 1) labeled with cyanine dye Cy5 is dissolved in PBS to prepare 500μL of mixed solution. The mixed solution is placed in a 92℃ constant temperature water bath for 5min, then quickly inserted into ice and ice bathed for 10min. The treated nucleic acid aptamer and GS cells infected with SGIV are gently mixed and incubated at 4℃ for 1h. After the incubation and combination are completed, the supernatant is removed by centrifugation, washed three times with PBS, and 400μL of PBS is added to resuspend the cells to obtain a cell resuspension.

[0044] Example 3

[0045] In this embodiment, the nucleic acid aptamer (SEQ ID No: 1) is combined with the grinding liquid of the liver, spleen and kidney tissue of grouper infected with SGIV. The specific operation includes the following steps: 500nmol of the nucleic acid aptamer (SEQ ID No: 1) labeled with cyanine dye Cy5 is dissolved in PBS to prepare 500μL of a mixed solution. The mixed solution is placed in a constant temperature water bath at 92°C for 5min, then quickly inserted into ice and ice bathed for 10min. The treated nucleic acid aptamer and the grinding liquid of the liver, spleen and kidney tissue of grouper infected with SGIV are gently mixed, and then incubated at 4°C for 1h. After the incubation and combination are completed, the supernatant is removed by centrifugation, washed three times with PBS, and 400μL of PBS is added to resuspend the cells to obtain a cell resuspension.

[0046] Comparative Example 1

[0047] In this comparative example, the nucleic acid aptamer (SEQ ID No: 1) was incubated and combined with GS cells that were not infected with SGIV (GS cells were stained with Hoechst dye Hoechst 33342). The specific operation includes the following steps: 500nmol of nucleic acid aptamer (SEQ ID No: 1) labeled with cyanine dye Cy5 was dissolved in PBS to prepare 500μL of mixed solution. The mixed solution was placed in a 92℃ constant temperature water bath for 5min, then quickly inserted into ice and ice bathed for 10min. The treated nucleic acid aptamer and GS cells that were not infected with SGIV were gently mixed, and then incubated at 4℃ for 1h. After the incubation and combination were completed, the supernatant was removed by centrifugation, washed three times with PBS, and 400μL of PBS was added to resuspend the cells to obtain a cell resuspension.

[0048] Comparative Example 2

[0049] In this comparative example, the nucleic acid aptamer (SEQ ID No: 1) is incubated and combined with GS cells infected with grouper neural necrosis virus. The specific operation includes the following steps: 500nmol of nucleic acid aptamer (SEQ ID No: 1) labeled with cyanine dye Cy5 is dissolved in PBS to prepare 500μL of mixed solution. The mixed solution is placed in a 92℃ constant temperature water bath for 5min, then quickly inserted into ice and ice bathed for 10min, the treated nucleic acid aptamer and GS cells infected with grouper neural necrosis virus are gently mixed, and then incubated at 4℃ for 1h. After the incubation and combination are completed, the supernatant is removed by centrifugation, washed three times with PBS, and 400μL PBS is added to resuspend the cells to obtain a cell resuspension.

[0050] Comparative Example 3

[0051] In this comparative example, the nucleic acid aptamer (SEQ ID No: 1) is incubated and combined with the grinding liquid of the liver, spleen and kidney tissue of grouper that is not infected with SGIV. The specific operation includes the following steps: 500nmol of the nucleic acid aptamer (SEQ ID No: 1) labeled with cyanine dye Cy5 is dissolved in PBS to prepare 500μL of a mixed solution. The mixed solution is placed in a constant temperature water bath at 92℃ for 5min, then quickly inserted into ice and ice bathed for 10min. The treated nucleic acid aptamer and the grinding liquid of the liver, spleen and kidney tissue of grouper that is not infected with SGIV are gently mixed, and then incubated at 4℃ for 1h. After the incubation and combination are completed, the supernatant is removed by centrifugation, washed three times with PBS, and 400μL of PBS is added to resuspend the cells to obtain a cell resuspension.

[0052] Test Example 1

[0053] 1. Test subjects: In this test example, the GS cells infected with SGIV in Example 2 and the GS cells not infected with SGIV in Comparative Example 1 were used as test subjects.

[0054] 2. Test items:

[0055] The fluorescence intensity of the Cy5-labeled aptamer in Example 2 after binding to GS cells infected with SGIV and the fluorescence intensity of the Cy5-labeled aptamer in Comparative Example 1 after binding to GS cells not infected with SGIV were observed using a laser confocal microscope. The specificity of the aptamer was determined by observing the fluorescence intensity of Example 2 and Comparative Example 1.

[0056] 3. Test results

[0057] The test results are as follows Figure 2 As shown. Figure 2 It can be seen that obvious cell nuclei were observed in both Example 2 and Comparative Example 1, but Cy5-labeled SGIV-infected GS cells were clearly observed in Example 2, while no fluorescent color was observed in Comparative Example 1. This shows that the nucleic acid aptamer (SEQ ID No: 1) provided by the present invention can specifically recognize grouper iridovirus.

[0058] Test Example 2

[0059] 1. Test objects: In this test example, GS cells infected with SGIV in Example 2, GS cells not infected with SGIV in Comparative Example 1, and GS cells infected with grouper neural necrosis virus in Comparative Example 2 were used as test objects.

[0060] 2. Test items:

[0061] Flow cytometry was used to detect the differences in fluorescence values ​​after the Cy5-labeled aptamer in Example 2 was bound to GS cells infected with SGIV, the Cy5-labeled aptamer in Comparative Example 1 was bound to GS cells not infected with SGIV, and the Cy5-labeled aptamer in Comparative Example 2 was bound to GS cells infected with grouper neural necrosis virus. The differences in Cy5 fluorescence values ​​between Example 2 and Comparative Examples 1 and 2 were used to determine the binding effect and specificity of the aptamer on GS cells infected with different viruses.

[0062] 3. Test results

[0063] The test results are as follows Figure 3 As shown. Figure 3 It can be seen that there is a significant difference in the fluorescence values ​​between Comparative Examples 1 and 2 and Example 2, the fluorescence value of Example 2 is significantly higher than that of Comparative Examples 1 and 2, and there is no significant difference in the fluorescence values ​​between Comparative Examples 1 and 2. This shows that the nucleic acid aptamer (SEQ ID No: 1) provided by the present invention can specifically identify cells infected with grouper iridovirus.

[0064] Test Example 3

[0065] 1. Test objects: In this test example, the grinding liquid of the liver, spleen and kidney tissues of grouper infected with SGIV in Example 3 and the grinding liquid of the liver, spleen and kidney tissues of grouper not infected with SGIV in Comparative Example 3 were used as test objects.

[0066] 2. Test items:

[0067] The fluorescence values ​​of the Cy5-labeled nucleic acid aptamer in Example 3 and the grinding fluid of the liver, spleen and kidney tissue of grouper infected with SGIV, and the Cy5-labeled nucleic acid aptamer in Comparative Example 3 after binding with the grinding fluid of the liver, spleen and kidney tissue of grouper not infected with SGIV were detected by flow cytometry, and the specificity of the nucleic acid aptamer was judged by the difference in Cy5 fluorescence values ​​between Example 3 and Comparative Example 3.

[0068] 3. Test structure:

[0069] Test results such as Figure 4 As shown. Figure 4 It can be seen that the fluorescence value of Example 3 is significantly higher than that of Comparative Example 3. This shows that the nucleic acid aptamer (SEQ ID No: 1) provided by the present invention can specifically identify the liver, spleen and kidney tissues of grouper infected with grouper iridovirus.

[0070] The above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the protection scope of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. A ssDNA nucleic acid aptamer that specifically recognizes grouper iridovirus, characterized in that: The nucleotide sequence of the ssDNA nucleic acid aptamer that specifically recognizes grouper iridovirus is shown in SEQ ID No:

1.

2. The ssDNA nucleic acid aptamer for specifically recognizing grouper iridovirus according to claim 1, characterized in that: The nucleotide sequence is bound to a label.

3. The ssDNA nucleic acid aptamer for specifically recognizing grouper iridovirus according to claim 2, characterized in that: The marker is selected from at least one of a biotin marker, a luminescent marker, and an enzyme marker.

4. Use of the ssDNA nucleic acid aptamer that specifically recognizes grouper iridovirus according to any one of claims 1 to 3 in the preparation of a product that specifically recognizes grouper iridovirus.

5. The use according to claim 4, characterized in that: The product for specifically recognizing grouper iridovirus comprises the ssDNA nucleic acid aptamer for specifically recognizing grouper iridovirus as claimed in any one of claims 1 to 3.

6. A product for detecting grouper iridovirus, characterized in that: The invention comprises the ssDNA nucleic acid aptamer for specifically recognizing grouper iridovirus as claimed in any one of claims 1 to 3.

7. The product for detecting grouper iridovirus according to claim 6, characterized in that: The product is a molecular probe and / or a kit.

Images