SNP Loci Related to Chicken Growth Traits and Their Applications
By identifying SNP sites related to chicken growth traits and developing KASP primers, the problems of slow chicken growth rate and insufficient improvement of static chicken breeding are solved, and the rapid improvement and efficient breeding of chicken growth traits are achieved, which improves the growth performance and market competitiveness of chickens.
Patent Information
- Application Number
- CN202311420393.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2023-10-30
- Publication Date
- 2025-07-08
- Estimated Expiration
- 2043-10-30
AI Technical Summary
In the prior art, the slow growth rate of chickens leads to low market weight, limiting the profitability of the livestock and poultry industry, and the research on molecular markers related to growth traits of Jingyuan chickens is lacking, which affects the breeding improvement process.
Through KASP genotyping and correlation analysis, SNP sites significantly related to chicken growth traits were identified, and corresponding KASP primers and detection kits were developed for molecular marker-assisted selection and genomic selection, retaining individuals with specific genotypes as breeders, and increasing the frequency of dominant alleles generation by generation.
The process of chicken breeding improvement has been accelerated, the growth performance of offspring chickens has been improved, the market competitiveness of breeding companies has been increased, and consumers have met the demand for high-quality meat.
Smart Images
Figure CN117887859B_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biotechnology, and particularly relates to SNP loci related to growth traits on chicken chromosomes and their applications. Background Art
[0002] The slow growth rate of animals results in a low market weight, which limits the profitability of breeding practices in any production system, causing livestock and poultry to be gradually marginalized in the market and facing the risk of elimination. The livestock and poultry industry attaches great importance to the body type development during the brooding period, and the healthy development of livestock and poultry can be intuitively judged by the body type development. The body type development largely determines the growth and development, slaughter performance, meat quality, egg quality, etc. of livestock and poultry. The development laws of bone development and body weight are slightly different. The bones develop relatively fast at 10 weeks of age, reaching more than 80% of the adult level, and 90% at 12 weeks of age. However, the body weight is in a continuous development process. At 8 weeks of age, only 27% of the maximum body weight is completed. Therefore, more attention should be paid to the growth and development of bones in the early stage. The most obvious indicators of body type and bones are the shank length. Therefore, the shank length is used to measure the bone development. According to the relationship between the growth and development of livestock and poultry bones and body weight, it is necessary to ensure the nutritional supply during the brooding period and feed a full-price brooding feed to make the shank length and body weight fully meet the standards.
[0003] With the rise of ecological breeding, the improvement of people's living standards and the increasingly fierce market competition, consumers' requirements for meat quality are also increasing. Livestock and poultry products with good nutrition, hygiene and flavor are becoming more and more popular in the market, and green foods without pollution and drug residues have become people's pursuit. Because Jingyuan chickens have the characteristics of being resistant to roughage, suitable for grazing and having delicious meat, grazing and raising them on grasslands, forest belts and wastelands is a natural pollution-free food, which has been widely welcomed and recognized by consumers. However, the research on the growth traits of Jingyuan chickens, especially the opening of molecular markers associated with growth traits, is still very lacking. Starting from the growth and development laws of Jingyuan chickens, the present invention uses a mathematical model to perform curve fitting analysis on the body weight and growth traits of Jingyuan chickens to study the growth and development characteristics; measures the body size traits at key time points of Jingyuan chickens, analyzes the correlations, and screens out loci significantly related to the growth traits of Jingyuan chickens, providing a basis for molecular breeding and variety improvement of local chicken breeds, especially Jingyuan chickens. Summary of the Invention
[0004] Aiming at the problems existing in the prior art, the present invention provides SNPs significantly related to chicken growth traits identified by KASP genotyping and correlation analysis strategies, and uses them in molecular marker-assisted selection and genomic selection to select genotypes favorable for improving chicken growth traits for seed retention, thereby gradually increasing the gene frequency of advantageous alleles from generation to generation, which can accelerate the process of breeding improvement of breeding chickens and bring huge economic benefits to chicken farming.
[0005] The primary objective is to identify SNP molecular markers significantly associated with chicken growth traits. The molecular markers are located at the C>T mutation at position 31770290, and / or the C>A mutation at position 31770461, and / or the G>A mutation at position 31770776 on chromosome 5 (NC_052536.1) of the chicken genome reference sequence.
[0006] The specific SNP markers are shown in the following table
[0007]
[0008] Another objective of the present invention is to provide KASP primers for detecting the above-mentioned molecular markers or a detection kit containing the above KASP primers. The primers are shown in the following table
[0009]
[0010] Another objective of the present invention is to provide the application of the above-mentioned molecular markers in screening chicken individuals with excellent growth traits. Specifically, the genotype at position 31770290, and / or the genotype at position 31770461, and / or the genotype at position 31770776 on chicken chromosome 5 (NC_052536.1) is detected, and individuals with the genotype GG at position 31770776 on chicken chromosome 5 (NC_052536.1) are retained as breeding chickens.
[0011] In a preferred embodiment, individuals with the genotype GG at position 31770776 and the genotype CC at position 31770290 on chicken chromosome 5 (NC_052536.1) are retained as breeding chickens.
[0012] In another preferred embodiment, individuals with the genotype GG at position 31770776 and the genotype CT at position 31770290 on chicken chromosome 5 (NC_052536.1) are retained as breeding chickens.
[0013] Another objective of the present invention is to provide the application of the above KASP primers or detection kit in identifying genotypes significantly associated with chicken growth traits. Specifically, the genotype at position 31770290, and / or the genotype at position 31770461, and / or the genotype at position 31770776 on chicken chromosome 5 (NC_052536.1) is detected using the above KASP primers, and individuals with the genotype GG at position 31770776 on chicken chromosome 5 (NC_052536.1) are retained as breeding chickens.
[0014] Furthermore, the above-mentioned KASP primers or detection kits are applied in the genomic selection and breeding of chickens. Specifically, the genotypes at position 31770290, and / or position 31770461, and / or position 31770776 on chicken chromosome 5 (NC_052536.1) are detected using the above-mentioned KASP primers or detection kits, and individuals with the genotype GG at position 31770776 on chicken chromosome 5 (NC_052536.1) are retained as breeding chickens.
[0015] In a preferred embodiment, individuals with the genotype GG at position 31770776 and the genotype CC at position 31770290 on chicken chromosome 5 (NC_052536.1) are retained as breeding chickens.
[0016] In another preferred embodiment, individuals with the genotype GG at position 31770776 and the genotype CT at position 31770290 on chicken chromosome 5 (NC_052536.1) are retained as breeding chickens.
[0017] Furthermore, the above-mentioned KASP primers or detection kits are applied in improving the growth traits of chickens.
[0018] Specifically, the genotypes at position 31770290, and / or position 31770461, and / or position 31770776 on chicken chromosome 5 (NC_052536.1) are detected using the above-mentioned KASP primers or detection kits, and individuals with the genotype GG at position 31770776 on chicken chromosome 5 (NC_052536.1) are retained as breeding chickens.
[0019] In a preferred embodiment, individuals with the genotype GG at position 31770776 and the genotype CC at position 31770290 on chicken chromosome 5 (NC_052536.1) are retained as breeding chickens.
[0020] In another preferred embodiment, individuals with the genotype GG at position 31770776 and the genotype CT at position 31770290 on chicken chromosome 5 (NC_052536.1) are retained as breeding chickens.
[0021] Another object of the present invention is to provide a method for genetic improvement of chickens, the method comprising: determining the genotypes of the above-mentioned molecular marker loci related to excellent growth traits of chickens in a breeding chicken resource population, and making corresponding selections according to the genotypes of the corresponding loci: retaining in the breeding chicken resource population the breeding chicken individuals with the genotype GG at the 31,770,776th position on chromosome 5 (NC_052536.1) of the chicken reference genome GRCg7b to gradually increase the frequency of the AA genotype at this locus, thereby improving the growth traits of the offspring chickens. The chicken population includes Jingyuan chickens and their synthetic lines.
[0022] In a preferred embodiment, individuals with the genotype GG at the 31,770,776th position and the genotype CC at the 31,770,290th position on chicken chromosome 5 (NC_052536.1) are retained as breeding chickens.
[0023] In another preferred embodiment, individuals with the genotype GG at the 31,770,776th position and the genotype CT at the 31,770,290th position on chicken chromosome 5 (NC_052536.1) are retained as breeding chickens.
[0024] Specifically, it includes the following steps:
[0025] (1) Extract the genomic DNA of the chicken to be tested;
[0026] (2) Detect the genotype of the chicken to be tested using the aforementioned KSAP primers or detection kit;
[0027] (3) Based on the detection results, determine the molecular markers of the C>T mutation at the 31,770,290th position, and / or the C>A mutation at the 31,770,461st position, and / or the G>A mutation at the 31,770,776th position on chromosome 5 (NC_052536.1) of the chicken reference genome GRCg7b in the chicken to be tested.
[0028] (4) Retain the breeding chicken individuals with the genotype GG at the 31,770,776th position on chromosome 5 (NC_052536.1) of the chicken reference genome GRCg7b as breeding chickens.
[0029] In a preferred embodiment, individuals with the genotype GG at the 31,770,776th position and the genotype CC at the 31,770,290th position on chicken chromosome 5 (NC_052536.1) are retained as breeding chickens.
[0030] In another preferred embodiment, individuals with the genotype GG at the 31,770,776th position and the genotype CT at the 31,770,290th position on chicken chromosome 5 (NC_052536.1) are retained as breeding chickens.
[0031] The growth traits of the chickens described above include one or more of the following traits: body weight, shank length, body slant length, keel length, chest width, chest depth, chest angle, pelvic width, shank circumference, etc.
[0032] During the improvement process of the growth traits of chickens, it is preferred to improve the body weight trait.
[0033] The present invention has the following advantages and effects compared with the prior art:
[0034] First, new molecular markers related to the growth traits of chickens are determined, and corresponding KASP primers are developed.
[0035] Second, new haplotypes related to the growth traits of chickens are determined.
[0036] Second, the SNP molecular markers determined by the present invention are applied to the genetic improvement of the excellent growth traits of breeding chickens, which can improve the initial body height of the offspring chickens, thereby increasing the market competitiveness of breeding enterprises. BRIEF DESCRIPTION OF THE DRAWINGS
[0037] The following combines the drawings and specific embodiments to detail the method and its beneficial effects of the present invention.
[0038] Figure 1 It is the pooled PCR sequencing result of Jingyuan chickens at the 31770290th site on chromosome 5 (NC_052536.1) of the chicken reference genome GRCg7b.
[0039] Figure 2 It is the pooled PCR sequencing result of Jingyuan chickens at the 31770461st site on chromosome 5 (NC_052536.1) of the chicken reference genome GRCg7b.
[0040] Figure 3 It is the pooled PCR sequencing result of Jingyuan chickens at the 31770776th site on chromosome 5 (NC_052536.1) of the chicken reference genome GRCg7b.
[0041] Figure 4 It is the haplotype linkage map of Jingyuan chickens at the 31770290th and 31770461st sites on chromosome 5 (NC_052536.1) of the chicken reference genome GRCg7b. DETAILED DESCRIPTION OF THE EMBODIMENTS
[0042] The technical solutions in the embodiments of the present invention are clearly and completely described below. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.
[0043] Unless otherwise defined, all technical and scientific terms used in this application have the same meaning as commonly understood by ordinary technicians in the technical field to which this application belongs.
[0044] Example 1 Correlation analysis of body weight and body size traits of Jingyuan chicken
[0045] Body size traits refer to the morphological characteristics of the animal's body that can be measured numerically. Screening individuals with high or low productivity through body size can greatly promote the improvement of economic traits in breeding livestock and poultry.
[0046] 1. Experimental Animals
[0047] This study was conducted from November 4, 2021 to May 2, 2022. The Jingyuan Chicken conservation population of the Jingyuan Chicken National Conservation Farm in Pengyang County, Ningxia Hui Autonomous Region was used as the experimental subject. 180 Jingyuan Chickens (90 roosters and hens) were randomly selected, and all experimental animals were in the same breeding environment and conditions.
[0048] 2. Experimental methods
[0049] (1) Growth performance measurement
[0050] The body size of Jingyuan chickens at 42, 126 and 180 days of age was measured. The measurement items refer to the terminology and measurement statistical methods of poultry production performance, and the measurement indicators are:
[0051] 1. Body oblique length: Use a tape measure to measure the distance from the shoulder joint to the ischial tuberosity along the body surface (cm).
[0052] 2. Keel length: Use a tape measure to measure the distance from the front end of the keel process on the body surface to the end of the keel (cm).
[0053] 3. Chest width: Measure the surface distance between the two joints with a caliper (cm).
[0054] 4. Thoracic depth: Measure the distance from the first thoracic vertebra to the front edge of the keel on the body surface with a caliper (cm).
[0055] 5.Chest angle: Use a chest angle meter to measure the chest angles on both sides at the front edge of the keel.
[0056] 6. Pelvic width: Measure the distance between the two hip tuberosities with a caliper (cm).
[0057] 7. Tibial circumference: the circumference of the mid-tibia (cm).
[0058] 8.Chest circumference: the circumference of the chest behind the shoulder joint (cm).
[0059] 3. Data analysis and processing
[0060] Use Excel to statistically analyze the data, and use SPSS 25.0 software to conduct correlation tests on the body weight and body size traits at 42 days of age, 126 days of age, and 180 days of age.
[0061] The results are as follows:
[0062] Table 1 Correlation analysis of body weight and body size of Jingyuan chickens at 42 days of age
[0063]
[0064] Note: Marked ** indicates extremely significant (P < 0.01), * indicates significant correlation (P < 0.05), and unmarked * indicates non-significant correlation (P > 0.05). The same applies to the following tables.
[0065] Table 2 Correlation analysis of body weight and body size of Jingyuan chickens at 126 days of age
[0066]
[0067] Note: The upper triangle is for hens and the lower triangle is for roosters. The same applies to the following tables.
[0068] Table 3 Correlation analysis of body weight and body size of Jingyuan chickens at 180 days of age
[0069]
[0070] Table 1 shows that at 42 days of age, the body weight and shank length of Jingyuan chickens are extremely significantly positively correlated with other body size traits (P < 0.01); in the correlation analysis of body weight and body size of Jingyuan chickens at 42 days of age, the correlation between body weight and shank length is the largest, followed by keel length and pelvic width, indicating that the growth and development in the early stage are mainly the growth and development of the trunk.
[0071] Table 2 shows that at 126 days of age, for roosters of Jingyuan chickens, the body weight is not significantly positively correlated with chest depth and chest circumference (P > 0.05), significantly positively correlated with shank length and keel length (P < 0.05), not significantly negatively correlated with chest angle (P > 0.05), and extremely significantly positively correlated with other body size traits (P < 0.01). For hens of Jingyuan chickens at 126 days of age, the body weight is not significantly positively correlated with chest circumference (P > 0.05), significantly positively correlated with chest depth (P < 0.05), not significantly negatively correlated with chest angle (P > 0.05), and extremely significantly positively correlated with other body size traits (P < 0.01).
[0072] Table 3 shows that for Jingyuan chicken cocks at 180 days of age, body weight was not significantly positively correlated with keel length (P>0.05), not significantly negatively correlated with chest angle (P>0.05), and extremely significantly positively correlated with other body size traits (P<0.01). For Jingyuan chicken hens at 180 days of age, body weight was not significantly positively correlated with chest angle and chest circumference (P>0.05), significantly positively correlated with keel length and chest depth (P<0.05), and extremely significantly positively correlated with other body size traits (P<0.01); shank length was not significantly positively correlated with chest width, chest depth, pelvic width, and chest circumference (P>0.05), not significantly negatively correlated with chest angle (P>0.05), and extremely significantly positively correlated with other body size traits (P<0.01).
[0073] Example 2 Screening of Gene Polymorphic Loci
[0074] 1. Experimental Animals
[0075] In this study, from November 4, 2021 to May 2, 2022, the Jingyuan chicken conservation population in the Jingyuan chicken national conservation farm in Pengyang County, Ningxia Hui Autonomous Region was used as the experimental object. 180 Jingyuan chickens wearing wing numbers from the same batch were selected, and body size measurements were taken at 42 days, 126 days, and 180 days of age. At 126 days of age, 180 chickens were bled from the wing vein for subsequent experiments.
[0076] 2. Experimental Instruments
[0077] Collect the venous blood of all individuals of the above samples with blood collection tubes and store them in a -80°C refrigerator for later use.
[0078] 3. Experimental Reagents
[0079] Table 4 Main Reagents Used in the Experiment
[0080]
[0081] 4. Extraction of Blood DNA and Construction of Pool
[0082] Use a DNA extraction kit to extract Jingyuan chicken blood DNA. At the same time, use agarose gel electrophoresis to detect the quality of DNA extraction, and use a micro nucleic acid protein detector to detect the concentration of the extracted DNA. Randomly select 60 qualified DNA samples, take 1 μl each and mix them into a 1.5 ml centrifuge tube to construct a DNA mixing pool, and store it at -20°C for subsequent experiments.
[0083] 5. Primer Design and PCR Amplification
[0084] The gene sequence of Gallus gallus ACTC1 (located on chromosome 5 NC_052536.1) published in NCBI (https: / / www.ncbi.nlm.nih.gov / ) was designed and amplified using Primer5.0 software (Table 5) and sent to Shanghai Sangon Biotechnology Co., Ltd. for synthesis.
[0085] Table 5 PCR primer sequence information
[0086]
[0087] The gene amplification system is 50 μL: 6 μL of cDNA sample, 2 μL of upstream and downstream primers, and Taq PCR Master Mix.
[0088] 25μL, ddH2O 15μL. The PCR amplification program was: 95℃ pre-denaturation for 5min; 95℃ denaturation for 15s, annealing for 40s, 72℃ extension for 1min, a total of 35 cycles; 72℃ extension for 5min, 4℃ storage. The product was detected by 1% agarose gel electrophoresis and sent to Shanghai Bioengineering Co., Ltd. for sequencing.
[0089] 6. Sequencing results and screening of polymorphic sites
[0090] The amplified samples that met expectations were sent to Shanghai Biotech Co., Ltd. for sequencing. The results were compared with the original sequences using SnapGene and compared with the sequencing peak graph to find the SNP sites present in the Jingyuan chicken population. Figures 1-3 The results of mixed pool sequencing of partial fragments of rs314569587, rs739523856 and rs316229551 loci respectively indicate that the above loci are polymorphic in the Jingyuan chicken population.
[0091] Example 3 Primer design and detection of KASP molecular markers
[0092] The polymorphic SNP sites were obtained according to Example 2, and KASP genotyping primers were designed.
[0093] The DNA sequences of the designed primers are as follows:
[0094] Table 6 KASP molecular marker primer information
[0095]
[0096] The detected SNP loci and the complete blood of the Jingyuan chicken population were submitted to Compson for KASP gene detection and typing.
[0097] Example 4 Association analysis between ACTC1 gene SNP and growth traits
[0098]
[0099] For 42-day-old Jingyuan chickens, at the rs739523856 locus, the shank circumference and chest circumference of CA-type individuals were significantly higher than those of AA-type individuals (P<0.05). At the rs316229551 locus, the body weight of GA-type individuals was significantly higher than that of GG-type individuals (P<0.05).
[0100] At 126 days of age, the pelvic width of CT-type individuals at the rs314569587 locus was significantly higher than that of CC-type individuals. The chest circumference of CC-type individuals was extremely significantly higher than that of CT-type individuals (P<0.01), and the chest circumference of TT-type individuals was significantly higher than that of CT-type individuals (P<0.05). At the rs739523856 locus, the chest circumference of CA-type individuals was significantly higher than that of AA-type individuals (P<0.05). In rs316229551, the body weight and shank length of GG-type individuals were significantly higher than those of GA-type individuals (P<0.05). The body slant length of GG-type individuals was significantly higher than that of AA-type individuals (P<0.05) and extremely significantly higher than that of GA-type individuals (P<0.01). The pelvic width of GG-type individuals was extremely significantly higher than that of GA-type individuals (P<0.01).
[0101] At 180 days of age, at the rs314569587 locus, the chest width of CT-type individuals was significantly higher than that of CC-type individuals (P<0.05), and the chest depth of CT-type individuals was extremely significantly higher than that of CC-type individuals (P<0.01). At the rs316229551 locus, the body weight, body slant length, chest width, chest depth, chest angle, and shank circumference of GG-type individuals were significantly higher than those of GA-type and / or AA (P<0.05).
[0102] Example 5 Linkage disequilibrium analysis
[0103] Perform linkage disequilibrium (LD) analysis on the above 3 mutation sites in the hybrid offspring using Haploview 4.2 software to analyze the linkage degree between SNPs and infer their haplotypes. The results ( Figure 4 ) show that rs314569587 and rs316229551 have strong linkage disequilibrium in the Block1 region, generating three haplotypes: CG, TG, and CA, named H1, H2, and H3 in sequence.
[0104] H1 is the dominant haplotype with a frequency of 0.668, and H3 is the lowest with a frequency of 0.156. Among the diploid types, H1H1 is the dominant diploid type with a frequency of 0.441, and H2H2 is the lowest with a frequency of 0.028.
[0105]
[0106] Example 6 Association analysis of different diploid types with growth traits
[0107] The association between different genotypes and growth traits at different stages was analyzed using the Generalized Linear Model (GLM) (Table 9). The results showed that at 42 days of age, the body weight of H1H3 individuals was significantly greater than that of H1H1 genotype (P < 0.05). At 126 days of age, the shank length of H1H1 individuals was significantly greater than that of H3H3 genotype (P < 0.05), the body slant length of H1H1 and H1H2 individuals was significantly greater than that of H1H3, H2H3, and H3H3 genotypes (P < 0.05), the chest depth of H1H2 individuals was significantly greater than that of H1H3 and H3H3 genotypes (P < 0.05), the pelvic width of H1H2 individuals was significantly greater than that of H1H1 and H1H3 genotypes (P < 0.05), and the chest circumference of H2H2 individuals was significantly greater than that of H1H1, H1H2, and H2H3 genotypes (P < 0.05). At 180 days of age, the body weight of H1H1 and H1H2 individuals was significantly greater than that of H1H3 genotype (P < 0.05), the body slant length of H1H1 individuals was significantly greater than that of H1H3 and H3H3 genotypes (P < 0.05), the chest width of H1H2 individuals was significantly greater than that of H3H3 genotype (P < 0.05), the chest depth of H1H2 individuals was significantly greater than that of H1H1 and H3H3 genotypes (P < 0.05), and the chest angle of H1H2 individuals was significantly greater than that of H1H3 genotype (P < 0.05).
[0108] Therefore, H1H1 and H1H2 are preferably the dominant genotypes.
[0109]
[0110] The above description of the disclosed embodiments enables those skilled in the art to implement or use the present invention. Various modifications to the above embodiments will be apparent to those skilled in the art, and the general principles defined herein can be implemented in other embodiments without departing from the spirit or scope of the present invention. Therefore, the present invention will not be limited to the embodiments shown herein, but rather to the widest scope consistent with the principles and novel features disclosed herein.
Claims
1. A method for improving chicken growth traits, characterized in that: The method comprises the following steps: detecting the chicken genome GRCg7b Genotype of nucleotide position 31770776 on chromosome 5 of the genome, select position 31770776 Individuals with the GG genotype are used as breeding chickens, the chickens include Jingyuan chickens or their synthetic lines, and the growth traits are one or more of tibial circumference, pelvic width, breast angle, breast depth, breast width, body oblique length, and tibial length.
2. A method for improving chicken growth traits, characterized in that: The method comprises the following steps: detecting the chicken genome The genotype of the nucleotide position 31770776 and the genotype of the nucleotide position 31770290 on chromosome 5 of the GRCg7b genome are retained as breeding chickens with the genotype of the nucleotide position 31770776 on chromosome 5 being GG and the genotype of the nucleotide position 31770290 being CC or CT; the chicken includes the Jingyuan chicken or its synthetic line, and the growth trait is one or more of pelvic width, breast angle, breast depth, breast width, body oblique length, and tibia length.
3. The method according to claim 1 or 2, characterized in that The method for detecting the genotype of nucleotide position 31770776 and / or the genotype of nucleotide position 31770290 on chromosome 5 of the chicken genome GRCg7b comprises the following steps: (1) Extracting genomic DNA from the chicken population to be tested; (2) using the first primer set and / or the second primer set to detect the genotype of the chicken to be tested; the first primer set is used to detect the G>A mutation corresponding to the 31770776th position of chromosome 5 of the chicken genome GRCg7b, with the RS number being rs316229551; the second primer set is used to detect the C>T mutation corresponding to the 31770290th position of chromosome 5 of the chicken genome GRCg7b, with the RS number being rs314569587; The nucleic acid sequence of the first primer set is as follows: SEQ ID NO.7: gaaggtgaccaagttcatgctCCAGCCATCCTTTATTGGTAAGTG SEQ ID NO.8: gaaggtcggagtcaacggattCCAGCCATCCTTTATTGGTAAGTA SEQ ID NO.9: TGATTCATTTGCACCTCCTACTGA; The nucleic acid sequence of the second primer set is as follows: SEQ ID NO.1: gaaggtgaccaagttcatgctCAGGTTATTCCAACTGGTTTCTGAC SEQ ID NO.2: gaaggtcggagtcaacggattCAGGTTATTCCAACTGGTTTCTGAT SEQ ID NO.3: CCAGAGTCAAGAACAATACCTGGA; (3) Based on the test results, determine the locus genotype of the chicken to be tested as described in claim 1 or 2.
4. A use of a SNP molecular marker for improving growth traits in chickens, wherein the SNP molecular marker site corresponds to the G>A mutation at position 31770776 of chromosome 5 in the chicken genome GRCg7b; the chicken comprises Gallus gallus domesticus or a synthetic strain thereof, and the growth trait is one or more of pelvic width at 126 days of age, body oblique length at 126 days of age, shank length at 126 days of age, body weight at 126 days of age, shank circumference at 180 days of age, breast angle at 180 days of age, breast depth at 180 days of age, breast width at 180 days of age, body oblique length at 180 days of age, and body weight at 180 days of age; wherein If the genotype is GG, the growth trait is a dominant growth trait; if the genotype is GA, the growth trait is a non-dominant growth trait.
5. A use of a SNP molecular marker in improving chicken growth traits, wherein the SNP molecular marker site corresponds to the G>A mutation at position 31770776 of chromosome 5 of the chicken genome GRCg7b; the chicken comprises a Silent Genus or a synthetic strain thereof, and the growth trait is body weight at 42 days of age; wherein, If the genotype is GA, the growth trait is a dominant growth trait; if the genotype is GG, the growth trait is a non-dominant growth trait.
6. Use of a single-nucleotide polymorphism (SNP) molecular marker for improving growth traits in chickens, wherein the SNP marker loci correspond to a C>T mutation at position 31770290 and a G>A mutation at position 31770776 on chromosome 5 of the chicken genome GRCg7b; the chicken comprises Gallus gallus domesticus or a synthetic strain thereof; and the growth trait is one or more of pelvic width at 126 days of age, body oblique length at 126 days of age, breast angle at 180 days of age, breast depth at 180 days of age, body oblique length at 180 days of age, and body weight at 180 days of age. in, If the genotype at position 31770776 is GG and the genotype at position 31770290 is CC or CT, then the growth trait is a dominant growth trait; if the genotype at position 31770776 is GA and the genotype at position 31770290 is CC, then the growth The trait is a non-dominant growth trait.