Biocontrol bacteria and biocontrol bacterial agent for preventing and treating botrytis cinerea and application thereof

By using the fermentation supernatant of Bacillus atrophicus strain HLTL04 to inhibit tomato gray mold, the problems of environmental hazards from chemical control and high costs of physical control were solved, achieving effective control of tomato gray mold and promoting plant growth.

CN117925437BActive Publication Date: 2026-02-13CHENGDU UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311405307.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-10-26
Publication Date
2026-02-13
Estimated Expiration
2043-10-26

AI Technical Summary

Technical Problem

Existing technologies for controlling tomato gray mold include chemical control, which can harm the environment and human health; physical control, which is costly; and biological control, which is difficult to effectively control the rapid spread and infection of the disease.

Method used

Bacillus atrophaeus HLTL04 strain was used as a biocontrol bacterium to inhibit the growth of tomato gray mold through fermentation supernatant and to colonize tomato plants. It has nitrogen-fixing and potassium-solubilizing effects and promotes plant growth.

Benefits of technology

It effectively inhibits the growth of gray mold on tomatoes, reduces rot, improves plant growth quality and yield, and is environmentally friendly and safe, reducing the risks associated with the use of chemical agents.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN117925437B_ABST
    Figure CN117925437B_ABST
Patent Text Reader

Abstract

The present application relates to the field of microbial technology, a kind of biocontrol agent for preventing and treating tomato botrytis, biocontrol agent and its application.The biocontrol agent is Bacillus atrophaeus HLTL04 strain, preserved in China General Microbiological Culture Collection Center on June 20, 2023, and the preservation number is CGMCC NO.27658.The biocontrol agent of the present application has a strong inhibitory effect on tomato botrytis, and the HLTL04 strain can effectively inhibit the development of tomato rot caused by botrytis.The HLTL04 has a good growth-promoting effect on tomato plants.The HLTL04 strain can successfully colonize in tomato fruits.The Rif-resistant HLTL04 can colonize in tomato stems, leaves and roots, and shows a dynamic change trend of more at first and less later, gradually decreasing.The colonization amount in tomato rhizosphere soil gradually decreases, and the colonization amount in each part is different, with relatively large increase in roots compared to stems and leaves, indicating that HLTL04 can colonize and parasitize in tomato roots, stems and leaves for a long time, and the root surface of tomato plants is more suitable for its growth and reproduction than other parts.
Need to check novelty before this filing date? Find Prior Art

Description

TECHNICAL FIELD

[0001] The present application relates to the field of microbiological technology, and particularly relates to a biocontrol agent for preventing and treating tomato botrytis, a biocontrol agent and application thereof. BACKGROUND

[0002] At present, the control method of botrytis is mainly chemical control, and large-scale spraying of pesticides will have adverse effects on the ecological environment, human health and food safety. Continuous use of chemical agents will cause the generation of drug-resistant strains. The cycle of botrytis infection is divided into three stages: germination, infection and colonization. In the early stage, the pathogen infects the host and reproduces, and then the pathogen will be latent for a period of time. Once the environment is suitable, it will cause the plant to be diseased and rotten, and cause serious diseases in the plant during the period after harvest or long-distance transportation. Through the investigation of botrytis, it is found that the disease is an air-borne disease, and its transmission speed is very fast. Its infection mode is various, and due to the complexity of the infection route, the disease is difficult to control effectively.

[0003] At present, the control method of botrytis is mainly chemical control, and large-scale spraying of pesticides will have adverse effects on the ecological environment, human health and food safety. Continuous use of chemical agents will cause the generation of drug-resistant strains. The cycle of botrytis infection is divided into three stages: germination, infection and colonization. In the early stage, the pathogen infects the host and reproduces, and then the pathogen will be latent for a period of time. Once the environment is suitable, it will cause the plant to be diseased and rotten, and cause serious diseases in the plant during the period after harvest or long-distance transportation. Through the investigation of botrytis, it is found that the disease is an air-borne disease, and its transmission speed is very fast. Its infection mode is various, and due to the complexity of the infection route, the disease is difficult to control effectively.

[0004] Tomato gray mold disease is caused by Botrytis cinerea, which is one of the world's diseases, and mainly infects the leaves, fruits and flowers of plants. When the leaves are infected, most of the diseased leaves start from the leaf tip, the color is light brown, gradually red-brown, the leaves are dry, and a large amount of gray mold layer appears; after the flower part is infected, the petals and leaves will rot, form a light gray mold, and cause the petals to fall off; when the fruit is infected, it starts from the flower organ and then spreads to the fruit stalk, and becomes light gray brown, and a gray mold layer appears, in a specific case, the diseased fruit will not fall off, and after water shortage, it will be in a hard state. After the stem is infected, small spots appear at first, and then become round spots, and in a humid environment, a layer of gray mold appears, and the infected part will wither and rot. At present, tomato gray mold is the main reason for causing tomato rot and quality decline. Gray mold is a low-temperature and high-humidity disease, and most of them are attached to the surface of plants in the form of mycelium and conidia. In suitable conditions, the germination of pathogen sclerotia will first produce mycelium and conidia, and factors such as air flow, human operation and the like will make the conidia begin to infect and invade the fruits, stems, flowers and leaves of the plants. The optimum temperature for the pathogen to occur is 15-22℃, and the most susceptible period of tomato includes the growth period, fruit period and mature period.

[0005] With the continuous expansion of the planting area and the annual production scale of tomatoes, tomatoes are more and more widely used in the world, but after harvesting, tomatoes are prone to rot, which seriously affects the storage quality of tomatoes and the economic development of the whole industry. The pericarp of tomato is very thin, the flesh is tender, and it is rich in nutrients, so when it grows, matures, is picked, transported, packaged and sold, it is easy to produce wounds and injuries due to its own physiology or human mechanical factors, which provides a very good invasion site and suitable nutritional conditions for the gray mold fungus to invade and expand, and then cause the fruit to rot; gray mold usually causes about 30% of the yield of tomatoes to decrease, and at most can reach 75%, so it is necessary to prevent and control the disease after the tomatoes are harvested. In recent years, Bacillus has been reported as a biocontrol agent for preventing and controlling crop fungal diseases, and the natural strains screened in nature have no pollution residues, which is a new environmentally friendly biological control method. SUMMARY

[0006] Therefore, the purpose of the present application is to provide a biocontrol agent for preventing and controlling tomato gray mold, a biocontrol agent and its application. The biocontrol agent can effectively inhibit the growth of tomato gray mold, and the biocontrol agent of the present application is used for preventing and controlling tomato gray mold, which is environmentally friendly, safe and efficient.

[0007] The present application solves the above technical problems by the following technical means:

[0008] The application provides a biocontrol agent for preventing and treating Botrytis cinerea, and the biocontrol agent is a Bacillus atrophaeus HLTL04 strain, which is preserved in the China General Microbiological Culture Collection Center on June 20, 2023, and the preservation number is CGMCC NO. 27658.

[0009] Further, the nucleotide sequence of the 16S rDNA of the biocontrol agent is shown in SEQ ID NO. 3.

[0010] The application also provides application of the biocontrol agent in inhibition of growth of Botrytis cinerea.

[0011] The application also provides a biocontrol agent with the biocontrol agent as a main effective component.

[0012] The application also provides application of the biocontrol agent in inhibition of growth of Botrytis cinerea.

[0013] The application screens the HLTL04 strain with a strong inhibitory effect on Botrytis cinerea from soil in Nima Jiangre Township (29°9'98.92"N, 91°8'90.29"E, 3848 m above sea level) in Lhasa City, Tibet Autonomous Region, and test proves that the HLTL04 strain, fermentation supernatant and produced volatile substances all have obvious inhibitory effects on the growth of Botrytis cinerea.

[0014] Test proves that the HLTL04 strain can effectively inhibit the development of tomato rot caused by Botrytis cinerea; the HLTL04 strain has the functions of nitrogen fixation and potassium solubilization, and has a significant growth promoting effect; the HLTL04 strain has a good growth promoting effect on tomato plants; the HLTL04 strain can successfully colonize in tomato fruits; the Rif-resistant HLTL04 can colonize in tomato stems, leaves and roots, and shows a dynamic change trend of more at first and less later, and the colonization amount in the soil around the tomato roots gradually decreases, and the colonization amounts in each part are different, and the increase in the roots is larger than that in the stems and leaves, indicating that the HLTL04 can colonize and parasitize in the tomato roots, stems and leaves for a long time, and the root surface of the tomato plant is more suitable for its growth and reproduction than other parts. BRIEF DESCRIPTION OF DRAWINGS

[0015] Figure 1 It is an effect picture of the inhibitory effect of the HLTL04 on Botrytis cinerea.

[0016] Figure 2 It is a picture of the morphological characteristics of the HLTL04 strain under a microscope.

[0017] Figure 3 It is a phylogenetic tree of the 16S rDNA sequence of the HLTL04 strain.

[0018] Figure 4 Growth curve of HLTL04 strain;

[0019] Figure 5 Inhibition effect diagram of Botrytis cinerea at different times;

[0020] Figure 6 Inhibition effect diagram of Botrytis cinerea of HLTL04 at different concentrations;

[0021] Figure 7 Influence diagram of fermentation broth of HLTL04 on mycelial growth of Botrytis cinerea;

[0022] Figure 8 Inhibition effect diagram of HLTL04 on different pathogenic fungi;

[0023] Figure 9 Prevention effect diagram of HLTL04 on Botrytis cinerea of tomato fruit in vitro;

[0024] Figure 10 Colonization density diagram of HLTL04 in tomato fruit;

[0025] Figure 11 Colonization dynamic diagram of HLTL04 in tomato root, stem, leaf and rhizosphere soil. DETAILED DESCRIPTION

[0026] The technical solutions in the embodiments of the present application will be clearly and completely described below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative work fall within the scope of protection of the present application.

[0027] In the following examples, the specific conditions not specified are carried out according to the conventional conditions or the conditions suggested by the manufacturer. The raw materials, equipment or instruments used, if not specified by the manufacturer, are all conventional products that can be obtained by purchase in the market.

[0028] The culture medium used in the following embodiments of the present application is as follows:

[0029] PDA culture medium: potato 20 g, glucose 2 g, agar 1.5 g, distilled water 100 mL, pH 7.0;

[0030] LB culture medium: yeast extract 5 g, tryptone 10 g, NaCl 10 g, agar 15 g, distilled water to 1000 mL, pH 7.0;

[0031] Ashby medium: Ashby nitrogen-free solid medium: 0.1 g CaSO4; 0.2 g KH2PO4; 0.2 g NaCI; 5.0 g CaCO3;

[0032] Sodium hypochlorite solution: dilute sodium hypochlorite with water to a concentration of 0.9% of active chlorine, and the solution is stable;

[0033] 10% urea: weigh 10 g of urea and dissolve in 100 mL of water;

[0034] 0.3% hydrogen peroxide solution: dilute 30% hydrogen peroxide with water by 100 times, and the accurate concentration of this solution needs to be calibrated with standard potassium permanganate solution;

[0035] Potassium solution: sucrose 5.0 g, MgSO4 0.5 g, CaCO3 1.0 g, Na2HPO4 2.0 g, FeCI3 0.05 g, potassium feldspar powder 1.0 g, agar powder 15 g, distilled water 1000 mL, pH 7.0;

[0036] Skim milk powder medium: 3.0 g of skim milk powder, 200 mL of distilled water; 1.5 g of agar, pH 7.0-7.2; high-pressure steam sterilization at 108℃ for 15 min;

[0037] Tricalcium phosphate inorganic phosphorus medium: NaCI 0.3 g, MgSO4·7H2O 0.3 g, MnSO4·4H2O 0.03 g, KCI 0.3 g, (NH4)2SO4 0.5 g, Fe SO4·7H2O 0.03 g, Ca3(PO4)2 10.0 g, glucose 10.0 g, agar 15.0 g, distilled water 1000 mL, pH 7.0;

[0038] Mungina organic phosphorus medium: NaCI 0.3 g, MgSO4·7H2O 0.3 g, MnSO4·4H2O 0.03 g, KCI 0.3 g, (NH4)2SO4 0.5 g, FeSO4·7H2O 0.03 g, CaCO3 5.0 g, glucose 10.0 g, agar 15.0 g, lecithin 0.2 g, distilled water 1000 mL, pH 7.0;

[0039] Gelatin medium: gelatin 130 g, 1000 mL, pH 7.0, aliquot test tubes to one-half of the test tube;

[0040] Hydrogen sulfide medium: proteose peptone 10 g, ferric citrate 0.5 g, agar 20 g, distilled water 1000 mL, pH 7.2;

[0041] Methyl red medium: peptone 5 g, glucose 5 g, NaCl 5 g, distilled water 1000 mL, pH 7.2;

[0042] V-P medium: peptone 5 g, glucose 5 g, NaCl 5 g, distilled water 1000 mL, pH 7.2;

[0043] Starch hydrolysis medium: soluble starch 10.0 g, MgCO3 1.0 g, K2HPO4 0.3 g, KNO3 1.0 g, NaCl 0.5 g, agar 20.0 g, water 1000 mL, pH 7.0;

[0044] Carbon source utilization medium: KH2PO4 0.05 g, KNO3 0.1 g, FeSO4·7H2O 0.001 g, NaCl 0.05 g, MgSO4·H2O 0.05 g, agar 15 g, water 1000 mL, pH 7.0. Sugar alcohol 1%, other carbon sources 0.1%.

[0045] Nitrogen source utilization medium: glucose 1.0 g, FeSO4·7H2O 0.001 g, KH2PO4 0.05 g, NaCl 0.05 g, MgSO4·H2O 0.05 g, agar 15 g, water 1000 mL, pH 7.0, different nitrogen sources 0.1%.

[0046] Example 1

[0047] This example provides the isolation, screening and identification of the biocontrol strain HLTL04 for preventing and treating tomato gray mold,

[0048] I. The specific steps for isolating and screening the biocontrol strain HLTL04 are as follows:

[0049] Soil was collected in Nima Jiangre Township, Maizhokunggar County, Lhasa City, Tibet Autonomous Region (29°9'98.92"N, 91°8'90.29"E, altitude 3848 m), and the collected soil sample was added to sterile water. The soil suspension was oscillated on a constant temperature shaker at 28°C for 30 min (200 r / min), and the obtained soil suspension was water-bathed at 80°C for 20 min. The supernatant was diluted to 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 , 10 -6 Gradient dilution was performed, and 10 μL of the diluted solution was spread on LB medium (repeated 3 times). After incubation at 37°C for 24 h, single colonies with different growth potentials were picked for further purification, and stored at -80°C for standby use.

[0050] Seven-day-old tomato gray mold mycelium blocks were inoculated into the center of a new PDA plate. Mycelium cakes were punched using a 4mm punch and transferred to the center of the PDA plate. The biocontrol bacteria to be tested were inoculated at equal distances of 3cm on both sides. A thin line of approximately 3cm was drawn on the surface of each plate. A control group inoculated only with pathogenic fungal mycelium cakes served as the control. Each treatment was repeated three times, and the plates were incubated at 28℃ for 7 days. The presence and diameter of inhibition zones were observed and recorded. The inhibition rate was calculated using the following formula to screen for strains with good antibacterial activity. The re-screening method was the same. The formula for calculating the inhibition rate is as follows:

[0051]

[0052] Thirty-two biocontrol bacteria were isolated from the collected soil samples. Eighteen biocontrol bacteria with obvious inhibition zones were preliminarily screened out. The results of their confrontation culture with Botrytis cinerea are shown in Table 1.

[0053] Table 1: Analysis of the antifungal effects of 18 biocontrol strains against Botrytis cinerea (gray mold) of tomato.

[0054]

[0055] It should be noted that the data in Table 1 are mean ± standard deviation, and different lowercase letters after the data in the same column indicate significant differences between treatments (P<0.05).

[0056] Through secondary screening, the following results were obtained: Figure 1 The graph shown illustrates the inhibitory effect of HLTL04 on Botrytis cinerea. Figure 1 In the diagram, A represents the control, and B represents the HLTL04 bacterial strain. Figure 1 The information shown indicates that the fermentation filtrate of HLTL04 has a good inhibitory effect on the growth of Botrytis cinerea. In the control group, the mycelium grew vigorously and covered the entire plate, while on the plate inoculated with HLTL04, the growth of Botrytis cinerea mycelium was significantly inhibited. The Botrytis cinerea mycelium was thin, twisted and deformed, and the mycelial branching increased significantly while the length was shortened.

[0057] Therefore, through extensive screening, this invention has obtained a strain HLTL04 that can effectively control tomato gray mold. It can effectively inhibit the growth of tomato gray mold pathogen and has broad application prospects. It can be used to prepare biocontrol agents for the prevention and control of tomato gray mold.

[0058] II. The morphological and molecular biological identification of the biocontrol strain HLTL04 is as follows:

[0059] (1) Morphological observation and identification

[0060] The HLTL04 strain, which has good antibacterial activity, was inoculated onto LB plates and cultured at 37°C for 24 hours. The morphology and size of the colonies were observed, and Gram staining was performed.

[0061] The specific sample preparation steps for Gram staining are as follows:

[0062] (1) Smear, dry, and fix the atrophied Bacillus sp. and Paenibacillus macerans cultured for about 24 hours.

[0063] (2) Stain with ammonium oxalate crystal violet for about 1 minute, and then rinse with distilled water.

[0064] (3) Add iodine solution dropwise until the smear is covered, and then restain for about 1 minute, rinse with distilled water, and absorb the excess water with a blotting paper.

[0065] (4) Slowly decolorize with 95% alcohol, rinse with water after 50 seconds, and absorb the excess water with a blotting paper.

[0066] (5) Finally, stain with diluted carbol fuchsin for 1-2 minutes, slowly rinse with sterile water, absorb the excess water with a blotting paper, and dry.

[0067] (6) Observe under a microscope. The morphological characteristics of the strain HLTL04 under a microscope are shown in Figure 2 , Figure 2 wherein the blue-purple color is a positive bacterium, and the red color is a negative bacterium.

[0068] As can be seen from Figure 2 , the strain HLTL04 grows on an LB plate, the colony surface is wrinkled, the central part is convex, the edge is jagged, it is opaque, has no luster, has a strong smell, is a Gram-positive bacterium, and the bacterial body is rod-shaped.

[0069] (2) Molecular biology identification

[0070] The 16S rDNA gene of the strain HLTL04 was amplified and subjected to sequence analysis, the primers were 27F (5'-AGAGTTTGATCCTGGCTCAG-3', SEQ ID NO. 1) and 1492R (5'-GGTTA CCTTGT TACGACTT-3', SEQ ID NO. 2), the PCR amplification reaction procedure was as follows: pre-denaturation at 94°C for 10 min; denaturation at 94°C for 30 s, annealing at 55°C for 30 s, extension at 72°C for 2 min, amplification cycle 31 times, and extension at 72°C for 5 min. The PCR product was detected by 1% agarose gel electrophoresis, and then was sent to Shengong Bioengineering (Shanghai) Co., Ltd. for sequencing. The sequencing result was subjected to sequence comparison in NCBI, homology analysis was performed by using MEGA7.0 software, and a phylogenetic tree was constructed, as shown in Figure 3 .

[0071] 16S sequence:

[0072]

[0073] In Figure 3 , the branch value represents the bootstrap value of the node, and the value in the parentheses represents the NCBI sequence number. By PCR amplification and sequencing of the 16S rDNA of the HLTL04 strain, homology comparison was performed in the BLAST program of NCBI, the highest homology sequence was downloaded and the phylogenetic tree was constructed using MEGA7.0. The results showed that the HLTL04 strain was clustered with Bacillus atrophaeus (JCM9070) in the same branch, with a similarity of 98.56%. Based on morphological observation, physiological and biochemical analysis, and phylogenetic tree construction, it was preliminarily determined that HLTL04 was Bacillus atrophaeus. The strain was preserved in the China General Microbiological Culture Collection Center on June 20, 2023, with the preservation number CGMCC NO.27658 and the preservation address Beijing, China.

[0074] III. Growth curve changes of HLTL04 strain

[0075] Most of the growth processes of biocontrol bacteria have certain regularity, and the growth process includes four stages of lag phase, logarithmic phase, growth phase and decline phase. The growth regularity of biocontrol bacteria was studied, which has certain guiding significance for inhibiting pathogenic bacteria under different concentrations and different culture times.

[0076] The determination method of the growth curve of HLTL04 is as follows: the seed liquid of HLTL04 is inoculated into LB medium at a ratio of 2%, and shaken at 28°C and 180r / min. Sample every 2h, count with visible spectrophotometer, and repeat the test three times. The growth curve of HLTL04 is established by taking the cell concentration of HLTL04 as the vertical coordinate and the culture time as the horizontal coordinate, and the growth regularity and change of HLTL04 are analyzed.

[0077] The OD 600 value of HLTL04 is determined every 2h, and the corresponding growth curve is drawn according to the culture time and the cell concentration of biocontrol bacteria as shown in Figure 4 . The HLTL04 strain enters the logarithmic growth phase after 8h, and the whole logarithmic phase lasts for 14h. After 22h, the growth curve tends to be relatively stable, and enters the stationary phase, and the number tends to be stable. According to the growth curve, the biocontrol bacteria fermentation liquid of HLTL04 strain between 8-22h is selected for subsequent experiments, which is in the logarithmic phase and has strong life and good vitality.

[0078] IV. Determination of the optimum temperature of HLTL04 strain

[0079] HLTL04 seed culture was inoculated into LB culture medium at a ratio of 2% and cultured in shakers at 180 r / min for 24 h at 4℃, 28℃, 30℃, 35℃, 37℃, 39℃, 45℃ and 50℃. The counts were performed using a visible spectrophotometer and the experiment was repeated 3 times.

[0080] The experiment found that strain HLTL04 could grow well at temperatures ranging from 30-45℃, with an optimal growth temperature of 37℃. Its OD... 600 The value was 0.98. When incubated at 50℃, its OD... 600 The absorbance value was the lowest, and the culture reached the stable phase earlier at 30-37℃. Moreover, there was no significant difference in absorbance values ​​among the different groups of bacterial cultures when the culture reached the stable phase. Therefore, the optimal temperature for HLTL04 culture is 37℃.

[0081] Example 2

[0082] This embodiment mainly aims to understand the inhibitory effect of HLTL04 on tomato gray mold.

[0083] (1) Inhibitory effect of HLTL04 cultured for different time on tomato botrytis cinerea

[0084] HLTL04 was cultured for 12h, 24h, 36h, 48h, 60h, and 72h. After 7 days of culture, the botrytis cinerea spores were washed with Tween 80, and 100μL of the culture was spread onto PDA plates. A well was punched in the center of each plate, and the bacterial culture of HLTL04 at each time point was collected into the well (repeated 5 times). The plates were incubated at 26℃ for 5-7 days. The presence and diameter of inhibition zones were observed and recorded. The results are shown in [Figure number missing]. Figure 5 .from Figure 5 It can be seen that the antibacterial activity of strain HLTL04 reached its maximum after 72 hours of culture.

[0085] (2) Inhibitory effect of different concentrations of HLTL04 on Botrytis cinerea

[0086] Botrytis cinerea cultured for 7 days was washed with Tween 80 spores, and 100 μL was spread onto a PDA plate. Two wells were punched at equal intervals on the plate, and HLTL04 bacterial suspensions of different concentrations (25 μL, 35 μL, 45 μL, and 55 μL) were added to the wells (repeated 3 times). The plates were incubated at 26℃ for 5-7 days, and the presence and diameter of inhibition zones were observed and recorded. The results are shown in the figure. Figure 6 .from Figure 6 It can be seen that, compared with HLTL04 bacterial solutions of different concentrations of 25μL, 35μL, 45μL, and 55μL, the inhibition diameter of HLTL04 is 0.96cm, 1.03cm, 1.21cm, and 1.43cm, respectively. As the concentration increases, the antibacterial activity of HLTL04 against Botrytis cinerea increases.

[0087] (3) Effect of HLTL04 on the mycelial growth of Botrytis cinerea

[0088] Botrytis cinerea, approximately 3 cm in size, was inoculated into 100 ml of LB liquid medium and then inoculated with HLTL04 seed culture at inoculation rates of 4%, 2%, and 1%. The cultures were incubated for 7 days in shake flasks at 26℃ and 180 rpm. A negative control was not inoculated with HLTL04. The growth changes of Botrytis cinerea mycelia were observed. The mycelia were filtered through gauze and collected, dried, and weighed. The effect of HLTL04 on the mycelial growth of Botrytis cinerea was analyzed, and the calculations were performed three times. The results are shown in Table 3.

[0089]

[0090] Table 3: Effects of fermentation broth of HLTL04 on the mycelial growth of Botrytis cinerea.

[0091]

[0092] In Table 3, the data are the mean ± standard deviation. Different lowercase letters after the data in the same column indicate significant differences between treatments (P<0.05).

[0093] The effect of HLTL04 fermentation broth on the mycelial growth of Botrytis cinerea is shown in [reference needed]. Figure 7 ,from Figure 7 As shown in Table 3, the HLTL04 culture medium had a very significant inhibitory effect on the dry weight of Botrytis cinerea. After filtering, drying and weighing the mycelium, it was found that the dry weight of the mycelium in the HLTL04 treatment group was significantly lower than that in the control group. The HLTL04 strain had a significant inhibitory effect on Botrytis cinerea mycelium, and the inhibition rates of different concentrations of fermentation filtrate on Botrytis cinerea were as high as 76.6%, 90.1% and 95.1%.

[0094] (4) Determination of the antibacterial spectrum of HLTL04

[0095] HLTL04 was subjected to plate confrontation culture with six tested pathogenic fungi (*Phyllostachys pubescens*, *Phyllostachys aurea*, *Phyllostachys nigra*, *Phyllostachys cucumeris*, *Phyllostachys bakanae*, and *Phyllostachys pubescens*) at 26℃ for 7 days. Colony diameter was measured and inhibition rate calculated according to method 3.5.1. The results are shown below. Figure 8 .

[0096] (5) Effects of HLTL04 on postharvest tomato fruit

[0097] Select tomatoes of similar color and size, with an average weight of approximately 85g. After disinfecting and washing the tomatoes, make an identical wound on each fruit using a sterilized pin, and inoculate the wound with 10μL of Botrytis cinerea spore suspension (1×10⁻⁶). 6cfu / mL); 4 hours later, the treatment group was inoculated with 15 μL HLTL04 (1×10⁻⁶ cfu / mL); 8 The fruit was then placed in a constant temperature incubator with a relative humidity of 85% and a temperature of about 25℃. The observation was repeated for 7 days and the data were recorded. The experiment was repeated three times.

[0098] DNA was extracted from tomato fruits treated with different genomic DNA kits to quantify the biomass of *Botrytis cinerea*. PCR detection was performed using... Green Pro Taq HS Premix (TAKARA, Japan) and Bio-Rad CFX system (Bio-Rad, USA) were used for the treatment. SLUBI and ITS were used as internal controls for tomato and B. cinerea backgrounds, respectively. The SLUBI primer sequences were: SLUBI-F (GCC GACTACAA CATCCAGAAGG, SEQ ID NO.4) and SLUBI-R (TGCAACACAGCGAGCTTAACC, SEQ ID NO.5), and the ITS primer sequences were: ITS-1 (TCCGTAGGTGAACCTGGGG, SEQ ID NO.6) and ITS-4 (TCCTCCGCTTATTGATATGC, SEQ ID NO.7). Each treatment was repeated 3 times, using 2 ^(-ΔΔCt) Calculation by method.

[0099] ΔΔCt=ΔCt 处理后 -ΔCt 对照 ; ΔCt=Ct 目标基因 -Ct 内参基因 ;Ct=-1 / lg(1+Ex)*lgX0+lgN / lg(1+Ex),

[0100] Where X0 is the initial template amount, Ex is the amplification efficiency, and N is the amount of amplified product when the fluorescence amplification signal reaches the threshold intensity.

[0101] See results Figure 9 ,like Figure 9 As shown, in the control group, lesions and mycelia appeared at the wound site of tomato fruits within 24 hours, and the lesions and mycelia expanded rapidly during the subsequent 120-hour storage period. In contrast, in the treatment group, the wounds infected with the HLTL04 strain only showed depressions after 24 hours, while in the treatment group, depressions appeared at the wounds after 120 hours, with trace amounts of gray mold mycelia visible. After 120 hours of culture, the lesion area at the wound site of the HLTL04 strain in the treatment group was 0.39 cm². 2 The diseased area of ​​the fruit in the control group was 0.82 cm². 2, which is 2.10 times of the diseased area of the control group. Consistently, the PCR quantitative results showed that the accumulation of B. cinerea in the control group was higher than that in the treatment group at all observation times (see Fig. 2C). The above results show that the HLTL04 strain can effectively inhibit the development of tomato rot caused by B. cinerea. Figure 9 C) The above results show that the HLTL04 strain can effectively inhibit the development of tomato rot caused by B. cinerea.

[0102] (6) Effect of HLTL04 on the germination of tomato seeds

[0103] According to the physiological and biochemical determination results in Table 2, the HLTL04 strain has the effects of nitrogen fixation and potassium solubilization, and thus has potential growth-promoting ability. Therefore, we further studied the growth-promoting ability of HLTL04.

[0104] After the uniformly filled tomato seeds were surface sterilized with 2% sodium hypochlorite for 5 min and then washed with sterile water for 3-5 times, the seeds were soaked in the HLTL04 suspension (1.0 x 10 8 cfu / mL) for 1.5 h, and then placed in a culture dish containing wet filter paper, with 18 seeds evenly placed in each dish. The seeds soaked in liquid LB for 1.5 h were used as a control, and the test was repeated 5 times. The seeds were placed in a constant temperature incubator with a relative humidity of 85% and a temperature of 25°C, and continuously observed for 8 days. The number of germinated seeds, root length, shoot length, and germination rate were counted every day, and the results are shown in Table 4.

[0105] Table 4 Effect of HLTL04 on the germination of tomato seeds and the growth of seedlings

[0106]

[0107] The data in Table 4 are mean ± standard deviation, and different lowercase letters after the same column of data indicate significant differences between treatments (P < 0.05).

[0108] As can be seen from the data in Table 4, the tomato seeds in the control group and the HLTL04 strain treatment group both started to germinate on the 3rd day, and the control group reached the maximum germination number on the 8th day. Compared with the control group, the HLTL04 strain treatment accelerated the germination speed of the seeds, and the number of germinated seeds sharply increased, reaching the maximum on the 6th day after treatment, and the germination rate of the seeds in the treatment group was significantly higher than that in the control group. In addition, the average plant height, root length, shoot length, and root-shoot ratio of the tomato seedlings were all higher than those of the control group. The above results show that the HLTL04 strain has a significant growth-promoting effect.

[0109] (7) Growth-promoting effect of HLTL04 on tomato plants

[0110] The uniformly filled tomato seeds were surface sterilized with 2% sodium hypochlorite for 5 min, then rinsed with sterile water for 3-5 times, soaked in 25°C warm water for 15 min, and then sowed in culture pots containing substrate soil. After the tomato seedlings grew to the three-leaf stage, they were transplanted into culture pots containing substrate soil, and 3 days later, HLTL04 fermentation broth (1.0 x 108cfu / mL) was used for root irrigation and spraying treatment at 15 mL per plant, with water as the control. The plant height, stem width, dry weight, fresh weight, and dry / fresh weight ratio were measured at intervals of 5 days, and the results are shown in Table 5.

[0111] Table 5 Effect of HLTL04 on tomato plant growth

[0112]

[0113] The data in Table 5 are mean ± standard deviation, and different lowercase letters after the same column of data indicate significant differences (P < 0.05) between treatments. Plant height: the distance from the root boundary to the terminal bud. Stem width: the diameter width of the stem at the root-stem boundary. Root length: the distance from the root-stem boundary to the root tip of the main root (the longest). Fresh weight: the weight of the plant after the roots were cleaned and dried with filter paper. Dry weight: the weight of the plant after water drying in an oven.

[0114] The data in Table 5 show that, compared with the control group, the HLTL04 strain in the experimental group has a growth-promoting effect on tomato plants, and the plant height of the treatment group is 5.13 cm higher than that of the control group. The average plant height, stem width, root length, dry weight, and fresh weight of the tomato plants in the treatment group are all higher than those in the control group. HLTL04 has a good growth-promoting effect on tomato plants.

[0115] (8) Colonization of HLTL04 on tomato fruits

[0116] HLTL04 was screened for rifampicin-resistant mutants. 50 μL of HLTL04 bacterial solution was inoculated into LB plate medium containing 1.0 μg / mL Rif and cultured for 5-6 days, repeated 3 times, and the mutant strains that could grow were picked and inoculated into the same concentration of culture medium. After one subculture, the Rif concentration was gradually increased (1.5, 2.5, 3.5, 5.5, 10, 20, 50, 80, 120, 170, 200 μg / mL, 300 μg / mL) to screen for drug-resistant mutant strains that stably grow in LB medium containing 300 μg / mL Rif and have the same physiological characteristics as the original strain, and were named RHLTL04, after 8-12 generations of subculture, when its stability was determined to be good, it was treated with antagonism with Botrytis cinerea to determine that the strain was the anti-Rif strain of HLTL04, and was preserved at 4°C for later use. After stable expression through screening, the strain (anti-Rif) had no significant difference in morphological characteristics and physiological and biochemical properties from the original strain.

[0117] The anti-Rif TL1 bacterial suspension (1.0 x 10 8 cfu / mL) 15 μL was inoculated at each wound of the tomato fruit; the number of strains was determined after 1 h of inoculation as the starting value, and the number of strains was determined every 12 h, for a total of 72 h. The method for determining the number of anti-Rif TL1 strains was as follows: the tomato pulp was placed in a sterile mortar, sterile water was added for grinding, and the grinding liquid was taken for gradient dilution LB plate (containing 300 μL / mL anti-Rif) culture for 24 h (37°C); the same volume of sterile water was added as a negative control at the wound of the tomato fruit, and the number of colonies was recorded; each group of treatment had 6 fruits, and the experiment was repeated 3 times. The results are shown in Figure 10 .

[0118] Figure 10 The data information table shows that, as time went on, the content of the tomato fruit R HLTL04 strain showed a significant upward trend, and the colonization density of the strain was 6.6 x 10 5 cfu / g after 12 h of treatment, and the strain showed a stable growth trend on the tomato fruit; R The colonization density of the HLTL04 strain was 66.8 x 10 5 cfu / g after 48 h. The above results show that the HLTL04 strain can successfully colonize in the tomato fruit.

[0119] (9) Determination of the colonization ability of HLTL04 in tomato roots, stems, leaves, and rhizosphere soil

[0120] The anti-Rif mutant of HLTL04 was screened as follows: 50 μL of HLTL04 bacterial liquid was inoculated into LB plate medium containing 1.0 μg / mL Rif and cultured for 5-6 d, repeated 3 times, and the mutant strains that could grow were picked and inoculated into the same concentration of culture medium; after subculture for 1 time, the Rif concentration was gradually increased (1.5, 2.5, 3.5, 5.5, 10, 20, 50, 80, 120, 170, 200 μg / mL, 300 μg / mL) to screen the drug-resistant mutant strain that stably grew in LB medium containing 300 μg / mL Rif and had the same physiological characteristics as the original strain; after 8-12 generations of subculture, when its stability was determined to be good, it was treated with antagonism with Botrytis cinerea to determine that the strain was the anti-Rif strain of HLTL04, and was preserved at 4°C for later use.

[0121] Tomato seeds were sterilized and placed in culture bottles for germination at 26°C. After germination, the seeds were transplanted into plastic pots with sterilized soil. When the plants reached the 3-4 leaf stage, the HLTL04 Rif-resistant strain was inoculated into the plants by root irrigation at 5.0 mL / plant and sprayed on the plant surface at 1.0 mL / plant. Sterile culture solution was used as a negative control, and a total of 200 plants were treated. After 1, 5, 10, 15, 20, and 25 days, 1.0 g of root, stem, leaf tissue, and rhizosphere soil (the soil closely attached to the root system) was collected.

[0122] The root, stem, and leaf tissue surfaces were cleaned with 75% alcohol, soaked in 2% sodium hypochlorite solution for 1 min, washed with sterile water 6 times, cut with scissors, and ground with 1 mL of sterile water. The rhizosphere soil (1.0 g) was dispersed in 10 mL of sterile water, shaken at 180 r / min for 20 min, and then allowed to stand. The supernatant of the above samples was gradient-diluted 10 -1 、10 -2 、10 -3 、10 -4 times, and 100 μL of each dilution was uniformly spread on LB plates containing 300 μg / mL rifampicin. This was repeated 3 times. After 48 h of incubation in a 37°C incubator, the colonies were counted and recorded. According to the average number of colonies in each treatment, the colonization in fresh leaves, roots, stems, and rhizosphere soil was determined (cfu / g). The results are shown in Figure 11 , Figure 11 The left graph in Figure 1 shows the colonization dynamics of HLTL04 in tomato roots, stems, and leaves, and the right graph shows the colonization dynamics of HLTL04 in tomato rhizosphere soil.

[0123] Figure 11 The information in Figure 1 shows that the Rif-resistant HLTL04 can colonize tomato stems, leaves, and roots, and shows a dynamic trend of more at first and less later, gradually decreasing, while the colonization in tomato rhizosphere soil gradually decreases. R After 10 days of HLTL04 application, the colonization in the roots was the largest (0.11 × 10 6 cfu / g), followed by the leaves (0.08 × 10 6 cfu / g), and the stems were the least (0.07 × 10 6 cfu / g). The colonization in the rhizosphere soil was 0.06 × 10 RThe target bacteria amount of HLTL04 was decreased at a constant rate, and after 25 days of administration, the HLTL04 marked by Rif still had a certain amount of colonization in the tomato roots, stems, leaves and rhizosphere soil. The colonization amount in each part was different, the root had a larger increase than the stem and leaf, indicating that HLTL04 could colonize and parasitize in the tomato roots, stems and leaves for a long time, and the root surface of the tomato plant was more suitable for its growth and reproduction. In addition, with the extension of inoculation time, the bacteria amount of HLTL04 in the rhizosphere soil and the plant gradually decreased, indicating that HLTL04 was easily affected by the external environment and various biological factors, and had weak competition and proliferation ability.

[0124] The above examples are only used to illustrate the technical solutions of the present application but not limit the present application. Although the present application has been described in detail with reference to the preferred embodiments, those skilled in the art should understand that the technical solutions of the present application can be modified or replaced equivalently without departing from the purpose and scope of the present application, and all should be covered in the scope of the claims of the present application. The technical, shape and structure parts not described in detail in the present application are all known technologies.

Claims

1. A biocontrol agent for controlling botrytis cinerea in tomatoes, characterized in that, The biocontrol bacteria is Bacillus atrophus (… Bacillus atrophaeus The HLTL04 strain was deposited on June 20, 2023, at the China General Microbiological Culture Collection Center (CGMCC) with accession number CGMCC NO.27658; the nucleotide sequence of the 16S rDNA of the biocontrol bacterium is shown in SEQ ID NO.

3.

2. The application of the biocontrol bacteria according to claim 1 in inhibiting the growth of Botrytis cinerea on tomatoes.

3. A biocontrol agent with the biocontrol bacteria described in claim 1 as the main active ingredient.

4. The application of the biocontrol agent as described in claim 3 in inhibiting the growth of Botrytis cinerea on tomatoes.