A one-step, extraction-free pathogen detection method based on Crispr / Cas12b-LAMP

Abstract

The present invention belongs to the field of biotechnology, and in particular to a one-step method for detecting pathogens without extraction based on Crispr / Cas12b-LAMP. In the process of detecting pathogens, the present invention introduces a CRISPR / Cas12b detection system, combines it with LAMP technology, and transforms the PAM+ preferred sequence before the pathogenic microorganism LAMP primer in the system, and uses the corresponding sgRNA, achieving the effect of high-sensitivity detection of pathogens within 1 hour without opening the lid, and reducing the detection limit to 0.2 copies / μL. Therefore, the detection method provided by the present invention has the advantages of high sensitivity and strong specificity, and can be widely used in the detection process of various pathogens.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and specifically relates to an extraction-free one-step pathogen detection method based on Crispr / Cas12b-LAMP. Background Art

[0002] The current prevention and control of infectious diseases has put forward higher requirements for the immediate detection of pathogenic microorganisms. The rapid and convenient characteristics of isothermal amplification technology (such as RAA, LAMP, EXPAR, etc.) make it possible for pathogenic microorganism detection to break away from the limitations of large laboratory instruments and professionals. Among them, LAMP has gradually become a common means of pathogenic microorganism detection due to its advantages such as high amplification efficiency and simple operation.

[0003] LAMP (Loop-Mediated Isothermal Amplification) is a rapid nucleic acid amplification technology that uses specific primers and strand displacement DNA polymerase to self-circulate for dozens of minutes under constant temperature conditions to complete 10 9 ~10 10 During the detection process, 4-6 primers are needed to identify several specific regions in the target DNA. Therefore, in the LAMP reaction, whether the primer design is reasonable is the key to determining whether the LAMP technology is efficient and specific.

[0004] LAMP technology has the advantages of isothermal and efficient amplification, simple operation, no need for expensive, large-scale variable temperature detection equipment, etc. in diagnosis. However, there are also disadvantages that cannot be ignored: ① Aerosol pollution problem: Once the lid is opened, aerosol pollution is easily formed, and most domestic laboratories cannot strictly partition, so the false positive problem is relatively serious; ② Primer design and screening are cumbersome: 3 pairs of primers for the target need to be designed separately, and the primer design requirements are relatively high. The traditional LAMP primer design scheme limits the selection of gene sites, etc., which is also the main reason restricting the application of LAMP technology. ③ Specificity problem, LAMP amplification is prone to false positive results. Although non-specific reactions can be distinguished from target amplification by optimizing the system and adjusting the positive judgment value, this will increase the R&D cycle and cost, and there are certain requirements for the detection system, making it difficult to reduce the cost of the signal reading end. ④ Limitations of the combination with gene editing technology. The current method of combining with CRISPR / Cas also needs to take into account the presence of PAM region (sequence recognized by Cas protein) in the target, which further limits the selection of sequence segments. However, the reaction temperature required for LAMP amplification is incompatible with the reactivity of most Cas12a proteins, which also limits the combination of isothermal amplification technology and gene editing technology.

[0005] From the above, it can be seen that solving the above-mentioned shortcomings of LAMP technology is the key to further expanding the application of LAMP technology in the process of pathogen detection. Summary of the invention

[0006] In view of the above technical difficulties, the present invention provides a one-step pathogen detection method based on Crispr / Cas12b-LAMP without extraction. The detection method provided by the present invention does not require opening the lid, avoids aerosol contamination, and has the advantages of high sensitivity and strong specificity, and can be widely used in the detection process of various pathogens.

[0007] In order to achieve the above technical effects, the technical solution adopted by the present invention is as follows:

[0008] A one-step pathogen detection method based on Crispr / Cas12b-LAMP without extraction, comprising the following steps:

[0009] S1. Extract the whole genome DNA sequence of pathogens and design LAMP primer sets according to the detection sites;

[0010] S2. inserting a functional sequence according to the design site of the LAMP primer design set, and adding other components of LAMP amplification to obtain a LAMP amplification system;

[0011] S3, placing the LAMP amplification system obtained in step S2 and the CRISPR / Cas12b system in the same PCR reaction tube to obtain a mixed system;

[0012] S4. Place the mixed system obtained in step S3 at 60-65° C., react for 1-1.5 hours, and detect under fluorescence.

[0013] Preferably, the LAMP primer set includes a front inner primer, a rear inner primer, a front outer primer, a rear outer primer, a front ring primer, and a rear ring primer.

[0014] Preferably, the insertion position of the functional sequence in step S2 is the front end of the back-loop primer, and the nucleotide sequence of the functional sequence is shown as SEQ ID NO.1.

[0015] AA TTC GTGGTGGTGACGGTAAAATGA(SEQ ID NO.1);

[0016] Preferably, other components of the LAMP amplification in step S2 include 10× buffer, dNTP, Bst enzyme, and thermostable inorganic pyrophosphatase (Tipp).

[0017] Preferably, the concentrations of the other components are: 100 mM MgSO4, 25 mM dNTP, 8 U / μL Bst enzyme, and 2000 U / mL Tipp.

[0018] Preferably, the CRISPR / Cas12b system described in step S3 includes LbCas12b, sgRNA, and a fluorescent probe.

[0019] Preferably, the nucleotide sequence information of the sgRNA is shown as SEQ ID NO.2.

[0020] Preferably, the fluorescent probe is FAM-CCCCCC-BHQ1, and its concentration is 25 mM.

[0021] The present invention also provides an application of the detection method in detecting the content of pathogenic bacteria.

[0022] When designing primers, the prior art usually requires that the target sequence contains a PAM sequence, or introduces a PAM sequence TTN recognized by Crispr / Cas12b, but in the process of designing primers, it is also necessary to continue to investigate the CG content of the primers, whether the reverse complementary sequence will easily form primer dimers, etc., which is for the LAMP amplification that needs to design 6 primers itself, and increases a certain design difficulty. Based on this, the present invention, in order to achieve a better detection effect, reduce the design difficulty of the LAMP+Crispr / Cas12b method of the present invention, designs a sequence that includes PAM and a preferred sequence at the same time, inserts it into a large number of screenings, and finally obtains the 5' end (5'-LOOPB) of the loop primer after the position suitable for sequence modification.

[0023] The uniqueness of the sequence design of the present invention is that: 1) after BLAST comparison of the NCBI database, it has no similarity of more than 50% with any microbial sequence, and this distinction ensures that the introduced sequence has a high degree of specificity. 2) After verification, we found that the guanine content of the sequence complementary to the sgRNA recognition has a significant effect on the accessory cleavage activity of LbCas12b. We screened the TTG sequence with better performance as the PAM region sequence, and screened out the preferred sequence with a G content of 40% based on 1), and found that it has stronger accessory cleavage activity than other G-content sequences, which is reflected in higher fluorescence values ​​and faster detection time.

[0024] Therefore, among the functional sequences introduced in the primers of the present invention, the PAM sequence preferably selects the TTC sequence. In the sequence-specific selection for sgRNA recognition by the Crispr / Cas12b system, a sequence with a G% content of 40% is finally selected through the exploration and optimization of the accessory cleavage activity, which makes the LAMP primer design for the target sequence more convenient and efficient, and achieves better sensitivity in the one-step method.

[0025] The modified LAMP reaction system is mixed with the CRISPR / Cas12b system components into one tube, and the DNA to be tested or the pathogen treated by the extraction-free method proposed in this application is added as a template, and the fluorescence change can be observed in a 60-65°C isothermal fluorescence detector in one tube. Or after incubation at 60-65°C, the fluorescence can be observed by naked eyes under blue light (440-485nm) to determine the detection results of pathogenic microorganisms.

[0026] Compared with the prior art, the present invention has the following technical advantages: the detection method provided by the present invention has a simple and convenient detection process, and can detect purified DNA or use a matching release agent to directly lyse the cultured strain. In addition, the reaction solution is configured in advance, and after the sample to be tested is directly added during use, it does not need to be opened until the end of the reaction to avoid aerosol contamination of the experimental environment. The detection limit of the reaction system has been tested to be as low as 0.2 copies / μL, which is much more sensitive than the separate LAMP or CRISPR / Cas12b detection, or the reported LAMP-CRISPR / Cas12b one-step method. And this detection method does not detect positive results for the detection of other respiratory pathogens, and has a strong specificity. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 It is the operation flow chart of the detection method of the present invention;

[0028] Figure 2 This is a schematic diagram of the transformation principle of the LAMP system of the present invention;

[0029] Figure 3 This is a comparison chart of detection limits at different insertion positions;

[0030] Figure 4 This is the real-time fluorescence comparison result of the detection limit between the original group and the modified group;

[0031] Figure 5 This is a comparison of the endpoint fluorescence and LED blue light results between the original group and the modified group;

[0032] Figure 6 This is a comparison of the end-point fluorescence results of the BP detection system under the same guanine content;

[0033] Figure 7This is the result diagram of the quantitative standard curve of the transformation method;

[0034] Figure 8 This is a graph showing the test results of BP clinical samples. DETAILED DESCRIPTION

[0035] The present invention is further explained below in conjunction with specific examples, but it should be noted that the following examples are only used to explain the present invention, and cannot be used to limit the present invention, and all technical solutions that are the same or similar to the present invention are within the scope of protection of the present invention. If no specific technology or conditions are specified in this embodiment, the operation is carried out according to the conventional technical methods and instrument instructions in the art; if the manufacturer of the reagents or instruments is not specified, they are all conventional products that can be purchased commercially.

[0036] The present invention specifically applies the detection method to the detection process of Bordetella pertussis (Bordetella pertussis, BP), designs the original LAMP primer set (BP-LAMP Primers) at the sequence detection site of the conservative gene of the IS1663 family transposase of Bordetella pertussis, detects the amplification efficiency by dye method, and finds that the original LAMP isothermal amplification method detection limit is 200 copies / μL, and there are false positive results in repetition. The present invention inserts the functional sequence Exopod (AATTCGTGGTGGTGACGGTAAAATGA) designed for Cas12b into the 5' end of the outer primer (FIP / BIP) in BP-LAMP Primers, the connecting part (5'-FIP / mFIP / 5'-BIP / mBIP), and the 5' end (5'-LF / 5'-LB) of the loop primer (LOOP F / LOOP B). The corresponding Exo-BP-sgRNA was designed and expressed, and the LAMP reaction and CRISPR / Cas12b detection were carried out in the same PCR tube at 60-65°C to detect fluorescence changes. The results were observed under blue light after 1 h of reaction.

[0037] By inserting the modified sequence into different positions of the LAMP primer, it was found that the modified primer inserted into the 5' end of the outer primer (FIP / BIP) had a poor detection effect on the template, while the modified primer inserted into the outer primer connecting part (mFIP / mBIP) and the 5' end of the loop primer (LOOPF / LOOP B) could achieve a detection limit as low as 0.2 copies / μL. Among them, the detection effect of the 5'-LOOP B modification is the best, with a higher endpoint fluorescence and a suitable detection time at the same concentration. We also found that the detection fluorescence under this modification is linearly related to the target concentration, and quantitative detection can be achieved. At the same time, the detection of 20 positive samples of Bordetella pertussis was achieved. The specific scheme adopted by the present invention is as follows:

[0038] Example A one-step pathogen detection method based on Crispr / Cas12b-LAMP without extraction

[0039] First, six primers were designed at the sequence detection site of the conserved gene of the IS1663 family transposase of Bordetella pertussis. The specific information is shown in Table 1 below. Among them, in the back-loop primer LOOPB, in the front AATTC, TTC is the PAM sequence, and AA is added in front to protect the following bases:

[0040] Table 1 Sequence information of LAMP primers designed by the present invention

[0041]

[0042] The LAMP system was mixed with the CRISPA / Cas12b system, and the specific system is shown in Table 2 below.

[0043] Table 2 Crispr / Cas12b-LAMP reaction system of the present invention

[0044]

[0045]

[0046] Then add 5 μL of reaction template (nucleic acid quality control, extracted clinical samples or strains to be tested) to the above PCR reaction system, place the entire system in a fluorescent PCR instrument set at 65°C, analyze the fluorescence curve after 1 hour, or place the PCR tube under blue light / ultraviolet light to observe fluorescence (negative without fluorescence signal). Experimental Example 1 Comparison of detection limits at different insertion positions

[0047] 1. Experimental method: In the LAMP amplification product, the copies of the inner primer and loop primer sequences are the largest, so the inner primer (FIP / BIP) and loop primer (LOOP F / R) are selected for modification. Since the amplification direction is 5'-3', the 5' of the primers are first selected for modification (5'-FIP / 5'-BIP / 5'-LOOP F / 5'-LOOP B), and the middle connecting part of the inner primer (this is because the LAMP primer design targets 6 different regions of the target gene, including the 3' end F3c, F2c and F1c regions and the 5' end B1, B2 and B3 regions, 4 to 6 primers are designed. The FIP primer (Forward Inner Primer) consists of the F2 region and the F1c region. The F2 region is complementary to the F2c region at the 3' end of the target gene, and the F1C region is identical to the Flc region sequence at the 5' end of the target gene. The BIP primer (Backward Inner Primer) Primer) is composed of B1c and B2 regions, and the B2 region is complementary to the B2c region at the 3' end of the target gene, and the B1c domain is identical to the Blc region sequence at the 5' end of the target gene. Whether FIP or BIP, there is a sequence for connection between the two sections, and the primer modification mFIP / mBIP of the present invention is to place the preferred sequence in this region. ) can also be replaced with a modified sequence (m-FIP / m-BIP). From a theoretical level, the modification of the above positions can produce a functional sequence that can be recognized by Cas12b in the LAMP product. In order to further investigate which position to insert to make the recognition efficiency better, the experiment is designed to preferably modify the primer.

[0048] Based on this, the present invention inserts the designed functional sequence into the 5' end and the middle connecting part of the inner primer (5'FIP), (m-FIP), (5'-BIP), (m-BIP) and the 5' end of the loop primer (5'-LOOP F, 5'-LOOP B), respectively, and reacts at 65°C for 1 hour.

[0049] 2. Test results: Specific test results are as follows: Figure 3 , Figure 4 As shown. It can be seen that the fluorescence of the 5'FIP and 5'BIP groups is too weak, and the detection limit of the m-FIP / m-BIP / 5'LOOP F / 5'LOOP B group has a stronger fluorescence signal than the original group (without inserted sequence) and a more stable detection result at a template concentration of 0.2 copies / μL. The fluorescence curve of the m-BIP / FIP modified group showed a slight non-specific tail in the real-time fluorescence detection, while 5'LOOP F / B showed a better positive template-NTC differentiation effect, among which the fluorescence signal intensity of 5'LOOP B was better than that of 5'LOOP F, so it was selected to insert the functional sequence designed by the present invention into the back loop primer.

[0050] Experimental Example 2 Real-time fluorescence comparison of detection limits between the original group and the modified group

[0051] The functional sequence designed by the present invention was inserted into the back loop primer and compared with the original group (i.e. without the functional sequence inserted). Figure 4 , Figure 5 As shown. Figure 4 (Real-time fluorescence curve comparison) and Figure 5 (Comparison of fluorescence at the minimum detection limit end point) It can be seen that the 5'LOOP B modified group released a stronger fluorescence signal for each gradient concentration template tested, which is conducive to the signal being recognized by the detector in any instrument, and has a lower detection limit of 0.2 copies / μL, while the original group is only 2 copies / μL. It can be seen that the 5'LOOP B modified group has increased the detection sensitivity of the original system by an order of magnitude. And as Figure 7 As shown, the endpoint fluorescence signal of the reaction can be used to quantify the detection template through a standard curve.

[0052] Experimental Example 3: Comparison of endpoint fluorescence of BP detection system under different guanine contents

[0053] After screening out the most suitable position for inserting the modified sequence, considering that Cas12b has a preference for recognition and cutting of guanine content, the present invention further performs performance tests on functional sequences with different guanine contents. The functional sequence of the front end of the loop primer (5'LOOPB) was modified and tested according to Table 3 below.

[0054] Table 3 Back-loop primers containing functional sequences with different guanine contents

[0055]

[0056] The above sequences were prepared according to Table 2 (except for LOOP B, other components were the same) and 2000 copies / μL of template were tested, and the end point fluorescence was compared. The results are as follows Figure 6 As shown, the sequence with a guanine content of 40% exhibits the best fluorescence signal, and thus this primer sequence is preferred as the back-loop primer of the present invention.

[0057] Test Example 4 Sample Testing

[0058] In order to verify the clinical applicability of the present invention, we tested 20 pertussis culture-positive samples and 20 pertussis culture-negative samples from Beijing Children's Hospital Affiliated to Capital Medical University using the one-step nucleic acid detection method Exopods and real-time fluorescence quantitative PCR method provided by the present invention (the patient's infection status was independently confirmed by Beijing Children's Hospital Affiliated to Capital Medical University).

[0059] The specific operation of the one-step nucleic acid detection method Exopods is as follows: take 20 μL of liquid sample (patient sputum) and add it to the same volume of extraction-free nucleic acid release agent, shake for 5 seconds, and use the lysed sample as a template for amplification. The reaction uses the system and method established by the present invention to detect 20 pertussis-positive and 20 pertussis-negative samples, among which NC negative control: a negative sample clinically diagnosed and PCR-identified; PC positive control: a pertussis-positive sample clinically diagnosed and PCR-identified; NTC no-template control: TE buffer (template diluent);

[0060] The extraction-free nucleic acid releaser is added according to the following formula: 5 mL of 2M NaOH; 5 mL of 1M Tris-acetate, pH 8.0; 2.5 mL of dextran with a mass concentration of 20%; 5 mL of mannitol with a mass concentration of 12.5%; 2.5 mL of sucrose with a mass concentration of 20%; add water to make up to 50 mL, mix well and store at room temperature for later use.

[0061] The qPCR detection process is as follows: Use the Bordetella pertussis nucleic acid detection kit (PCR-fluorescent probe method) (Shenzhen Yilifang Biotechnology Co., Ltd., production license number Guangdong Food and Drug Administration Machinery Production Permit No. 20142667, National Machinery Registration No. 20203400152) as a comparison reagent. Take the same sample as used for the detection test, refer to the instructions of the kit, concentrate 1mL of the sample to 10μL by centrifugation at 12000×g for 5min, and then add 50μL of DNA extraction solution in the kit to the concentrated sample and treat at 100℃ for 10min. After cooling, the sample was centrifuged at 12000×g for 5min. Then, 4μL of the treated sample was added to a 16μL volume containing 15.2μL of polymerase chain reaction solution A and 0.8μL of polymerase chain reaction solution B. Finally, the real-time polymerase chain reaction assay was performed on an ABI7500 or Roche instrument.

[0062] The test results are as follows Figure 8 As shown in Table 4, it can be seen that the method of the present invention has achieved successful detection, which is completely consistent with the detection of qPCR, and the specificity and sensitivity have reached 100%.

[0063] Table 4 Comparison of consistency between the detection method of the present invention and qPCR for clinical samples

[0064]

[0065] Finally, it should be noted that the above embodiments are only illustrative of the principles, performance and efficacy of the present invention, and are not intended to limit the present invention. Anyone familiar with the technology may modify or change the above embodiments without violating the spirit and scope of the present invention. Therefore, all equivalent modifications or changes made by those with ordinary knowledge in the technical field without departing from the spirit and technical ideas disclosed by the present invention should still be covered by the claims of the present invention.

Claims

1. A one-step, extraction-free pathogen detection method based on Crispr / Cas12b-LAMP, which is used for non-diagnostic or therapeutic purposes of diseases. It is characterized in that The following steps are involved: S1. Extract the whole genome DNA sequence of pathogens and design LAMP primer sets according to the detection sites; S2. inserting a functional sequence according to the design site of the LAMP primer design set, and adding other components of LAMP amplification to obtain a LAMP amplification system; S3, placing the LAMP amplification system obtained in step S2 and the CRISPR / Cas12b system in the same PCR reaction tube to obtain a mixed system; S4, placing the mixed system obtained in step S3 at 60-65°C, reacting for 1-1.5h, and detecting under fluorescence to obtain; the pathogen in step S1 is Bordetella pertussis; the insertion position of the functional sequence in step S2 is the front end of the back loop primer, and the nucleotide sequence of the functional sequence is shown in SEQ ID NO.1; the CRISPR / Cas12b system in step S3 includes LbCas12b, sgRNA, and fluorescent probe, and the nucleotide sequence information of the sgRNA is shown in SEQ ID NO.2; the sequence of the LAMP primer set in step S1 is shown in the following table:

2. The detection method according to claim 1, It is characterized in that Other components of the LAMP amplification described in step S2 include 10× buffer, MgSO 4 , dNTP, Bst enzyme, thermostable inorganic pyrophosphatase.

3. The detection method according to claim 2, It is characterized in that The concentrations of the other components are: MgSO 4 The concentration of is 100 mM, the concentration of dNTP is 25 mM, the concentration of Bst enzyme is 8 U / μL, and the concentration of thermostable inorganic pyrophosphatase is 2000 U / mL.

4. The detection method according to claim 1, It is characterized in that The fluorescent probe is FAM-CCCCCC-BHQ1, and its concentration is 25 mM.

5. Use of the detection method according to any one of claims 1 to 4 in detecting the content of pathogenic bacteria.

Images