A lineage tracing mouse model and its construction method and application

Abstract

The present invention discloses a lineage tracing mouse model, a construction method, and an application thereof, particularly an application in establishing a mouse model of acute drug-induced liver injury. The lineage tracing mouse model provided by the present invention is constructed from the offspring produced by mating Cyp2e1-DreERT2 mice with H11-tdTomato mice. It can specifically label CYP2E1-positive central venous zone (PC) hepatocytes. Therefore, in an acute drug-induced liver injury mouse model established by the lineage tracing mouse model, the cell fate or cell dynamic behavior of the remaining PC hepatocytes near the damaged area after acute drug-induced liver injury can be tracked. The spatiotemporal dynamic changes in the molecular pathology of PC hepatocytes and the molecular mechanism driving PC cell regeneration can be further analyzed.

Description

Technical Field

[0001] The present invention belongs to the field of bioengineering technology and relates to a lineage tracing mouse model for specifically labeling CYP2E1-positive central venous zone hepatocytes, and a construction method and application thereof, in particular to its application in establishing a mouse model of acute drug-induced liver injury (e.g., induced by carbon tetrachloride), as well as its application in studying the cell fate of PC hepatocyte populations during liver injury and regeneration (tracking the cell fate of residual PC hepatocytes near the damaged area after acute drug-induced liver injury, and clarifying the mechanism driving PC hepatocyte regeneration), as well as its application in screening drugs for treating acute drug-induced liver injury. Background Art

[0002] The liver is the most regenerative solid organ and performs a variety of key functions necessary for maintaining physiological homeostasis in mammals. Histologically, the liver is composed of structural and functional units called hepatic lobules. Each hepatic lobule is arranged in a hexagonal pattern, with a central vein in the middle and a portal vein triad (portal vein, hepatic artery, and bile duct) at each corner. Functionally, blood flow has a metabolic gradient along the portal vein-central vein direction, reflecting a metabolic functional zonation (Benhamouche S et al. Apc tumor suppressor gene is the "zonation-keeper" of mouse liver [J]. Developmental cell, 2006, 10 (6): 759-770.). According to this metabolic functional zonation, the liver lobule is roughly divided into two main regions: the periportal vein (PV) (PP) and the pericentral vein (CV) (PC) regions (Jungermann K et al. Functional specialization of different hepatocyte populations [J]. Physiological reviews, 1989, 69 (3): 708-764.), or further divided into three regions (regions 1, 2 and 3) (Colnot S et al. Liver zonation [J]. Molecular pathology of liver diseases, 2011: 7-16.), or elaborated into nine regional layers (Halpern D et al. We face, I tweet: How different social media influence political participation through collective and internal efficacy [J]. Journal of Computer-Mediated Communication, 2017, 22 (6): 320-336.). Due to the existence of these functional divisions, liver lesions often show a pattern of damage to specific regions, the most common of which is damage to the PP or PC regions (Ben-Moshe S et al. Spatial heterogeneity in the mammalian liver [J]. Nature reviews Gastroenterology & hepatology, 2019, 16 (7): 395-410.).PC hepatocytes (pericentral venous zone hepatocytes) highly express enzymes involved in drug and xenobiotic metabolism and detoxification, such as the cytochrome P450 family system (Kietzmann T. Metabolic zonation of the liver: The oxygen gradient revisited [J]. Redox biology, 2017, 11: 622-630.). Compounds such as acetaminophen, anti-tuberculosis drugs (rifampicin), carbon tetrachloride (CCl4), and ethanol are often metabolized by cytochrome P450 family 2 subfamily E member 1 (CYP2E1) into toxic intermediates, leading to drug- and alcohol-induced liver damage, primarily in the PC region. In addition, since genes related to fat synthesis are also mainly distributed in the PC region, fatty liver disease, including non-alcoholic and alcoholic fatty liver disease, and steatosis also usually begin in the PC region (Brunt, EM (2007). Pathology of fatty liver disease. Modern Pathology 20, S40-S48; Chalasani, N., et al. (2008). Relationship of steatosis grade and zonallocation to histological features of steatohepatitis in adult patients with non-alcoholic fatty liver disease. Journal of Hepatology 48, 829-834). Some PC hepatocytes are also important source cells for the development of hepatocellular carcinoma (Ang Chow, H., et al. (2019). Lgr5+pericentral hepatocytes are self-maintained in normal liver regeneration and susceptible to hepatocarcinogenesis. Proceedings of the National Academy of Sciences 116, 19530-19540), and the replication of the liver stage of malaria parasites in PC hepatocytes is more significant (Ng, S., et al. (2014). Hypoxia promotes liver-stage malaria infection in primary human hepatocytes in vitro. Disease Models & Mechanisms 7, 215-224).Given the clinical relevance of PC region-related pathologies to common liver diseases, it is crucial to elucidate the mechanisms of liver regeneration after PC region-specific injury. Summary of the Invention

[0003] In order to address one or more of the problems existing in the prior art, one aspect of the present invention provides a method for constructing a lineage tracing mouse model for specifically labeling CYP2E1-positive central venous zone hepatocytes, comprising the following steps:

[0004] 1) Cyp2e1-DreERT2 genotype mice were mated with H11-tdTomato genotype mice to produce offspring mice;

[0005] 2) From the offspring mice obtained in step 1), mice that are double positive for Cyp2e1-DreERT2 and H11-tdTomato are identified and named Cyp2e1-DreERT2; H11-tdTomato mice, which serve as a lineage tracing mouse model for specifically marking CYP2E1-positive central venous zone hepatocytes.

[0006] In some embodiments, the Cyp2e1-DreERT2 mouse in step 1) is a Cyp2e1-e(2A-DreERT2-WPRE-pA)5 mouse.

[0007] In some embodiments, the H11-tdTomato mouse in step 1) is an H11-e(CAG-RSR-tdTomato)1 mouse.

[0008] In some embodiments, the Cyp2e1-DreERT2 and H11-tdTomato double-positive mice in step 2) refer to mice with Dre gene + / - and tdTomato gene + / - or tdTomato gene + / +, where + / - indicates heterozygous and + / + indicates homozygous.

[0009] Another aspect of the present invention provides a lineage tracing mouse model for specifically marking CYP2E1-positive central venous zone hepatocytes, which is constructed by the above method.

[0010] The use of the above-mentioned lineage tracing mouse model for specifically marking CYP2E1-positive central venous zone hepatocytes in establishing a mouse model of acute drug-induced liver injury also falls within the scope of the present invention.

[0011] In another aspect, the present invention provides a method for establishing a mouse model of acute drug-induced liver injury, comprising the following steps:

[0012] S1: The above-mentioned Cyp2e1-DreERT2;H11-tdTomato mice were intraperitoneally injected with tamoxifen (Tam);

[0013] S2: 5-7 days after the injection of tamoxifen, the drug is intraperitoneally injected into the Cyp2e1-DreERT2;H11-tdTomato mice to obtain the acute drug-induced liver injury mouse model.

[0014] In some embodiments, in step S1, the injection amount of tamoxifen is 1-3 mg / kg mouse body weight.

[0015] In some embodiments, in step S1, the Cyp2e1-DreERT2;H11-tdTomato mouse is 6-8 weeks old.

[0016] In some embodiments, in step S2, the drug is selected from one or more of the following: carbon tetrachloride, acetaminophen, anti-tuberculosis drugs (rifampicin), alcohol, and poisons.

[0017] In some embodiments, the drug is CCl4, and its dosage is 0.5-1 μL / g mouse body weight.

[0018] In another aspect, the present invention provides a mouse model of acute drug-induced liver injury, which is established by the above method.

[0019] The use of the above-mentioned lineage tracing mouse model for specifically marking CYP2E1-positive central venous zone hepatocytes, or the above-mentioned acute drug-induced liver injury mouse model in studying the cell fate of PC hepatocyte populations during liver injury and regeneration, or in screening drugs for treating acute drug-induced liver injury also falls within the scope of the present invention.

[0020] The lineage tracing mouse model provided based on the above technical solution can specifically mark CYP2E1-positive central venous zone hepatocytes (also referred to as Cyp2e1+PC hepatocytes in this article), and then the cell fate or cell dynamic behavior of the remaining PC hepatocytes near the damaged area after acute drug-induced liver injury can be tracked in the acute drug-induced liver injury mouse model established by the lineage tracing mouse model. It can also further analyze the spatiotemporal dynamic changes in the molecular pathology of PC hepatocytes and the molecular mechanisms that drive PC cell regeneration. Therefore, the mouse model provided by the present invention can help discover new targets for promoting liver regeneration, thereby providing new intervention measures for the clinical treatment of drug-induced liver disease, restoring endogenous liver regeneration and functional reconstruction, reducing dependence on orthotopic liver transplantation, and saving the lives of more patients with liver disease, which will have important theoretical and practical significance. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 Schematic diagram of the process for constructing a lineage tracing mouse model for specifically labeling CYP2E1-positive central venous zone hepatocytes;

[0022] Figure 2 This is a panoramic fluorescence scan of the liver of a Cyp2e1-DreERT2;H11-tdTomato mouse treated with tamoxifen;

[0023] Figure 3 Immunofluorescence staining of E-CAD, CYP2E1, and GS in liver sections of Cyp2e1-DreERT2;H11-tdTomato mice (A), immunofluorescence staining of biliary cell marker CK19 (B), and quantitative detection bar graph of RFP / CYP2E1 labeling range (C);

[0024] Figure 4 Immunofluorescence staining images of non-parenchymal cells in liver sections of Cyp2e1-DreERT2;H11-tdTomato mice;

[0025] Figure 5 RFP+ and RFP- cells were isolated from the livers of tamoxifen-pretreated Cyp2e1-DreERT2;H11-tdTomato mice by flow cytometry (A) and quantitative RT-PCR analysis was performed to evaluate the expression of PP and PC genes (B).

[0026] Figure 6 The panoramic fluorescence image (A) and quantitative detection bar graph (B) of the RFP+ area in liver sections of Cyp2e1-DreERT2;H11-tdTomato mice after intraperitoneal injection of CCl4;

[0027] Figure 7 Immunofluorescence staining of RFP with CYP2E1 and GS (A), and quantitative detection bar graph of RFP+ (n=15,11,16,17,21) and CYP2E1+ (n=15,11,16,17,21) areas at the indicated time points (B);

[0028] Figure 8 The remaining RFP+PC hepatocytes expanded and the damaged PC area was restored by immunofluorescence staining after CCl4 injection;

[0029] Figure 9 Immunofluorescence staining of RFP using E-CAD on days 0, 2, 3, 4, and 7 after CCl4 injection;

[0030] Figure 10Immunofluorescence staining of RFP for the proliferation marker Ki67 (A), and quantitative detection bar graph of the percentage of hepatocytes expressing Ki67 among RFP+ hepatocytes (B);

[0031] Figure 11 Single-cell transcriptome data analysis (A) using unified dimensionality reduction (UMAP) to visualize integrated data from all RFP+ hepatocytes at five time points (n = 15 mice, three mice per time point). UMAP visualization of integrated data, with cells colored by time after CCl4 injection. Single-cell transcriptome data analysis (B) of RFP+ hepatocytes isolated from Cyp2e1-DreERT2;H11-tdTomato mice at day 0 (D0P), day 2 (D2P), day 4 (D4P), day 7 (D7P), and day 14 (D14P) post-injection. Dot plots show the expression levels of the top five differentially expressed genes (DEGs) within each cell population. Dot size indicates the proportion of the population expressing each gene, and color indicates expression level. (C)

[0032] Figure 12 To identify differentially expressed genes (DEGs) within a given cell population, a heatmap shows the clustering of each gene cluster (A). UMAP plots highlight the expression analysis of representative proliferation markers and PC markers within the cell population (B).

[0033] Figure 13 UMAP map of the cell cycle stage distribution of all RFP+ hepatocytes;

[0034] Figure 14 GO analysis diagram of the biological process gene expression values ​​of D7P samples and D0P samples (A), and GO analysis diagram of the biological process gene expression values ​​of D14P samples and D0P samples (B), down-regulated GO terms (blue) and up-regulated GO terms (red);

[0035] Figure 15 Heat map showing the cell proliferation-related signaling pathways enriched in each cell cluster (A), and violin plots showing the expression of downstream genes in the mTOR signaling pathway in each identified cluster (B);

[0036] Figure 16 To verify the protein expression level of p-4E-BP1, a key molecule of the mTOR signaling pathway, in the CCl4-induced acute central venous zone liver injury model (A) and the APAP-induced acute central venous zone liver injury model (B);

[0037] Figure 17Figure 3: The results of functional intervention of the mTOR signaling pathway using Torin 1 and 4EGI-1, key regulatory small molecules of the mTOR signaling pathway, and their controls in mice with CCl4-induced acute central venous zone liver injury model. The results include H&E staining after intervention (A), serum transaminase expression levels (B), immunostaining of PC hepatocyte-specific functional markers (C), and quantitative data of corresponding staining indicators (D). DETAILED DESCRIPTION

[0038] The present invention aims to construct a genetic marker system that is highly correlated with clinical liver pathology. Specifically, it aims to construct a lineage tracing mouse model for specifically labeling CYP2E1-positive central venous zone hepatocytes. This lineage tracing mouse model is also used to establish a mouse model of acute drug-induced liver injury, such as a carbon tetrachloride-induced acute drug-induced liver injury mouse model. This model can be used to study the fate of PC hepatocyte populations during acute drug-induced liver injury and regeneration. Specifically, it can be used to track the cell fate of residual PC hepatocytes near the damaged area after acute drug-induced liver injury, thereby elucidating the mechanisms that drive PC hepatocyte regeneration. It can also be used to screen for drugs for the treatment of acute drug-induced liver injury. The present invention is based on at least the following findings:

[0039] Acetaminophen, anti-tuberculosis drugs (rifampicin), alcohol, carbon tetrachloride (CCl4), and other drugs and poisons are commonly metabolized by CYP2E1 in central venous zone hepatocytes into toxic intermediates, which then specifically damage CYP2E1-positive central venous zone hepatocytes, a major form of acute drug-induced liver injury. Using CYP2E1 as a marker to label these cells allows for the specific study of the damage and regenerative effects of these CYP2E1-positive hepatocytes caused by these common clinical drugs and poisons, providing an effective tool for studying the related pathogenic mechanisms and developing corresponding interventions. Based on this, the present inventors used the positive F1 parent mice of Cyp2e1-e (2A-DreERT2-WPRE-pA) 5 genotype mice and H11-e (CAG-RSR-tdTomato) 1 genotype mice to mate and breed to obtain Cyp2e1-e (2A-DreERT2-WPRE-pA) 5 and H11-e (CAG-RSR-tdTomato) 1 double-positive offspring mice (also referred to as Cyp2e1-DreERT2; H11-tdTomato lineage tracer mice herein), and carried out Tam induction on the Cyp2e1-DreERT2; H11-tdTomato lineage tracer mice. The expression of RFP was induced by Cyp2e1-DreERT2;H11-tdTomato lineage tracing mice. The gene expression characteristics of RFP-positive cells were studied by immunofluorescence staining of hepatocyte-specific markers in different metabolic functional zones and flow cytometry sorting. It was found that the Cyp2e1-DreERT2;H11-tdTomato lineage tracing mice only specifically labeled CYP2E1-positive central vein zone hepatocytes (PC hepatocytes around the central vein (CV) were specifically labeled with red fluorescent protein (RFP)), while PP hepatocytes, biliary epithelial cells and liver non-parenchymal cell lines (including vascular endothelial cells (Endomucin+), Kupffer cells (F4 / 80+) and hepatic stellate cells (PDGFR-β1+)) were not labeled. Therefore, the Cyp2e1-DreERT2;H11-tdTomato lineage tracer mice can be used to specifically label CYP2E1-positive central venous zone hepatocytes, thereby establishing an acute drug-induced liver injury mouse model, such as an acute drug-induced liver injury mouse model induced by carbon tetrachloride, acetaminophen, anti-tuberculosis drugs (rifampicin), alcohol and poisons, and used to study the cell fate of PC hepatocyte populations during acute drug-induced liver injury and regeneration. That is, it can be used to track the cell fate of residual PC hepatocytes near the damaged area after acute drug-induced liver injury, and then to elucidate the mechanism driving PC hepatocyte regeneration (for example, combining single-cell sequencing, immunostaining and in vivo functional intervention to reveal the rules of hepatocyte regeneration after acute drug-induced liver injury). It can also be used to screen drugs for the treatment of acute drug-induced liver injury.

[0040] The present invention is described in detail below with reference to specific embodiments and accompanying drawings.

[0041] Hereinafter, only certain exemplary embodiments are briefly described. As will be appreciated by those skilled in the art, the described embodiments may be modified in various ways without departing from the spirit or scope of the present invention. Therefore, the drawings and description are to be considered as illustrative in nature and not restrictive.

[0042] Unless otherwise specified, the methods used in the following examples are conventional methods. For specific steps, please refer to: Molecular Cloning: A Laboratory Manual (Sambrook, J., Russell, David W., Molecular Cloning: A Laboratory Manual, 3rd edition, 2001, NY, Cold Spring Harbor).

[0043] Unless otherwise specified, the percentage concentrations are mass / mass (W / W, g / 100 g), mass / volume (W / V, g / 100 mL) or volume / volume (V / V, mL / 100 mL) percentage concentrations.

[0044] The methods for obtaining the various biological materials described in the examples merely provide experimental methods for achieving the disclosed objectives and should not be construed as limiting the sources of the biological materials used in the present invention. In fact, the sources of the biological materials used are diverse, and any legally and ethically accessible biological material may be substituted for and used as indicated in the examples.

[0045] All primers mentioned in the present invention were synthesized using existing techniques.

[0046] Example 1: Construction and phenotypic identification of the Cyp2e1-DreERT2;H11-tdTomato lineage tracing mouse model

[0047] In this embodiment, Cyp2e1-e (2A-DreERT2-WPRE-pA) 5 (representing that the DreERT2 sequence is inserted into the promoter region of the Cyp2e1 gene, and when the Cyp2e1 gene is expressed, the DreERT2 gene is transcribed) genotype mice and H11-e (CAG-RSR-tdTomato) 1 (representing that the RSR-tdTomato sequence is inserted into the promoter region of the H11 gene, and when the H11 gene is expressed, the RSR-tdTomato gene is transcribed) genotype mice were constructed and identified by Shanghai Model Organisms Science Co., Ltd. (License No.: SCXK (Shanghai) 2017-0010), and the F1 generation positive mice of the two genotype mice (6-8 weeks old, 20-25 g) were raised in Qinghai. At the Tsinghua University Experimental Animal Center (SPF), with normal diet, water intake, and circadian rhythm (8:00-20:00), one F1 Cyp2e1-e(2A-DreERT2-WPRE-pA)5 male mouse and two F1 H11-e(CAG-RSR-tdTomato)1 female mice were co-bred. F2 generation newborn mice were identified as Cyp2e1-e(2A-DreERT2-WPRE-pA)5 and H11-e(CAG-RSR-tdTomato)1 double-positive mice (double-positive mice are mice with + / - Dre gene and + / - or + / + tdTomato gene after mating) and thus became the Cyp2e1-DreERT2;H11-tdTomato model mice required for the experiment. All animal experiments were conducted with the approval of the Laboratory Animal Care and Ethics Committee of Tsinghua University. The specific steps involved were as follows:

[0048] 1.1. Genotyping of Cyp2e1-DreERT2;H11-tdTomato Mice

[0049] 1.1.1 DNA extraction

[0050] Three weeks after birth, newborn mice (F2 generation and later) were ear-pierced and approximately 2 mm of tail tissue was removed. DNA was extracted according to the TIANamp Genomic DNA Kit instructions.

[0051] (1) Add 200 μL of buffer GA and mince the tissue thoroughly;

[0052] (2) Add 20 μL of Proteinase K solution, mix well, and digest at 56°C overnight;

[0053] (3) Add 200 μL of buffer GB, mix thoroughly by inversion, incubate at 70°C for 10 min, and briefly centrifuge;

[0054] (4) Add 200 μL of anhydrous ethanol, shake thoroughly for 15 seconds, and briefly centrifuge;

[0055] (6) Add the solution and flocculent precipitate obtained in the previous step to an adsorption column CB3, centrifuge at 12000 rpm for 30 seconds, discard the waste liquid, and return the adsorption column CB3 to the collection tube;

[0056] (6) Add 500 μL of buffer GD to the adsorption column CB3, centrifuge at 12,000 rpm for 30 seconds, discard the waste liquid, and return the adsorption column CB3 to the collection tube;

[0057] (7) Add 600 μL of rinse solution PW to the adsorption column CB3, centrifuge at 12000 rpm for 30 seconds, discard the waste liquid, and return the adsorption column CB3 to the collection tube;

[0058] (8) Repeat step 7;

[0059] (9) Place the adsorption column CB3 back into the collection tube and centrifuge at 12,000 rpm for 2 min. Discard the waste liquid and leave the adsorption column CB3 at room temperature for 5 min to completely dry the remaining rinse liquid.

[0060] (10) Transfer the adsorption column CB3 into a clean centrifuge tube, add 50 μL of elution buffer TE to the middle part of the adsorption membrane, let it stand at room temperature for 2 minutes, centrifuge at 12000 rpm for 2 minutes, and collect the solution into the centrifuge tube.

[0061] 1.1.2 PCR amplification

[0062] (1) Cyp2e1-e(2A-DreERT2-WPRE-pA)5 genotype was amplified by PCR using the primers listed in Table 1, the system listed in Table 2, and the program listed in Table 3.

[0063] Table 1: Cyp2e1-e(2A-DreERT2-WPRE-pA)5 genotype identification primer information

[0064]

[0065] Table 2: Cyp2e1-e(2A-DreERT2-WPRE-pA)5 genotype identification PCR reaction system

[0066]

[0067] Table 3: Cyp2e1-e(2A-DreERT2-WPRE-pA)5 genotype identification PCR amplification system

[0068]

[0069]

[0070] (2) PCR amplification of H11-e(CAG-RSR-tdTomato)1 was performed using the primers listed in Table 4, the system listed in Table 5, and the program listed in Table 6.

[0071] Table 4: H11-e(CAG-RSR-tdTomato)1 genotype identification primer information

[0072]

[0073] Table 5: PCR reaction system for genotyping H11-e(CAG-RSR-tdTomato)1

[0074]

[0075] Table 6: Cyp2e1-e(2A-DreERT2-WPRE-pA)5 genotype identification PCR amplification system

[0076]

[0077] 1.1.3 Gel electrophoresis and genotyping

[0078] After the PCR amplification in step 1.1.2 is completed, 1% agarose gel electrophoresis is used to identify the genotype. The genotype determination method is as follows:

[0079] (1) Cyp2e1-e(2A-DreERT2-WPRE-pA)5 genotype determination method:

[0080] Wild type: 805 bp bands were amplified from P1 and P2, but no bands were amplified from P3 and P4 (i.e., Dre gene - / -);

[0081] Heterozygotes: P1 and P2 amplified an 805 bp band, and P3 and P4 also amplified a 758 bp band (i.e., Dre gene + / -);

[0082] Homozygotes: No bands were found in P1 and P2, but 758 bp bands were amplified in P3 and P4 (i.e., Dre gene + / +).

[0083] (2) H11-e(CAG-RSR-tdTomato)1 genotype determination method:

[0084] Wild type: P5 and P6 amplified a 319 bp band; P6 and P7 had no band (i.e., tdTomato- / -);

[0085] Heterozygotes: P5 and P6 amplified a 319 bp band; P6 and P7 also amplified a 485 bp band (i.e., tdTomato+ / -);

[0086] Homozygotes: No bands were found at P5 and P6; 485 bp bands were amplified at P6 and P7 (i.e., tdTomato+ / +).

[0087] The mice identified as Cyp2e1-e(2A-DreERT2-WPRE-pA)5 and H11-e(CAG-RSR-tdTomato)1 double-positive (Dre+ / -, tdTomato+ / - or Dre+ / -, tdTomato+ / +) are the Cyp2e1-DreERT2;H11-tdTomato model mice required for the experiment.

[0088] 1.2. Tamoxifen (Tam, Sigma-Aldrich)-induced red fluorescent protein (RFP) expression

[0089] 1) Preparation and storage of Tam: Tam was dissolved in corn oil at 15 mg / mL, shaken at 37°C overnight, and stored at 4°C until completely dissolved.

[0090] 2) Tam was injected intraperitoneally at a dose of 2 mg / kg into 6-8 week old Cyp2e1-DreERT2;H11-tdTomato mice (Dre+ / -, tdTomato+ / - and Dre+ / -, tdTomato+ / + mice) to induce RFP expression. Liver tissues were harvested 5-7 days after Tam injection for subsequent immunofluorescence experiments as described in 1.3 according to the experimental design.

[0091] 1.3 Immunofluorescence on frozen tissue sections

[0092] 1) Freshly collected liver tissue was fixed in 4% PFA at 4°C for 4 h;

[0093] 2) Wash the fixed liver tissue three times with 1× PBS, then transfer it to a 30% sucrose solution and refrigerate at 4°C overnight. Observe the sucrose solution the next day. If the dehydration is good, the liver tissue will sink to the bottom of the tube.

[0094] 3) Embed the liver tissue in OCT (optimal cutting temperature compound, a water-soluble mixture of polyethylene glycol and polyvinyl alcohol) and slice using a freezing microtome to a thickness of 8-10 μm.

[0095] 4) Air-dry the sections at room temperature for 10-15 minutes, then wash twice with 1× PBS for 2-3 minutes each.

[0096] 5) Block the tissue in sections with 10% serum containing 0.2% Trixon X-100 for 30 minutes at room temperature;

[0097] 6) Use primary antibody (primary antibody) in a 4°C refrigerator overnight. Table 7 below lists the primary antibodies for immunofluorescence detection used for identification of Cyp2e1-DreERT2; H11-tdTomato mice;

[0098] 7) Select the corresponding secondary antibody (secondary antibody) according to the species of the primary antibody and incubate in the dark at room temperature for 1 hour. Table 8 below lists the secondary antibodies used for immunofluorescence detection of Cyp2e1-DreERT2; H11-tdTomato mice;

[0099] 8) Use DAPI (4',6-diamidino-2-phenylindole) to stain the nuclei for 10-15 minutes at room temperature in the dark;

[0100] 9) Use water-soluble mounting medium to protect the slides from light;

[0101] 10) Collect images under a microscope.

[0102] Table 7: Primary antibodies for immunofluorescence detection used for identification of Cyp2e1-DreERT2;H11-tdTomato mice

[0103]

[0104] Table 8: Secondary antibodies for immunofluorescence detection used for identification of Cyp2e1-DreERT2;H11-tdTomato mice

[0105]

[0106]

[0107] like Figure 1 As shown, Cyp2e1-e(2A-DreERT2-WPRE-pA)5 mice (i.e. Figure 1 Cyp2e1-DreERT2) and H11-e(CAG-RSR-tdTomato)1 mice (i.e. Figure 1 By crossing the H11-tdTomato (Cyp2e1) with the H11-tdTomato reporter line, cells expressing cyp2e1 and their progeny are permanently labeled with the red fluorescent protein (RFP) genetic marker tdTomato. Tamoxifen is given at 6-8 weeks of age to induce genetic recombination, and liver samples are collected 5-7 days later for analysis. Figure 2As shown, the results of panoramic scanning immunofluorescence staining of frozen sections of Cyp2e1-DreERT2; H11-tdTomato mice are shown, and the area around the central vein (CV) is specifically labeled with red fluorescent protein (RFP). Therefore, this example establishes a genetic lineage tracing system for CYP2E1+ central vein perivascular area (PC) hepatocytes (also referred to herein as CYP2E1+PC hepatocytes, i.e., CYP2E1-positive central vein area hepatocytes) in normal mouse livers. Figure 3 As shown, RFP was immunostained with E-CAD, CYP2E1 and GS, as well as the biliary epithelial cell marker CK19. Immunofluorescence staining results confirmed that Cyp2e1-DreERT2;H11-tdTomato specifically labeled CYP2E1+PC hepatocytes, including CYP2E1+GS+PC hepatocytes near the central vein (occupying only 1-2 cell layers), while PP hepatocytes and biliary epithelial cells were not labeled. In addition, as Figure 4 As shown, non-parenchymal liver cell lineages, including vascular endothelial cells (Endomucin+), Kupffer cells (F4 / 80+), and hepatic stellate cells (PDGFR-β1+), were also not labeled in the livers of Cyp2e1-DreERT2;H11-tdTomato lineage-traced mice.

[0108] 1.4. Extract RNA using RNeasy Mini Kit (Qiagen, 74104) and use ReverTra Ace qPCR RTMaster Mix

[0109] RNA was reverse transcribed using SYBR qPCR Mix (TOYOBO, QPS-201) and subsequently Q-PCR was performed using SYBR qPCR Mix (TOYOBO, QPS-201), specifically including the following steps:

[0110] 1) Place a tissue no larger than 30 mg in a 1.5 ml EP tube and add 350 μl-600 μl Lysis Buffer (Qiagen, 74104) (if the tissue is rich in DNase, add 10 μl β-ME to 1 ml Lysis Buffer). Mince the tissue with a pair of small scissors and centrifuge at 12,000 rpm for 3 minutes. After 3 minutes, aspirate the supernatant.

[0111] 2) Add an equal volume of 70% ethanol to the lysate, mix well with a pipette, and transfer to a spin column (Qiagen, 74104). Centrifuge at 12,000 rpm for 30 seconds at room temperature.

[0112] 3) Discard the waste liquid, add 700 μL of Buffer RW1 (Qiagen, 74104) to the spin column, and centrifuge at 12000 rpm at room temperature for 30 seconds.

[0113] 4) Discard the waste liquid, add 500 μL of Buffer RPE (Qiagen, 74104) to the spin column, and centrifuge at 12000 rpm at room temperature for 30 seconds.

[0114] 5) Discard the waste liquid, add 500 μL of Buffer RPE to the spin column, and centrifuge at 12000 rpm at room temperature for 2 minutes.

[0115] 6) Discard the waste liquid and centrifuge at room temperature at 12000 rpm for 1 min.

[0116] 7) Transfer the spin column to a new 1.5 mL collection tube, add 30 μL-50 μL RNeasy-free water (Qiagen, 74104), and centrifuge at 12,000 rpm for 1 minute at room temperature. The liquid in the collection tube is the RNA extraction solution.

[0117] 8) Use NanoDrop 2000 to detect the RNA concentration in the extract.

[0118] 9) Denature 1 μg of RNA in a total volume of 16 μL using RNA and RNeasy-free water. Heat at 65°C for 5 min to denature the RNA, then quickly transfer to ice and pre-cool for 2 min.

[0119] 10) Add 4 μL of 5×RT.MM reverse transcription reagent to a total volume of 20 μL. Set the reverse transcription program on a conventional PCR instrument to 37°C for 15 min, 50°C for 5 min, 98°C for 5 min, and terminate at 4°C.

[0120] 11) Prepare a q-PCR mixture using triple-distilled water, reverse-transcribed cDNA, and SYBR qPCR Mix (TOYOBO, QPS-201). Add primers to a 96-well plate in advance, with a total volume of 20 μL per well. Seal the 96-well plate with a blocking membrane and place it in a real-time quantitative PCR instrument. The detection program is: 95°C for 3 minutes, 95°C for 10 seconds, 60°C for 35 seconds, 65°C for 5 seconds, and 95°C for 5 seconds, for a total of 40 cycles. The PCR primers used are shown in Table 9 below.

[0121] Table 9: PCR primer sequences

[0122] Gene F(5’-3’) R(5’-3’) GAPDH GAGTCAACGGATTTGGTCGT(SEQ ID NO:8) TTGATTTTGGAGGGATCTCG(SEQ ID NO:9) Cdh1 TCGGAAGACTCCCGATTCAAA(SEQ ID NO:10) CGGACGAGGAAACTGGTCTC(SEQ ID NO:11) Cyp2e1 TAACCAAGTTGGCAAAGCG(SEQ ID NO:12) CGGCCAGAGAACTCATTCTT(SEQ ID NO:13) Gs CAGGCTGCCATACCAACTT(SEQ ID NO:14) TGCACTTCAGACCATTCTCC(SEQ ID NO:15) G6pc CGACTCGCTATCTCCAAGTGA(SEQ ID NO:16) GTTGAACCAGTCTCCGACCA(SEQ ID NO:17) Gls2 AATGCCACATTCCAGTCAGA(SEQ ID NO:18) TAACCTCCACAGAGCACAGC(SEQ ID NO:19) Oat GGCTGTGGATCATGAGAATG(SEQ ID NO:20) GCACTGCAGACACAGGGTAT(SEQ ID NO:21) Pck1 TTTGTAGGAGCAGCCATGAG(SEQ ID NO:22) TGATGATCTTGCCCTTGTGT(SEQ ID NO:23) Rhb CTTCAGCAGTGTGGGCTTTA(SEQ ID NO:24) AGCGTTGATCAAACTCTCCA(SEQ ID NO:25)

[0123] Based on the RFP gene expression of Cyp2e1-DreERT2;H11-tdTomato, CYP2E1 and CYP2E1 hepatocytes were isolated from the livers of Cyp2e1-DreERT2;H11-tdTomato mice pretreated with tamoxifen by flow cytometry. Figure 5 These isolated hepatocytes were then used for gene expression analysis of previously reported PP and PC compartment markers (Braeuning, Albert, et al. "Differential gene expression in periportal and perivenous mouse hepatocytes." The FEBS journal 273.22 (2006): 5051-5061.). As expected, PC compartment-specific genes (Cyp2e1, Gs, Rhbg, and Oat) were expressed at significantly higher levels in RFP+ cells, while PP compartment-specific genes (Cdh1, Gls2, Pck1, and G6pc) were expressed at significantly lower levels in RFP+ cells ( Figure 5 Together, these results indicate that Cyp2e1-DreERT2;H11-tdTomat mice specifically label CYP2E1+ PC hepatocytes in the liver and that these lineage-tracing mice can serve as a powerful tool for studying the cell fate of PC hepatocyte populations during liver injury and regeneration.

[0124] Example 2: Establishment of an acute drug-induced liver injury model induced by carbon tetrachloride

[0125] After CCl4 injection induced acute liver injury in wild-type mice (c57bl / 6), we found that most of the PC region hepatocytes were killed, and only 1-2 circles of CYP2E1+PC hepatocytes remained around the injury. In order to clarify how this group of residual PC region hepatocytes promotes repair and regeneration, this example used the genetic lineage tracing system established in Example 1 to study the fate changes of the residual CYP2E1+ hepatocytes. Tamoxifen was injected in advance (intraperitoneally at a dose of 2 mg / kg) into 6-8 week old Cyp2e1-DreERT2; H11-tdTomato mice to induce RFP gene expression 5-7 days later, a single dose of CCl4 (1 μL / g mouse body weight) was injected into the mice intraperitoneally, and liver samples were collected on the 2nd to 7th day for analysis. Figure 6 As shown, panoramic immunofluorescence staining showed that the RFP-positive area in the liver increased from day 2 to day 7 after CCl4 injection ( Figure 6 A and B).

[0126] 2.1 Fixing liver tissue samples and paraffin sections

[0127] 1) The fixed liver tissue was automatically dehydrated using a dehydrator according to the program listed in Table 10:

[0128] Table 10 Automatic dehydration program for liver tissue

[0129]

[0130]

[0131] 2) After the automatic dehydration process is completed, transfer the liver tissue to a paraffin embedding machine for embedding. Place it on ice for 5-10 minutes and wait for the wax block to fall off automatically before sectioning.

[0132] 3) Use a microtome to make 4 μm serial paraffin sections. Place the sections in water in the microtome (42°C). After the tissue is evenly spread, remove the sections with a glass slide. After absorbing any remaining water stains on the slide, bake the sections in a microtome (62°C) for 60-90 min.

[0133] 2.2 Immunohistofluorescence staining (IF) of paraffin sections

[0134] 1) Paraffin sections were dewaxed using xylene (2 times, 5 min each time), 100% ethanol (2 times, 3 min each time), 95% ethanol (1 time, 3 min), and 75% ethanol (1 time, 3 min). After dewaxing, the sections were washed 3 times with distilled water. Frozen sections were allowed to stand at room temperature for 15 min and then removed by immersion in PBS (2 times, 3 min each time).

[0135] 2) Antigen retrieval was performed by microwave heating of sodium citrate solution for 10 minutes;

[0136] 3) Incubate with 0.2% Triton X-100 at room temperature for 15 min, then wash three times with 1× PBS;

[0137] 4) Block with 10% goat serum or 10% donkey serum at room temperature for 1 hour, depending on the antibody species, and wash three times with 1× PBS.

[0138] 5) Primary Antibody Incubation: Prepare antibodies using the corresponding blocking serum at the dilution concentration specified in the manufacturer's instructions. Incubate at 4°C overnight. Table 7 below lists the primary antibodies used for immunofluorescence detection of Cyp2e1-DreERT2 and H11-tdTomato mice.

[0139] 6) Equilibrate at room temperature for 30 minutes, wash three times with 1× PBS, select the corresponding secondary antibody based on the primary antibody species, incubate at room temperature in the dark for 1 hour, and wash three times with 1× PBS. Table 8 below lists the secondary antibodies used for immunofluorescence detection of Cyp2e1-DreERT2 and H11-tdTomato mice.

[0140] 7) DAPI was used to stain the cell nuclei, and the cells were incubated in the dark for 15 min at room temperature, followed by three washes with 1× PBS.

[0141] 8) Seal the slides with water-soluble sealing agent;

[0142] 9) Observe and capture images under a microscope (Perkin Elmer).

[0143] Table 7: Primary antibodies for immunofluorescence detection used for identification of Cyp2e1-DreERT2;H11-tdTomato mice

[0144]

[0145]

[0146] Table 8: Secondary antibodies for immunofluorescence detection used for identification of Cyp2e1-DreERT2;H11-tdTomato mice

[0147]

[0148] like Figure 7 As shown, GS and CYP2E1 proteins were combined with RFP protein to immunostain liver tissues at different times derived from the Cyp2e1-DreERT2; H11-tdTomato mouse model. The results showed that on the second day of injury (i.e., the peak of injury), all RFP+GS+PC hepatocytes were killed, and only 1-2 layers of RFP+CYP2E1+PC hepatocytes survived around the necrotic area, which is consistent with the pathological conditions observed in wild-type mice treated with CCl4. During the recovery process, the number of RFP+CYP2E1+PC hepatocytes gradually increased, and from the fourth day, RFP+GS+PC hepatocytes reappeared around the central vein. On the seventh day, the expression pattern of proteins such as GS, CYP2E1 and E-CAD in the liver lobule returned to normal (the state on the first day) ( Figure 7 However, not all regenerating Cyp2e1 hepatocytes were RFP. From day 3 to day 7, the area occupied by CYP2E1+ hepatocytes was larger than that occupied by CYP2E1+RFP+ hepatocytes ( Figure 8 ), and this phenomenon was still observed even after 4 weeks of recovery. Quantitative analysis of the area occupied by CYP2E1+ hepatocytes and CYP2E1+RFP+ hepatocytes showed that ( Figure 7 Middle B), the majority of regenerated CYP2E1+PC hepatocytes (approximately 84%) were derived from RFP+PC hepatocytes on day 2. A small portion (~16%) of regenerated CYP2E1+PC hepatocytes lacked RFP expression, indicating that they were derived from previously uninjured RFP-PP hepatocytes. In addition, immunostaining results also showed that regenerated RFP+PC cells began to express E-CAD, a characteristic protein of PP hepatocytes, starting on day 3, and returned to normal PP area distribution on day 7 ( Figure 9 ). In addition, if Figure 10 As shown in the figure, on the second day, there were a large number of proliferating hepatocytes in the undamaged PP area, while in the residual RFP+PC hepatocytes, there were fewer Ki67 proliferating cells. RFP+PC hepatocytes began to proliferate significantly on the third day. The proliferation of both PP and PC hepatocytes decreased significantly on the fourth day, and by the seventh day, they had almost returned to a state of almost no proliferation ( Figure 10 In summary, the results of this example indicate that CCl4-induced acute PC region damage is mainly repaired by the proliferation of residual CYP2E1+ PC region hepatocytes, supplemented by the proliferation of CYP2E1-PP hepatocytes ( Figure 10 ).

[0149] Example 3: Multi-omics data analysis of spatiotemporal dynamic molecular and cellular behaviors of PC hepatocytes during liver regeneration after acute drug-induced liver injury

[0150] 3.1. Single-cell sequencing processing (this step was completed in collaboration with GeekGene Technology Co., Ltd.)

[0151] To reveal global transcriptional changes in PC hepatocytes during injury and regeneration at single-cell resolution, the transcriptomes of RFP+ PC hepatocytes from CCl4-treated Cyp2e1-DreERT2;H11-tdTomato mice on days 2, 4, 7, and 14 and control mice (day 0) were sorted by flow cytometry and characterized by single-cell RNA sequencing (scRNA-seq). Diploid cells, immune cells, mesenchymal and endothelial cell types, and low-quality hepatocytes were filtered out from the dataset, retaining high-quality hepatocyte transcriptomes for subsequent analysis.

[0152] Single-cell RNA sequencing and computational analysis RFP+ fresh hepatocytes were isolated from acute carbon tetrachloride-treated mice (days 2, 4, 7, and 14) and control mice (day 0) and subjected to scRNA-seq analysis. These isolated cells were processed using the 10xChromium30v3 kit (10x Genomics) according to the manufacturer's protocol. The target number of captured cells ranged from 4,000 to 10,000 cells. The library was sequenced using the NovaSeq 6000Sp (Illumina). For data preprocessing, Cell Ranger (v4.0.0, reference genome: mm10-2020-A) was used to process the raw scRNA-seq data. Then, the R package developed by the inventor's group was applied for data quality control and normalization (Guo, W., et al. (2021). scCancer: a package for automated processing of single-cell RNA-seq data incancer. Briefings in Bioinformatics 22, bbaa127). To identify hepatocytes, after quality control and filtering of the sorted RFP+ hepatocytes, unsupervised clustering (Seurat FindClusters) was used to obtain the main cell clusters. Hepatocyte clusters were identified by calculating the hepatocyte type score in each cell. In total, 7242 high-quality hepatocytes were obtained at five time points (2825 at D0, 217 at D2, 872 at D4, 969 at D7, and 2359 at D14). Uniform manifold approximation and projection were used to visualize the single-cell analysis results. To analyze the dynamic changes of hepatocytes, we used linear regression to remove batch effects between samples for further analysis. The dynamic changes of hepatocyte clusters were analyzed based on KEGG pathways and GO terms, similar to the analysis of ST data analysis. The CellChat package (Jin, S., et al. (2021). Inference and analysis of cell-cell communication using CellChat. Nature Communications 12, 1088) was used to infer interactions between cell subpopulations based on ligand-receptor expression.

[0153] like Figure 11 As shown in Figure 2, the datasets of all five samples were integrated to allow cross-sample comparison. Unsupervised graph-based clustering identified 14 cell clusters based on the top five differentially expressed genes (DEGs) from all RFP+PC hepatocytes ( Figure 11Next, the selected DEGs were used to characterize the most important biological features in each cluster at day 2 and day 4, time windows that capture the important stages of injury and regeneration. Figure 12 As shown in Figure 3, in samples collected on days 2 and 4, respectively, clusters 8 and 14 were mainly enriched for genes related to cell cycle and DNA replication (H2afz, Lcn2, Tubb5, Mki67, Tmsb4x, Hmgb2, Ube2c, Stmn1, and Hist1h2ap), indicating that they are the proliferative subpopulations of PC cells in response to acute PC cell injury ( Figure 12 In addition, representative PC functional markers (Oat, Cyp2e1, Cyp2c9, Cyp2c50, and Rgn) were found to be downregulated in the two proliferating cell populations compared with other cells with weaker proliferative ability, indicating that liver function is reduced during hepatocyte proliferation ( Figure 12 (A and B). Notably, genes encoding acute phase proteins (Saa1, Saa2, Orm1, Orm2, and Hpx) were also enriched in cluster 8, revealing inflammatory and innate immune responses, as well as hepatocyte injury in these cells on day 2, which may contribute to the recruitment of innate immune cells after injury. Clusters 9 and 10 from day 4 samples showed upregulation of genes related to antioxidant and detoxification (Gsta3, Gsta4, Cbr1, Gstp1, and Esd), as well as genes related to gluconeogenesis (Fbp1, Eno1, Gapdh, and Akr1a1). These genes may help neutralize the cytotoxic free radical metabolites of carbon tetrachloride and produce glucose to meet the energy needs of active regeneration. Cluster 11 in day 4 samples was enriched in genes that promote cell survival (Igfbp1, Neat1, Clu, Trp53inp1, and Hes1), especially genes encoding secretory proteins (Igfbp1 and Clu), suggesting that these cells may exert cytoprotective effects on themselves or neighboring cells under CCl4-induced stress ( Figure 12 Middle A). The cell cycle phase of each cluster was analyzed using the Seurat package. Figure 13 As shown, cells in cluster 8 were found to be divided into S phase and G2M phase, while cells in cluster 14 were mainly in G2M phase. Cells in other clusters starting from day 4 or day 7 were classified as G1 or S phase, and clusters starting from day 14 and day 0 were defined as G0 phase (outside the cell cycle) ( Figure 13 Although complete histological recovery was observed at day 7 after carbon tetrachloride injection, the scRNA-seq dataset showed transcriptional differences between day 0 and day 7 hepatocytes ( Figure 11 Further analysis of DEGs was performed as follows. Figure 14 As shown, compared with day 0, the toxic substance metabolism process in hepatocytes was upregulated and the fatty acid metabolism process was downregulated on day 7 ( Figure 14 When the evaluation time was extended to day 14, the transcriptome almost returned to the control level (day 0), but some transcriptional differences still existed. These included decreased cholesterol metabolism and increased nucleotide metabolism in hepatocytes at day 14 compared with day 0 ( Figure 14 (B), which means that transcriptional recovery after acute PC injury lags behind histological recovery. Taken together, these results indicate that PC cells undergo a series of adaptive changes in cell proliferation, detoxification, innate immune response, cell survival, and glycolipid metabolism in response to acute PC cell injury in different cell populations and at different time points.

[0154] 3.2 In vivo functional validation of the mTOR / 4E-BP1 signaling axis

[0155] (1) 4EGI-1 (inhibitor) was initially dissolved in 100 mg / mL DMSO and then dissolved in 40% polyethylene glycol, 5% Tween 80, and 50% double-distilled water. Wild-type mice (C57BL / 6) were intraperitoneally injected at a dose of 50 mg / kg once a day for 4 consecutive days.

[0156] (2) Torin 1 (mTOR inhibitor) was first dissolved in 100% N-methyl-2-pyrrolidone at 25 mg / ml, then diluted with sterile 50% polyethylene glycol at a ratio of 1:4 to a final concentration of 5 mg / ml. Wild-type mice (C57BL / 6) were intraperitoneally injected at a dose of 20 mg / kg once a day for 4 consecutive days.

[0157] (3) Control mice were treated with the corresponding solvent as a control group, and samples for analysis were collected at the designated time points.

[0158] To reveal the potential pathways for regulating PC cell proliferation after acute PC cell injury, this example analyzed the signature gene signatures of RFP+ PC cells during injury and regeneration. Figure 15 As shown, the mTOR signaling pathway (mTORC1_signaling and PI3K_AKT_mTOR_signaling) was enriched in the proliferating cell clusters in the samples on day 2 and day 4, and showed a co-expression pattern with proliferation-related pathways (G2M_checkpoint, E2F_targets, Myc_targets_v1 and DNA_repair) ( Figure 15 In addition, core components of mTOR signaling, such as Rheb, Eif4e, Eif4e2, and Cdk1, were also upregulated in these cell clusters ( Figure 15Middle B). We further identified the protein expression level of phosphorylated 4E-BP1, a key effector molecule of mTOR, after acute central venous injury and found that it was significantly expressed in peri-injured hepatocytes after CCl4- and APAP-induced acute central venous liver injury ( Figure 16 To further evaluate the functional role of the mTOR / 4E-BP1 signaling axis in PC hepatocyte regeneration, highly selective inhibitors of key components of the mTOR / 4E-BP1 axis: mTOR (Torin 1, inhibiting rapamycin-resistant 4E-BPs phosphorylation) and eukaryotic translation initiation factor 4E (eIF4E) (4EGI-1, inhibiting eIF4E / eIF4G interaction) were used in a CCl4-induced liver injury model. Compared with the control group, these inhibitors significantly delayed liver repair, as determined by larger necrotic areas and elevated serum alanine aminotransferase (ALT) levels starting on day 3 ( Figure 17 Similarly, they hampered the remodeling of the PC area, as indicated by a slower expansion of the GS+ and CYP2E1+ areas. Furthermore, these inhibitors significantly reduced the proliferation of PC hepatocytes on day 3, followed by a delayed increase in proliferation relative to the control group on day 4 ( Figure 17 These results suggest that the mTOR / 4E-BP1 axis is an important mechanism affecting PC hepatocyte regeneration.

[0159] In summary, the results of the above examples demonstrate that the use of a newly developed lineage-tracing transgenic mouse model, combined with multiple analytical methods such as immunostaining, single-cell sequencing, and in vivo functional intervention, has significantly advanced our understanding of liver regeneration after acute PC cell injury at the cellular and molecular levels. This study, for the first time, elucidates the contributions of distinct hepatocyte populations to regeneration after acute PC cell injury and reveals the spatiotemporal dynamics of hepatocyte molecular changes. This provides a powerful, visual, and quantifiable tool for studying various acute and chronic liver injuries.

[0160] Finally, it should be noted that the above descriptions are merely preferred embodiments of the present invention and are not intended to limit the present invention. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art will be able to modify the technical solutions described in the aforementioned embodiments or substitute equivalents for some of the technical features. Any modifications, equivalent substitutions, and improvements made within the spirit and principles of the present invention shall be included within the scope of protection of the present invention.

Claims

1. A method for constructing a lineage tracing mouse model for specifically labeling CYP2E1-positive hepatocytes surrounding the central vein of the liver, comprising the following steps: 1) Cyp2e1-DreERT2 Genotype of mice H11-tdTomato Mice of the genotypes were mated to produce offspring mice; 2) Identifying the offspring mice obtained in step 1) Cyp2e1-DreERT2 and H11-tdTomato Double positive mice, named Cyp2e1-DreERT2;H11-tdTomato The mouse model serves as a lineage tracing mouse model for specifically labeling CYP2E1-positive pericentral venous hepatocytes.

2. The construction method according to claim 1, wherein the step 1) Cyp2e1-DreERT2 Mice are Cyp2e1-e (2A-DreERT2-WPRE-pA)5 mice; and / or As described in step 1) H11-tdTomato Mice are H11-e(CAG-RSR-tdTomato)1 mouse.

3. The construction method according to claim 1 or 2, wherein in step 2) Cyp2e1-DreERT2 and H11-tdTomato Double positive mice are Dre Gene + / -, and tdTomato Gene + / - or tdTomato Mice with the gene + / +, where + / - indicates heterozygous positive and + / + indicates homozygous positive.

4. Use of a lineage tracing mouse model for specifically labeling CYP2E1-positive pericentral venous hepatocytes constructed by the method of any one of claims 1 to 3 in establishing a mouse model of acute drug-induced liver injury.

5. Use of a lineage tracing mouse model for specifically labeling CYP2E1-positive pericentral venous hepatocytes constructed by the method of any one of claims 1 to 3 in studying the fate of pericentral venous hepatocytes during liver injury and regeneration, or in screening drugs for treating acute drug-induced liver injury.

6. A method for establishing a mouse model of acute drug-induced liver injury, comprising the following steps: S1: The reference to claim 1 Cyp2e1-DreERT2;H11-tdTomato Mice were injected intraperitoneally with tamoxifen; S2: 5-7 days after the injection of tamoxifen, Cyp2e1-DreERT2;H11-tdTomato The mice were intraperitoneally injected with drugs to obtain the acute drug-induced liver injury mouse model.

7. The method according to claim 6, wherein in step S1, the injection amount of tamoxifen is 1-3 mg / kg mouse body weight; and / or In step S1, the Cyp2e1-DreERT2;H11-tdTomato The mice were 6-8 weeks old.

8. The method according to claim 6 or 7, wherein in step S2, the drug is selected from one or more of the following: carbon tetrachloride, acetaminophen, anti-tuberculosis drugs, alcohol, and poisons.

9. The method according to claim 8, wherein in step S2, the drug is CCl4, and the dosage thereof is 0.5-1 μL / g mouse body weight.

10. The method according to claim 8, wherein the anti-tuberculosis drug is rifampicin.

11. Use of the mouse model of acute drug-induced liver injury established by the method of any one of claims 6 to 10 in studying the fate of pericentral venous hepatocytes during liver injury and regeneration, or in screening drugs for treating acute drug-induced liver injury.

Images