Application of non-coding RNA as a molecular marker in the preparation of a kit for predicting potential malignant diseases of the oral mucosa

Abstract

The present invention discloses the application of non-coding RNA as a molecular marker in the preparation of a kit for predicting oral mucosal potential malignant diseases and canceration, and relates to the technical field of molecular biology. The oral squamous cell carcinoma marker of the present invention includes miR-24-3p, miR-205-5p or circ-ATG5. The present invention constructs a patient-specific ncRNA expression spectrum database for oral squamous cell carcinoma (OSCC), draws differential expression maps of miRNAs and circRNAs, and finally screens a group of novel salivary exosome non-coding RNA markers, namely miR-24-3p, miR-205-5p, circ-ATG5, which are the first salivary exosome ncRNA markers that have been confirmed to be useful for oral mucosal potential malignant disorders (OPMDs) canceration screening, and have high sensitivity and specificity for the diagnosis of OSCC.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular biology, and in particular to the use of non-coding RNA as a molecular marker in the preparation of a kit for predicting the carcinogenesis of potential malignant diseases of oral mucosa. Background Art

[0002] Oral cancer is one of the most common head and neck malignancies in my country. In 2020, the number of new cases and deaths ranked at the forefront of head and neck malignancies, and tumors originating from the lips and oral cavity have been listed as the 18th most common cancer in the world. Oral squamous cell carcinoma (OSCC) accounts for more than 90% of oral cancers. It is a multi-step progressive disease of oral mucosal tissue that undergoes hyperplasia, abnormal hyperplasia, carcinoma in situ, and invasive cancer. It is highly invasive and prone to lymph node metastasis in the early stages. The five-year survival rate of patients still hovers around 60%. Existing medical technologies such as surgical resection of the primary lesion and lymph node dissection, traditional chemotherapy drugs, and radiotherapy are the main strategies for "post-cancer treatment" of OSCC, which have improved the survival rate of patients to a certain extent and given patients hope for diagnosis and treatment. However, oral and maxillofacial regions are the main organs that affect human appearance and eating function. The large-area tissue defects, postoperative scars, radiation oral mucositis, and rampant dental caries caused by systematic diagnosis and treatment of OSCC seriously affect the patient's facial appearance, speech, chewing and swallowing functions, leading to a sharp decline in the patient's quality of life. Therefore, close monitoring of patients with oral potential malignant disorders (OPMDs) with a tendency to malignant transformation in order to achieve early diagnosis and early treatment of oral cancer patients is a new strategy for tumor prevention and treatment to ensure the basic quality of life of patients, reduce the medical burden, and improve the national economic benefits.

[0003] OPMDs is a general term for a large class of oral diseases with an increased risk of canceration. The typical representative of OPMDs is oral leukoplakia (OLK). Studies have shown that during the follow-up period of 12 months to 20 years, the overall canceration rate of OPMDs was 7.9%, of which the canceration rate of the OPMDs subtype OLK was 9.5%. OLK usually has specific epithelial structural disorders and cell atypia, and is divided into mild, moderate, and severe oral epithelial dysplasia (oralepithelial dysplasia, OED) according to the depth and severity of the changes. Some studies have shown that the risk of OLK canceration is associated with the grade of OED. Compared with mild dysplasia, moderate / severe dysplasia has a higher risk of canceration. However, not all OLKs that present as OED will eventually progress to OSCC. Lesions that have not been found to have OED or tumor-related histopathological features in previous histopathological biopsies can also develop into cancer. This indicates that the method of predicting the risk of OPMDs canceration by simply determining the OED grade through traditional histopathological examination is not perfect, and it is necessary to explore OPMDs canceration biomarkers related to or independent of the OED grade. Therefore, there is an urgent need for a biomarker that can reflect the disease status of OPMDs patients in the clinic to determine which type of OPMDs patients can maintain a stable clinical state and which type of OPMDs patients will undergo malignant transformation.

[0004] Exosomes are membrane vesicles with a lipid bilayer structure and a diameter of about 30-150nm secreted by cells. They contain various bioactive molecules, such as DNA, proteins, mRNAs, lipids, miRNAs, circRNAs, etc. Tumor cell-derived exosomes can reflect the genomic and epigenetic changes of the origin cells because the bioactive molecular components they carry are close to the parental tumor cells, so as to clarify the degree of tumor progression and response to treatment. Exosomes can be derived from almost all cells and exist in most biological fluids including plasma, saliva, urine, etc., providing new targets for liquid biopsy for tumor screening. As a new tumor screening strategy, exosome liquid biopsy technology has also received great attention in the field of OSCC patient screening and disease monitoring. Compared with other solid tumors, OSCC cancer tissue is directly exposed to the complex oral microenvironment, and the saliva in the mouth (including gingival crevicular fluid) can directly erode OSCC tissue and have a biological effect on it. In addition, in addition to exchanging substances with blood and lymph, free biomolecules from OSCC tissue can also enter saliva directly or through the transport of blood circulation. Therefore, compared with other conventional detection technologies, saliva-based liquid biopsy has its unique advantages in OPMDs cancer screening: ① Saliva is considered to be a "mirror of the human body" and can reflect the physiological and pathological changes of local and even distant organs in the oral cavity; ② Saliva is an easily accessible biological diagnostic liquid, the sampling process is rapid and the technical sensitivity is low, and the sample will not coagulate and maintain good stability and is easy to store; ③ The non-invasive sampling method of saliva means that a large number of samples can be collected repeatedly for analysis, providing an opportunity to monitor the changes in the condition of OPMDs patients throughout their life cycle over time; ④ Compared with blood / serum body fluid samples, the molecular components in saliva are relatively simple, and the protein contained is less, thus avoiding the interference of inherent biomolecules in the blood on the results. The specific phospholipid bilayer membrane structure of exosomes can protect ncRNA from the influence of RNase or other environmental factors. Therefore, the ncRNA carried by exosomes is highly stable and has a longer "lifespan" than free ncRNA. Exosomal ncRNA has become a biomarker of great interest in the field of precision medicine due to its high stability, and exosomal miRNAs and circRNAs in saliva have been shown to be suitable for non-invasive monitoring of a variety of malignant tumors. However, there is currently a lack of reliable indicators that can be used to clarify the risk of OPMDs canceration and non-invasively monitor its disease changes. Therefore, clarifying the changes in the expression pattern of salivary exosomal ncRNA in patients with OPMDs canceration, screening specific biomarkers, and preparing clinically feasible liquid biopsy kits are urgent issues to be solved in the field of OPMDs molecular diagnosis. Summary of the invention

[0005] The purpose of the present invention is to overcome the deficiencies of the prior art and provide the use of non-coding RNA as a molecular marker in the preparation of a kit for predicting the carcinogenesis of potential malignant diseases of the oral mucosa.

[0006] To achieve the above object, the technical solution adopted by the present invention is: to provide an oral squamous cell carcinoma marker, wherein the marker includes miR-24-3p, miR-205-5p or circ-ATG5.

[0007] The present invention also provides the use of non-coding RNA as a molecular marker in the preparation of a kit for predicting potential malignant diseases and carcinogenesis of oral mucosa, wherein the non-coding RNA includes miR-24-3p, miR-205-5p or circ-ATG5.

[0008] As a preferred embodiment of the application of the present invention, the canceration is a potential malignant disease of the oral mucosa that develops into oral squamous cell carcinoma.

[0009] The present invention also provides the use of a reagent for detecting non-coding RNA in a sample in the preparation of a kit for predicting potential malignant diseases and carcinogenesis of oral mucosa, wherein the non-coding RNA includes miR-24-3p, miR-205-5p or circ-ATG5.

[0010] As a preferred embodiment of the application of the present invention, the sample is saliva.

[0011] As a preferred embodiment of the application of the present invention, the reagent includes a reagent for detecting the expression level of non-coding RNA in a sample by sequencing technology and qRT-PCR quantitative detection technology.

[0012] The present invention also provides a kit for predicting potential malignant diseases and carcinogenesis of oral mucosa, the kit comprising a reagent for detecting non-coding RNA in a sample; the non-coding RNA comprises miR-24-3p, miR-205-5p or circ-ATG5.

[0013] As a preferred embodiment of the kit of the present invention, the kit comprises an RNA reverse transcription reaction solution, a quantitative PCR reaction solution, a standardized quantitative Cel-miR-39 external reference probe and a GAPDH internal reference probe.

[0014] As a preferred embodiment of the kit of the present invention, the RNA reverse transcription reaction solution includes the following components: 5× PrimeScript Buffer, PrimeScript RT Enzyme Mix I, Primer Mix, RNase Free dH2O; the quantitative PCR reaction solution includes the following components: SYBR Green I Master, PCR Forward Primer, Reverse Primer, cDNA solution, RNase Free ddH2O.

[0015] The present invention also provides the use of non-coding RNA as a molecular marker in the preparation of a product for diagnosing oral squamous cell carcinoma.

[0016] Beneficial effects of the present invention: The present invention provides the use of non-coding RNA as a molecular marker in the preparation of a kit for predicting the canceration of potential malignant diseases of the oral mucosa. The present invention constructs an OSCC patient-specific ncRNA expression spectrum database, draws differential expression maps of miRNAs and circRNAs, and finally screens a group of novel salivary exosome non-coding RNA markers, namely miR-24-3p, miR-205-5p, and circ-ATG5, which are salivary exosome ncRNA markers that have been confirmed for the first time to be used for OPMDs canceration screening, and have high sensitivity and specificity for the diagnosis of OSCC. The present invention provides the use of non-coding RNA as a molecular marker in the preparation of a kit for predicting the canceration of potential malignant diseases of the oral mucosa. Compared with traditional histopathological biopsy, the kit of the present invention provides a non-invasive liquid biopsy detection technology for canceration screening of OPMDs patients, which is easy for patients to accept. At the same time, the problem of cumbersome extraction steps and high requirements for instruments and equipment in the traditional exosome differential ultracentrifugation method is solved. The present invention formulates a standardized extraction and detection process for salivary exosomes, and the ncRNA markers are quantitatively accurate and easy to carry out clinically. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 : A is a hierarchical clustering heat map showing that there are differences in the expression profiles of salivary exosome miRNAs between OSCC patients and healthy individuals; B is a hierarchical clustering heat map showing that there are differences in the expression profiles of salivary exosome circRNAs between OSCC patients and healthy individuals; C is a hierarchical clustering heat map showing that there are differences in the expression profiles of circRNAs between tumor tissues and normal mucosal tissues of OSCC patients; D is the intersection of the differences in circRNA expression profiles of tissue and saliva samples to screen OSCC-specific circ-ATG5.

[0018] Figure 2: qRT-PCR verified the differential expression of miR-24-3p, miR-205-5p, and circ-ATG5 in OSCC.

[0019] Figure 3 : ROC curve analysis of the differential diagnostic ability of miR-24-3p, miR-205-5p, and circ-ATG5 for OSCC.

[0020] Figure 4 : A is the CCK-8 experiment evaluating the effects of miR-24-3p-rich exosomes and miR-24-3p-deficient exosomes on the viability of recipient OSCC cell lines HSC6 and SCC25 cells; B is the growth curve of SCC25 and HSC6 cells transiently overexpressing miR-24-3p; C is the cloning efficiency of SCC25 and HSC6 cells transiently overexpressing miR-24-3p; Data are shown as mean ± standard error, *P<0.05, **P<0.01.

[0021] Figure 5 : A is the effect of knocking down circ-ATG5 on the proliferation ability of OSCC cells evaluated by CCK-8 experiment; B is the effect of knocking down circ-ATG5 on the clone formation ability of OSCC cells; C and D are the effects of knocking down circ-ATG5 on the migration and invasion ability of OSCC cells; *P<0.05. DETAILED DESCRIPTION

[0022] The above contents of the present invention are further described in detail below through specific implementation methods in the form of embodiments. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. All technologies realized based on the above contents of the present invention belong to the scope of the present invention.

[0023] In the embodiment of the present invention:

[0024] (1) The standardized procedure for saliva collection is as follows: Saliva collection from OSCC and OPMDs patients is performed before treatment measures such as pathological biopsy or surgical resection, drug treatment, chemotherapy and radiotherapy are implemented, and complete clinical medical history information is collected for each sample. 5 ml of resting saliva is obtained from patients and healthy controls according to the standard measures described below: First, all subjects are reminded not to eat, drink coffee or caffeinated soft drinks, chew gum, rinse mouth with mouthwash, brush teeth or other oral hygiene measures at least one hour before saliva collection. The saliva collection time is controlled between 9:00 am and 12:00 noon. During sampling, each subject is required to rinse the mouth with clean water and then wait for 5 minutes. Remind the patient not to talk or swallow during saliva collection, and do not spit into the collection tube. Subsequently, saliva collection is completed within 30 minutes using a pre-cooled 50 ml conical tube. After the sample is collected, it is placed at 4 ° C and centrifuged at 3000g for 30 minutes as soon as possible to reduce contamination of the sample by cell debris, bacteria, food residues, etc. Separate the supernatant, repeat centrifugation at 16000 gg for 30 min at 4°C, and aliquot 500 μl of the supernatant into each tube for subsequent testing. If necessary, store it at -80°C for later use.

[0025] (2) Saliva exosome extraction steps: Use polymer precipitation reagent to obtain exosomes from saliva samples (0.5-1.0ml). After thoroughly mixing the exosome extraction components with the purified saliva sample in a ratio of 1:2, place in a 4°C refrigerator for overnight incubation (at least 12h). Note that the centrifuge tube must be kept upright and avoid shaking during the sample incubation process. Centrifuge the incubated mixture at 1500g for 30min at 4°C. After centrifugation, white exosome precipitate can be seen at the bottom of the centrifuge tube. Carefully aspirate the supernatant (do not stir the precipitate). Centrifuge the precipitate again at 1500g for 5min at 4°C. After fully aspirating the residual supernatant, collect the exosome precipitate and resuspend it in 100μl phosphate buffer for subsequent analysis.

[0026] (3) Extraction and quality detection of salivary exosome RNA: The total RNA of exosomes was further extracted using the Trizol (Invitrogen) method. Due to the lack of consensus housekeeping genes for quantitative analysis of exosome miRNAs, 25 fmol of synthetic Cel-miR-39 mimics were added as an external reference after Trizol lysis for subsequent qRT-PCR experiments. The purity and concentration of RNA samples were detected using a NanoDrop 2000 micro-volume UV spectrophotometer.

[0027] Example 1

[0028] (1) Construction of differential expression database of ncRNAs and screening of specific ncRNAs

[0029] miRNA screening: Four exosome samples from OSCC patients and four from healthy individuals were collected for miRNAs expression profile chip analysis. The OSCC saliva samples were from OSCC patients who were treated and treated in the Department of Oral and Maxillofacial Surgery, Affiliated Stomatological Hospital of Sun Yat-sen University, and the saliva samples of healthy individuals were from healthy volunteers recruited at the same time. All subjects considered eligible for inclusion in this database construction must meet the following criteria: ① OSCC patients were first diagnosed by histopathological biopsy. ② All patients did not receive clinical treatment such as chemotherapy and radiotherapy before surgery. ③ All subjects did not have other oral mucosal lesions, other malignant tumors, and serious systemic diseases. In addition, there was no significant difference in age and gender distribution between OSCC patients included in this study and the healthy control group (P>0.05). The human miRNA expression profile of human species was detected using Agilent's Human miRNA Microarray, Release 21.0, 8x60K chip, which covers a total of 2549 human miRNAs. The chip hybridization experiment and data analysis were entrusted to Beijing Bio-Jingdian Biotechnology Co., Ltd. The obtained gene expression data were subjected to an unpaired t-test to obtain the differential fold change (Log Fold Change, Log FC) of miRNAs between the two groups of samples and the statistical significance index P value. The Benjamini-Hochberg FDR algorithm was used to correct the P value to control false positives and obtain the corrected value FDR. Differentially expressed miRNAs were screened based on the absolute difference fold FC of more than 2.0 times and FDR≤0.05. The results showed that compared with healthy controls, the expression levels of 109 miRNAs in salivary exosomes of OSCC patients changed significantly, of which 50 miRNAs increased in expression (fold change 3.60 to 345.62 times) and 59 miRNAs decreased in expression (fold change 0.02 to 0.49 times). The hierarchical and average linkage clustering methods in the R language and its extension packages were further used to perform unsupervised hierarchical clustering analysis on the candidate differentially expressed miRNAs, and the results were displayed as cluster heat maps as shown in the figure. Figure 1 As shown in A. Figure 1 A. Hierarchical clustering heat map showing differences in the expression profiles of salivary exosome miRNAs between OSCC patients and healthy individuals.

[0030] circRNA screening: circRNA sequencing analysis was performed on 5 exosomes and tissue samples from OSCC patients and 5 from healthy individuals. The sample sources and inclusion criteria were the same as miRNA screening. The ArraystarHuman circRNA Array V2 chip from Arraystar was used to detect the circRNA expression profile of human species. The chip hybridization experiment and data analysis were entrusted to Shanghai Digital Spectrum Biotechnology Co., Ltd. An unpaired t-test was performed on the obtained gene expression data to obtain the differential fold changes of circRNAs between samples and the statistical significance index P value. Differentially expressed circRNAs were screened based on the absolute difference multiple LogFC being above 1.0 times and satisfying P<0.05. The results showed that compared with healthy controls, 3030 genes were upregulated and 1639 genes were downregulated in salivary exosome samples of OSCC patients, while 167 genes were upregulated and 154 genes were downregulated in tissue samples. After taking the intersection of the two, the results showed that there were 56 commonly upregulated circRNAs and 23 downregulated circRNAs. The clustering heat map shows the results as follows Figure 1 B. Figure 1 C. The intersection of the two was used to screen OSCC-specific circRNAs. Figure 1 D.

[0031] According to the analysis of miRNAs expression profile chip and circRNAs sequencing results, the candidate OSCC-specific ncRNAs were screened as miR-24-3p, miR-205-5p, and circ-ATG5, and their sequencing expression changes are shown in Table 3. The gene sequences of miR-24-3p, miR-205-5p, and circ-ATG5 are shown in Table 1, and the designed primers of miR-24-3p, miR-205-5p, and circ-ATG5 are shown in Table 2.

[0032] Table 1 ncRNA marker gene sequences

[0033]

[0034] Table 2 Primer sequences

[0035]

[0036]

[0037] Table 3 Differential expression of candidate OSCC-specific ncRNAs markers in salivary exosomes

[0038]

[0039] (2) Quantitative detection of OSCC-specific ncRNAs by qRT-PCR

[0040] Forty-five exosome samples from OSCC patients and 10 from healthy individuals were collected for expression analysis of miR-24-3p and miR-205-5p to verify differential expression. Another 39 salivary exosome samples from OSCC patients and 15 from healthy individuals were collected for differential expression of circ-ATG5. The sources of the above samples were the same as the inclusion criteria (1).

[0041] Total RNA samples were reverse transcribed to obtain cDNA, using reagents including 5× PrimeScript Buffer (for Real Time) 2μl, PrimeScript RT Enzyme Mix I 0.5μl, Primer Mix 0.5μl, Total RNA 500ng, and RNase Free dH2O Up to 10μl. Reverse transcription was performed in a gradient PCR instrument, and the miRNA reverse transcription reaction program was set as follows: 42℃, 15min; 85℃, 5s; 4℃, continuous cooling. The circRNA reverse transcription program was set as follows: 37℃, 15min; 85℃, 5s; 4℃, continuous cooling.

[0042] The primers synthesized by Ribio were used to perform quantitative PCR on cDNA. The reagents used were 10μl of SYBR Green IMaster, 1μl of PCR Forward Primer (10μm), 1μl of Reverse Primer (10μm), 2μl of template (cDNA solution), and 6μl of RNase Free ddH2O. The qPCR reaction was performed using the 96 detection system with the following program settings: initial denaturation at 95°C / 10 min, one cycle; PCR amplification at 95°C / 10 s, 65°C / 15 s, 72°C / 15 s, 45 cycles; melting curve analysis at 95°C / 5 s, 65°C / 60 s, 97°C continuous; cooling at 4°C / 10 s.

[0043] After the PCR reaction, the original CT value of each gene was obtained, with Cel-miR-39 and GADPH as references. The primers of Cel-miR-39 and GADPH are shown in Table 2. ΔCT = CT (target gene) - CT (reference gene), with 2 -ΔΔCT The relative expression of the target gene was calculated by the method. The difference in the expression of ncRNAs in salivary exosome samples of OSCC patients and healthy subjects was detected and compared.

[0044] The results are as follows Figure 2 As shown. Figure 2As shown in A, the relative expression of salivary exosomal miR-24-3p in the healthy control group was 1.594±0.5154 (mean±SE), while it was upregulated in the OSCC patient group, which was 9.127±1.768 (mean±SE). The differential expression between the two groups was 5.73 times (P<0.05). Figure 2 As shown in B, the relative expression of miR-205-5p in the healthy control group was 2.925±1.647 (mean±SE), while it was upregulated in the OSCC patient group, which was 13.64±2.822 (mean±SE). The differential expression between the two groups was 4.66 times (P<0.05). Figure 2 As shown in Figure C, the relative expression of circ-ATG5 in the healthy control group was 0.004±0.001 (mean±SE), while it was upregulated in the OSCC patient group, which was 0.066±0.012 (mean±SE). The differential expression between the two groups was as high as 14.85 times (P<0.05).

[0045] (3) Data processing and analysis

[0046] Data processing and analysis of (2) above were performed. All data were statistically analyzed using Excel, Graphpad prism 8.0, and SPSS24.0 software, and the values ​​were expressed as mean ± SEMs. For comparison of variables between the two groups, when the statistical data followed a normal distribution and the variance was equal, the t-test was used; when the statistical data followed normality but the variance was unequal, the corrected t-test was used. To evaluate the accuracy of ncRNAs in diagnosing OSCC, the ROC curve was drawn using SPSS software, and the AUC value was obtained. The Uden index was calculated using the formula "sensitivity + specificity - 1" to determine the optimal cut-off threshold (Cut-off) for diagnosis. P < 0.05 was considered statistically significant.

[0047] The results are as follows Figure 3 As shown in the figure, miR-24-3p AUC was 0.738, Cut-off was 2.282, diagnostic sensitivity was 64.4%, and specificity was 80%; miR-205-5p AUC was 0.738, Cut-off was 0.946, diagnostic sensitivity was 80%, and specificity was 80%; circ-ATG5 AUC was 0.930, Cut-off was 0.637, diagnostic sensitivity was 93.3%, and specificity was 89.7%. That is, when the expression of miR-24-3p in the test sample was ΔCT≤5.2129; miR-205-5p≤8.4546; circ-ATG5≤6.95931, it indicated a high risk of oral mucosal cancer.

[0048] Example 2 Verification of specific ncRNAs promoting OSCC malignant biological behavior

[0049] This example explores the effects of miR-24-3p and circ-ATG5 on the biological behavior of OSCC cells, as follows:

[0050] (1) OSCC cells were co-cultured with exosomes from miR-24-3p stably transfected cell lines and verified by conventional CCK-8 assay. Figure 4 As shown in A. Under the stimulation of exosomes derived from OSCC cells overexpressing miR-24-3p, the viability of recipient cells was improved, while exosomes derived from OSCC cells that inhibited miR-24-3p expression by sponge adsorption showed the opposite effect, indicating that OSCC cells overexpressing miR-24-3p in the tumor microenvironment may further secrete exosomes rich in miR-24-3p, and exosomal miR-24-3p exerts its function of promoting cell proliferation, thereby generating a "tumor-friendly" microenvironment that promotes tumor development.

[0051] The expression of miR-24-3p in OSCC cell lines was upregulated by transient transfection of miR-24-3p mimic and verified by conventional CCK8 and plate clone formation assays. Figure 4 B and Figure 4 C, Overexpression of miR-24-3p significantly increased the growth rate and clone-forming ability of OSCC cells.

[0052] (2) circ-ATG5 was knocked down in OSCC cell lines and verified by conventional CCK8 assay and transwell assay. The results are as follows Figure 5 As shown. After knocking down circ-ATG5, the migration and invasion abilities of OSCC cell lines were also inhibited, indicating that circ-ATG5 has the ability to promote tumor cell proliferation, migration, and invasion in OSCC cells.

[0053] Finally, it should be noted that the above embodiments are only used to illustrate the technical solution of the present invention rather than to limit the scope of protection of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solution of the present invention can be modified or replaced by equivalents without departing from the essence and scope of the technical solution of the present invention.

Claims

1. Use of a reagent for detecting non-coding RNA in a sample in the preparation of a kit for predicting potential malignant diseases and canceration of oral mucosa, characterized in that: The non-coding RNA is circ-ATG5, and the canceration is a potential malignant disease of the oral mucosa that develops into oral squamous cell carcinoma; The nucleotide sequence of circ-ATG5 is: ACTGTCCATCTAAGGATGCAATTGAAGCTCATTTTATGTCATGTATGAAAGAAGCTGATGCTTTAAAACATAAAAGTCAAGTAATCAATGAAATGCAGAAAAAAGATCACAAGCAACTCTGGATGGGATTGCAAAATGACAGATTTGACCAGTTTTGGGCCATCAATCGGAAACTCATGGAATATCCTGCAGAAGAAAATGGATTTCGTTATATCCCCTTTAGAA TATATCA[GT]TGCTTTTTGCCAAGAGTAAGTTATTTGACGTTGGTAACTGACAAAGTGAAAAAAGCACTTTCAGAAGGTTATGAGACAAGAAGACATTAGTGAGATATGGTTTGAATATGAAGGCACACCACTGAAATGGCATTATCCAATTGGTTTGCTATTTGATCTTCTTGCATCAAGTTCAGCTCTTCCTTGGAACATCACAGTACATTTTTAAGAGTTTTCCAGAAAAAGACCTTCTGC.

2. The use according to claim 1, characterized in that: The sample is saliva.

3. The use according to claim 1, characterized in that: The reagents include reagents for detecting the expression level of non-coding RNA in a sample by sequencing technology and qRT-PCR quantitative detection technology.

4. The use according to claim 1, characterized in that: The kit comprises an RNA reverse transcription reaction solution, a quantitative PCR reaction solution, a standardized quantitative Cel-miR-39 external reference primer and a GAPDH internal reference primer.

5. The use according to claim 4, characterized in that: The RNA reverse transcription reaction solution includes the following components: 5× PrimeScript Buffer, PrimeScript RT Enzyme Mix I, Primer Mix, and RNase Free dH2O; the quantitative PCR reaction solution includes the following components: SYBR Green I Master, PCR Forward Primer, Reverse Primer, cDNA solution, and RNase Free ddH2O.

Images