A strain of Lactobacillus plantarum SM1 and its application in the preparation of foods and drugs for regulating the stomach and intestines and losing weight

Abstract

The present invention belongs to the technical field of probiotics and their applications, and particularly relates to a Lactiplantibacillus plantarum SM1 and its applications in the preparation of foods and drugs for gastrointestinal conditioning and weight loss. In order to explore more Lactiplantibacillus plantarum with probiotic functions, the present invention isolated and purified a strain of Lactiplantibacillus plantarum SM1 from the fecal sample of a healthy adult in Guangdong region. This strain has excellent protease activity, excellent cellulase activity, can produce and secrete glutathione, can produce and secrete γ-aminobutyric acid, can inhibit α-glucosidase activity, can inhibit xanthine oxidase activity, can inhibit renin activity, and has various functions such as promoting the digestion and absorption of protein foods and improving protein allergy; promoting the absorption of cellulose and improving constipation, etc., and has important application value and economic value in the fields of gastrointestinal conditioning and weight loss.

Description

Technical Field

[0001] The present invention belongs to the technical field of probiotics and their applications, and particularly relates to a Lactiplantibacillus plantarum SM1 and its applications in the preparation of foods and drugs for regulating the stomach and intestines and losing weight. Background Art

[0002] Lactiplantibacillus plantarum, also known as Lactobacillus plantarum, belongs to the genus Lactobacillus of the family Lactobacillaceae, is a Gram-positive bacterium, anaerobic or facultatively anaerobic, with an optimal culture pH of 6.5. Its cells are straight or curved rods, single, sometimes in pairs or in chains. Lactiplantibacillus plantarum is a probiotic in the human gastrointestinal tract, and can produce a variety of natural antibacterial substances such as organic acids, bacteriocins, hydrogen peroxide, and diacetyl, and has various functions such as maintaining the balance of the intestinal flora, reducing cholesterol levels, enhancing the body's immunity, and promoting the absorption of nutrients.

[0003] Lactiplantibacillus plantarum is an edible lactobacillus, which is closely related to human life and is commonly found in fermented products such as dairy products, meats, and many vegetables. It can colonize the intestine through the stomach to play a beneficial role and has an important impact on intestinal microorganisms. It has a wide range of applications in fields such as food fermentation, industrial lactic acid fermentation, and healthcare. As is well known, lactobacilli are part of the normal human flora, and as an important component of the normal intestinal microbial system, they accompany the host throughout life, which is of great significance for maintaining the balance of the intestinal microecology. And Lactiplantibacillus plantarum, as an edible lactic acid bacterium, is also an important intestinal probiotic, which can help intestinal peristalsis, enhance the body's digestive ability, and improve immunity, etc. In recent years, Lactiplantibacillus plantarum, as a probiotic lactobacillus with great potential, has become a research hotspot and is constantly being made into probiotic preparations suitable for humans and animals.

[0004] Research findings indicate that different strains of Lactiplantibacillus plantarum have different probiotic functions. For example: (1) Anti-pathogenic bacteria: Some studies have found that Lactiplantibacillus plantarum has a strong inhibitory effect on Salmonella and also inhibits Helicobacter pylori. (2) Immunomodulation: Some studies have shown that Lactiplantibacillus plantarum HK-LP has a strong inductive effect on IL-12 in mice. Feeding HK-LP can inhibit the production of immunoglobulins, resist food allergies caused by natural diet in mice, and also inhibit tumor growth and the transplantation of tumor cells in mice. (3) Cadmium excretion: Some studies have shown that Lactiplantibacillus plantarum CCFM8610 has acid tolerance, has good tolerance and adsorption capacity for cadmium ions in vitro, can reduce the cadmium content in the liver and kidneys of cadmium-exposed mice, and has the effect of promoting cadmium excretion through feces in cadmium-exposed mice. (4) Inhibition of Escherichia coli: Some studies have shown that Lactiplantibacillus plantarum N13 has acid tolerance and bile salt tolerance, has a high adhesion to the intestinal epithelial cell line HT-29 cells, can inhibit the growth of enteropathogenic Escherichia coli, and prevent it from invading HT-29. (5) Proteolytic activity: Some studies have shown that Lactiplantibacillus plantarum CW006 has proteolytic activity and can ferment raw milk to produce angiotensin-converting enzyme inhibitory peptides, thereby achieving the effect of anti-hypertension.

[0005] Due to the diversity of the sources of Lactiplantibacillus plantarum, it has genetic diversity and functional diversity, manifested as different strains of Lactiplantibacillus plantarum having different probiotic functions. At present, although a small number of studies have begun to focus on the development and utilization of Lactiplantibacillus plantarum, there are still few studies on the isolation and identification, probiotic characteristics, and metabolic mechanisms of Lactiplantibacillus plantarum, which to a certain extent also affects the development and utilization of Lactiplantibacillus plantarum. Therefore, it is necessary to deeply develop its probiotic functions according to the different sources of Lactiplantibacillus plantarum, clarify its application prospects, further enrich the number of probiotic Lactiplantibacillus plantarum, and make it play a greater role in human health. In summary, the research and application of probiotic Lactiplantibacillus plantarum have relatively broad development space. Summary of the Invention

[0006] To overcome the deficiencies of the above-mentioned prior art, the present invention isolated and purified a strain of Lactiplantibacillus plantarum SM1 from the fecal sample of a healthy adult in Guangdong, China. This strain has excellent protease activity, excellent cellulase activity, can produce and secrete glutathione, can produce and secrete γ-aminobutyric acid, can inhibit α-glucosidase activity, can inhibit xanthine oxidase activity, can inhibit renin activity, and has important potential application value in the fields of gastrointestinal regulation and weight loss.

[0007] To achieve the above object, the technical solution adopted by the present invention is:

[0008] In the first aspect of the present invention, a strain of Lactiplantibacillus plantarum SM1 is provided. The Lactobacillus paracasei SM1 strain was deposited at the China Center for Type Culture Collection on September 27, 2022, with the deposit number: CCTCC NO: M 20221500; the complete 16S rDNA sequence of the Lactobacillus paracasei SM1 strain is as shown in SEQ ID No: 1.

[0009] In the second aspect of the present invention, there is provided the use of the Lactiplantibacillus plantarum SM1 strain described in the first aspect in the preparation of a renin inhibitor.

[0010] Through research, it is found that the probiotic Lactiplantibacillus plantarum SM1 strain can effectively inhibit renin activity, suggesting that the Lactiplantibacillus plantarum SM1 strain can be used as a renin inhibitor to inhibit renin activity, and thus prevent and treat hypertension as well as other cardiovascular diseases and kidney diseases.

[0011] In the third aspect of the present invention, there is provided the use of the Lactiplantibacillus plantarum SM1 strain described in the first aspect in the production of protease.

[0012] Preferably, the protease includes (but is not limited to) protease that degrades milk protein.

[0013] Through research, it is found that the probiotic Lactiplantibacillus plantarum SM1 strain can produce protease, suggesting that the Lactiplantibacillus plantarum SM1 strain is expected to be used in the production of protease, and through this property of producing protease, it can be applied to fields such as promoting the digestion and absorption of proteins in food by the human body, anti-allergy, and helping animals digest and absorb nutrients.

[0014] In the fourth aspect of the present invention, there is provided the use of the Lactiplantibacillus plantarum SM1 strain described in the first aspect in the production of cellulase.

[0015] Through research, it is found that the probiotic Lactiplantibacillus plantarum SM1 strain can produce cellulase, suggesting that the Lactiplantibacillus plantarum SM1 strain can be used in the production of cellulase, and through this property of producing cellulase, it can be used in fields such as promoting the digestion and absorption of proteins in food by the human body, improving the absorption of small peptides and amino acids, and anti-allergy.

[0016] In the fifth aspect of the present invention, there is provided the use of the Lactiplantibacillus plantarum SM1 strain described in the first aspect in the production of reduced glutathione.

[0017] It has been found through research that the probiotic Lactiplantibacillus plantarum strain SM1 can produce reduced glutathione (GSH), suggesting that Lactiplantibacillus plantarum strain SM1 can be used for the production of GSH, and can be used in the fields of antioxidant whitening, anti-aging, immune enhancement, anti-tumor, and anti-allergy through the property of producing GSH.

[0018] The sixth aspect of the present invention provides the use of the Lactiplantibacillus plantarum strain SM1 described in the first aspect in the production of γ-aminobutyric acid.

[0019] It has been found through research that the probiotic Lactiplantibacillus plantarum strain SM1 can produce γ-aminobutyric acid (GABA), suggesting that Lactiplantibacillus plantarum strain SM1 can be used for the production of GABA, and can be used in the fields of improving the sleep quality of the body, anti-depression, anti-anxiety, blood pressure reduction, and lipid metabolism improvement through the property of producing GABA.

[0020] The seventh aspect of the present invention provides the use of the Lactiplantibacillus plantarum strain SM1 described in the first aspect in the preparation of an α-glucosidase inhibitor.

[0021] It has been found through research that the probiotic Lactiplantibacillus plantarum strain SM1 can effectively inhibit the activity of α-glucosidase, and α-glucosidase is related to type 2 diabetes. Inhibiting α-glucosidase is one of the methods to control postprandial hyperglycemia, suggesting that Lactiplantibacillus plantarum strain SM1 is expected to be used in the fields of blood sugar reduction and obesity inhibition.

[0022] The eighth aspect of the present invention provides the use of the Lactiplantibacillus plantarum strain SM1 described in the first aspect in the preparation of a xanthine oxidase inhibitor.

[0023] It has been found through research that the probiotic Lactiplantibacillus plantarum strain SM1 can inhibit the activity of xanthine oxidase (XOD), suggesting that Lactiplantibacillus plantarum strain SM1 can be used to inhibit the activity of xanthine oxidase through the XOD activity, reduce purines in the body, and reduce uric acid production, thereby controlling the uric acid level and preventing gout attacks.

[0024] The ninth aspect of the present invention provides a bacterial agent with probiotic functions, and the bacterial agent includes the Lactiplantibacillus plantarum strain SM1 described in the first aspect.

[0025] Preferably, the bacterial agent is the product after fermentation of the Lactiplantibacillus plantarum strain SM1.

[0026] Preferably, the bacterial agent further comprises excipients.

[0027] More preferably, the excipients include carriers and shaping agents. The shaping agents refer to diluents, binders, lubricants, disintegrants, solubilizers, stabilizers, etc. that can be used in the pharmaceutical field, as well as some pharmaceutical matrices. The carriers are functional pharmaceutical excipients obtainable in the pharmaceutical field, including surfactants, suspending agents, emulsifiers, and some new pharmaceutical polymer materials, such as cyclodextrin, chitosan, polylactic acid (PLA), poly(lactic-co-glycolic acid) (PLGA), hyaluronic acid, etc.

[0028] Preferably, in the field of medical applications, the dosage forms of the bacterial agent include tablets, granules, capsules, dripping pills, sustained-release agents, oral liquid preparations, and injections.

[0029] More preferably, the above dosage forms refer to the dosage forms commonly used clinically. Pharmaceutical preparations can be administered orally or parenterally (e.g., intravenously, subcutaneously, intraperitoneally, or topically). If some drugs are unstable under gastric conditions, they can be prepared into enteric-coated tablets.

[0030] Compared with the prior art, the beneficial effects of the present invention are as follows:

[0031] A strain of Lactiplantibacillus plantarum SM1 was isolated and purified from the fecal sample of a healthy adult in Guangdong region, China. This strain has a variety of probiotic effects, including superior protease activity, superior cellulase activity, the ability to produce and secrete glutathione, the ability to produce and secrete γ-aminobutyric acid, the ability to inhibit α-glucosidase activity, the ability to inhibit xanthine oxidase activity, and the ability to inhibit renin activity. Therefore, Lactiplantibacillus plantarum SM1 strain can promote the digestion and absorption of protein foods and improve protein allergy; promote the absorption of cellulose and improve constipation; have antioxidant, anti-aging, anti-inflammatory and anti-allergic effects; have antidepressant, hangover and sleep-aiding effects; lower blood sugar; prevent and relieve hyperuricemia and gout; lower blood pressure and protect the kidneys. It can be seen that the newly isolated Lactiplantibacillus plantarum SM1 strain of the present invention has a variety of probiotic effects and can be used in the fields of gastrointestinal conditioning and weight loss. For example, it can be made into drugs for gastrointestinal conditioning and weight loss, which has important application value and economic value. Description of the Drawings

[0032] Figure 1 Phylogenetic tree of Lactiplantibacillus plantarum SM1 strain (Lactiplantibacillus JF1 is from the Chinese invention patent "CN116555075B", Lactiplantibacillus JF4 is from the Chinese invention patent "CN116656526B", and the other tree-building strains are all from the Genome database of NCBI);

[0033] Figure 2 Degradation experiment of Lactiplantibacillus plantarum SM1 strain on milk plate (left, blank control group; right, experimental group);

[0034] Figure 3 Degradation experiment of Lactiplantibacillus plantarum SM1 strain on cellulose plate (left, blank control group; right, experimental group);

[0035] Figure 4 Lactiplantibacillus plantarum SM1 strain can produce and secrete GSH;

[0036] Figure 5 Lactiplantibacillus plantarum SM1 strain can produce and secrete γ-aminobutyric acid;

[0037] Figure 6 The substances secreted by the fermentation broth of Lactiplantibacillus plantarum SM1 can significantly inhibit the activity of α-glucosidase;

[0038] Figure 7 Lactiplantibacillus plantarum SM1 strain can inhibit the activity of XOD;

[0039] Figure 8 The substances secreted by the fermentation broth of Lactiplantibacillus plantarum SM1 can significantly inhibit the activity of renin. Detailed implementation manners

[0040] The following further describes the detailed implementation manners of the present invention. It should be noted here that the description of these implementation manners is used to help understand the present invention, but does not constitute a limitation to the present invention. In addition, the technical features involved in the various implementation manners of the present invention described below can be combined with each other as long as they do not conflict with each other.

[0041] The experimental methods in the following examples are all conventional methods unless otherwise specified, and the test materials used in the following examples are all commercially available through conventional channels unless otherwise specified.

[0042] The experimental materials involved in the following examples are as follows:

[0043] (1) Strain: Lactiplantibacillus plantarum SM1 strain, which was isolated from the intestinal fecal sample of a healthy adult (BMI = 23.0) in Guangzhou, Guangdong, China by Runze Laboratory of Gut Microbiome Research, and stored at -80 °C in a glycerol tube under cryogenic freezing. Generally, colonies can be obtained by inoculating the strain on the surface of an MRS solid medium plate and incubating it in an anaerobic incubator at 37 °C for 24 h in an inverted position, or a fermentation broth can be obtained by shaking culture in an MRS liquid medium in an anaerobic incubator at 37 °C for 24 - 48 h.

[0044] (2) Kits: Micro glutathione (GSH) assay kit (Nanjing Jiancheng, Cat: A006 - 2 - 1), γ - aminobutyric acid (GABA) detection kit (Cloud - Clone Corp., Cat: CEA900Ge), α - glucosidase inhibitor screening kit (abcam, Cat: ab284520), xanthine oxidase activity assay kit (Sangon Biotech, Cat: AKAO006M), renin inhibitor screening kit (abnova, Cat: KA1361).

[0045] (3) MRS plate: 10 g of beef extract, 10 g of peptone, 5 g of yeast extract, 2 g of ammonium citrate, 5 g of sodium acetate, 20 g of glucose, 2 g of dipotassium hydrogen phosphate, 1 mL of Tween 80, 0.58 g of magnesium sulfate, 0.25 g of manganese sulfate, 15 g of agar, made up to 1 L with ddH2O, adjusted to pH 6.2 - 6.6, autoclaved at 121 °C for 20 min to prepare the MRS plate.

[0046] (4) MRS liquid medium: 10 g of beef extract, 10 g of peptone, 5 g of yeast extract, 2 g of ammonium citrate, 5 g of sodium acetate, 20 g of glucose, 2 g of dipotassium hydrogen phosphate, 1 mL of Tween 80, 0.58 g of magnesium sulfate, 0.25 g of manganese sulfate, made up to 1 L with ddH2O, adjusted to pH 6.2 - 6.6, autoclaved at 121 °C for 20 min to prepare the MRS liquid medium.

[0047] (5) MP plate: 10 g of skim milk powder, 1 g of sodium chloride, 10 g of beef extract, 10 g of peptone, 5 g of yeast extract, 20 g of glucose, 2 g of ammonium citrate, 5 g of sodium acetate, 2 g of dipotassium hydrogen phosphate, 0.5 mL of Tween 80, 0.58 g of magnesium sulfate, 0.25 g of manganese sulfate, 15 g of agar, made up to 1 L with ddH2O, adjusted to pH 6.2 - 6.6, autoclaved at 121 °C for 20 min to prepare the MP plate.

[0048] (6) CMC Plate: 10 g of sodium carboxymethyl cellulose, 1.5 g of ammonium sulfate, 0.3 g of manganese sulfate, 0.2 g of calcium chloride, 5 g of sodium chloride, 0.3 g of urea, 10 g of beef extract, 10 g of peptone, 5 g of yeast extract, 20 g of glucose, 2 g of ammonium citrate, 5 g of sodium acetate, 2 g of dipotassium hydrogen phosphate, 0.5 mL of Tween 80, 0.58 g of magnesium sulfate, 0.25 g of manganese sulfate, 15 g of agar, made up to 1 L with ddH2O, adjusted to pH 6.2 - 6.6, autoclaved at 121 °C for 20 min to prepare the CMC plate.

[0049] Example 1 Isolation and Identification of Lactiplantibacillus plantarum Strain SM1

[0050] The Lactiplantibacillus plantarum strain SM1 was isolated from the fecal sample of a healthy adult in the Guangdong region of China, as follows:

[0051] The fecal sample was washed repeatedly 3 times with sterile water, placed in a mortar, 500 μL of sterile water was added to every 100 mg of feces, and it was thoroughly ground into a homogenate. An appropriate amount of the ground liquid was pipetted and spread on an MRS plate, and cultured at room temperature for 3 days. Then, the colonies to be streaked and purified on the isolation experiment plate were numbered with a marker pen, and the strain numbers were marked on the plate accordingly. After marking, the colonies were picked and inoculated onto an MRS plate, and the strain was purified by the streak plate method. If the strain could not be isolated by this method, colonies needed to be picked from the enrichment plate, gradient diluted with MRS liquid medium, and then spread on the medium. Finally, referring to "Bergey's Manual of Determinative Bacteriology" (8th Edition) and "Manual of Fungal Taxonomy and Identification", the strains belonging to bacteria were first distinguished. A purified strain was initially isolated, with the strain number SM1. After culturing for 24 hours, its colonies were observed to be white, round, convex in the center, and the colony surface was fine and smooth.

[0052] Next, after molecular identification of the isolated SM1 strain using the 16S rDNA universal primers (27F: AGAGTTTGATCCTGGCTCAG, 1492R: TACGGCTACCTTGTTACGACTT), the whole genome sequencing of the SM1 strain was performed by Beijing Biomarker Technologies Corporation. The obtained 16S rDNA sequence (SEQ ID No: 1) was subjected to BLAST alignment in the Genome database of NCBI. The results showed that the homology of the SM1 strain with the known 16S rDNA sequence of Lactiplantibacillus plantarum > 99%, and phylogenetic analysis was performed with homologous strains ( Figure 1) It was confirmed that SM1 is Lactiplantibacillus plantarum of the same species but different strains.

[0053] Finally, the strain SM1 was preserved, and the preservation information is as follows: Preservation time: September 27, 2022; Name of the preservation unit: China Center for Type Culture Collection (CCTCC); Preservation number: CCTCC NO: M 20221500; Address of the preservation unit: Wuhan University, Wuhan, China; Taxonomic nomenclature: Lactiplantibacillus plantarum.

[0054] Lactiplantibacillus plantarum is a probiotic strain with a wide range of probiotic effects, such as anti-inflammatory, antihypertensive, and anti-pathogenic bacteria, etc. However, the effects of strains from different sources are different, indicating that the new Lactiplantibacillus plantarum SM1 isolated from the fecal sample of a healthy adult in the Guangdong region of the present invention can be used as a probiotic and may have new effects and functions.

[0055] Lactiplantibacillus plantarum SM1 16S rDNA sequence (1437bp, SEQ ID No: 1):

[0056]

[0057] Example 2: Functions and Applications of Lactiplantibacillus plantarum SM1 Strain

[0058] (1) Lactiplantibacillus plantarum SM1 strain can produce protease

[0059] According to the agar well diffusion test, the ability of Lactiplantibacillus plantarum SM1 to secrete protease to hydrolyze proteins was identified and measured using skim milk plate medium (MP plate). During the test, 3 μL of Lactiplantibacillus plantarum SM1 bacterial solution with a concentration of 10 Abs was added dropwise to the MP plate of the experimental group, and 3 μL of blank MRS medium was added dropwise to the control group. Then, the plates were incubated upside down in a constant temperature anaerobic incubator at 37°C for 3 days. The results showed that compared with the control group with the addition of blank medium, strain SM1 could significantly degrade proteins, forming an obvious degradation zone ( Figure 2 ), indicating that Lactiplantibacillus plantarum SM1 strain can produce protease that degrades milk proteins.

[0060] Lactiplantibacillus plantarum SM1 can produce protease. As a probiotic strain, it can promote the digestion and absorption of proteins in food by the human body and improve the absorption of small peptides and amino acids. At the same time, it can also be used for anti-allergy (improving food allergies caused by protein indigestion or non-absorption). In addition, it can also be used for the extraction of protease and applied to the production of protease in the food industry or washing industry, etc.; it can also be used in microbial feed to help animals digest and absorb nutrients and improve the utilization rate of feed.

[0061] (2) Lactiplantibacillus plantarum SM1 strain can produce cellulase

[0062] According to the agar well diffusion method, the degradation ability of Lactiplantibacillus plantarum SM1 to cellulose was identified and measured using carboxymethyl cellulose plate medium (CMC plate). During the test, 3 μL of Lactiplantibacillus plantarum SM1 bacterial solution with a concentration of 10 Abs was added dropwise to the CMC plate of the experimental group, and 3 μL of blank MRS medium was added dropwise to the control group. After incubation upside down in a constant temperature anaerobic incubator at 37°C for 3 days, Congo red staining was performed. The results showed that compared with the control group with the addition of blank medium, strain SM1 could significantly degrade cellulose, forming an obvious degradation zone ( Figure 3 ), indicating that Lactiplantibacillus plantarum SM1 strain can produce cellulase.

[0063] Since the Lactiplantibacillus plantarum SM1 strain can produce cellulase, the probiotic Lactiplantibacillus plantarum SM1 strain can play the following multiple roles through the function of producing cellulase: (1) It is used to promote the digestion and absorption of dietary components; (2) It can improve constipation. Probiotics decompose cellulose in the intestine to produce a certain amount of water, which has the effect of softening the stool; (3) Reducing cholesterol is the most important effect of cellulose. Because after soluble fiber is absorbed by the human body, it can inhibit the absorption of cholesterol by the human body, and can bind to cholesterol in the intestine, accelerating the metabolism of cholesterol in the body, preventing hyperlipidemia induced by high cholesterol in the human body, and reducing the incidence of arteriosclerosis and coronary heart disease; (4) This non-sweet "sugar" of cellulose can slow down the absorption of glucose by the blood, balance blood glucose concentration, and promote the sensitivity of muscle and fat cells to insulin, thus preventing and assisting in the treatment of diabetes.

[0064] In addition, the Lactiplantibacillus plantarum SM1 strain can also be applied to the fermentation and extraction of cellulase; it can be applied to degrade the cell wall of pathogenic fungi to control diseases; it can be applied to the decomposition of cellulose in compost; it can be applied to the preparation of livestock and poultry breeding feeds, such as single-stomach animal feeds like pigs and chickens, to overcome their defect of being unable to utilize cellulose.

[0065] (3) The Lactiplantibacillus plantarum SM1 strain can produce and secrete reduced glutathione (GSH)

[0066] The Lactiplantibacillus plantarum SM1 strain cultured in MRS liquid medium until the stationary phase was expanded and cultured in a new MRS liquid medium at a dilution ratio of 1:30. The bacterial suspension was collected 24 h after culturing to the stationary phase. After centrifugation at 10,000×g and 4 °C for 10 min, the supernatant of the fermentation broth was collected, and then the GSH concentration of the fermentation broth supernatant was measured by a reduced glutathione (GSH) assay kit (A006-2-1). The results showed that compared with the low concentration of GSH in the blank medium MRS, the GSH concentration in the fermentation supernatant of strain SM1 was 265.20 μmol / L, indicating that the GSH concentration increased significantly after fermentation by SM1 (***P<0.001), suggesting that Lactiplantibacillus plantarum SM1 can produce and secrete glutathione (GSH) during the stationary phase ( Figure 4 ).

[0067] Glutathione (GSH) is a tripeptide composed of glutamic acid, cysteine, and glycine, and contains a γ-amide bond and a sulfhydryl group, with antioxidant and integrative detoxification effects. The sulfhydryl group on cysteine is the active group of glutathione (so glutathione is often abbreviated as GSH). Glutathione helps maintain normal immune system function, and has antioxidant and integrative detoxification effects, playing an important role in a variety of cellular biochemical processes, such as free radical neutralization, detoxification, transport and storage of cysteine, maintenance of cellular redox, regeneration of ascorbic acid and vitamin E, etc. It mainly includes the following aspects:

[0068] ① Detoxification: Bind to poisons or drugs to eliminate their toxic effects;

[0069] ② Participate in redox reactions: As an important reducing agent, participate in various redox reactions in the body;

[0070] ③ Protect the activity of sulfhydryl enzymes: Maintain the active group (-SH) of sulfhydryl enzymes in a reduced state;

[0071] ④ Maintain the stability of the erythrocyte membrane structure: Eliminate the destructive effect of oxidants on the erythrocyte membrane structure.

[0072] Therefore, the multiple biological functions of GSH endow it with multiple efficacy and uses, mainly manifested in:

[0073] 1) Antioxidant: Scavenge free radicals in the human body, protect the sulfhydryl groups in many proteins and enzymes and other molecules from being oxidized by harmful substances, so as to ensure the normal exertion of the physiological functions of proteins and enzymes and other molecules; The content of glutathione in human erythrocytes is very high, which is of great significance for protecting the sulfhydryl groups of proteins on the erythrocyte membrane in a reduced state and preventing hemolysis; It can also prevent skin aging and pigmentation, reduce the formation of melanin, improve the skin's antioxidant capacity, and make the skin shiny.

[0074] 2) Clinical drug: Use its sulfhydryl group to chelate heavy metals, fluorides, mustard gas and other toxins to prevent poisoning; It can also be used as a therapeutic or adjuvant therapeutic drug in hepatitis, hemolytic diseases, and keratitis, cataract and retinal diseases, etc.; It can also correct the imbalance of acetylcholine and cholinesterase, playing an anti-allergic role.

[0075] 3) Food additive: Strengthen food nutrition, stabilize vitamin C, and enhance flavor.

[0076] To sum up, glutathione can not only be used in drugs, but also can be used as a base material for functional foods, and has broad application value in the fields of functional foods such as antioxidant and whitening, anti-aging, immune enhancement, anti-tumor and anti-allergy.

[0077] Thus, the probiotic Lactiplantibacillus plantarum strain SM1 can exert the above-mentioned multiple effects through the function of the GSH it produces.

[0078] (4) Lactiplantibacillus plantarum strain SM1 can produce and secrete γ-aminobutyric acid (GABA)

[0079] Lactiplantibacillus plantarum SM1 cultured in MRS liquid medium until the stationary phase was expanded and cultured in a new MRS liquid medium at a dilution ratio of 1:30. When cultured to the stationary phase for 24 h, the bacterial suspension was collected. After centrifugation at 10,000×g and 4 °C for 10 min, the supernatant of the fermentation broth was collected, and then the GABA concentration in the supernatant of the fermentation broth was measured by a specific GABA ELISA kit (CEA900Ge). The results showed that compared with the low concentration of GABA in the blank medium MRS, the concentration of GABA in the fermentation supernatant of strain SM1 increased significantly, and the accumulative amount was 344.44 pg / mL, indicating that Lactiplantibacillus plantarum SM1 can produce and secrete γ-aminobutyric acid Figure 5 ).

[0080] γ-aminobutyric acid is an important inhibitory neurotransmitter in the central nervous system and is widely present in animals, plants, and microorganisms. It has now been confirmed that GABA, a small molecular weight non-protein amino acid, has food safety and can be used as a food additive. Research has shown that the intake of a certain amount of GABA has physiological effects such as improving the sleep quality of the body, antidepressant, anti-anxiety, blood pressure lowering, improving lipid metabolism, enhancing memory ability and improving brain vitality, accelerating brain metabolism, strengthening the liver and kidney, promoting ethanol metabolism (alcohol detoxification), and improving menopausal syndrome.

[0081] Therefore, the probiotic Lactiplantibacillus plantarum strain SM1 can exert the above-mentioned multiple uses through the effect of producing γ-aminobutyric acid.

[0082] (5) The fermentation broth of Lactiplantibacillus plantarum strain SM1 can effectively inhibit the activity of α-glucosidase

[0083] Lactiplantibacillus plantarum SM1 cultured in MRS liquid medium until the stationary phase was expanded and cultured in a new MRS liquid medium at a dilution ratio of 1:30. When cultured to the stationary phase for 24 h, the bacterial suspension was collected. After centrifugation at 10,000×g and 4 °C for 10 min, the supernatant of the fermentation broth was collected, and then the effect of the supernatant of the fermentation broth on the enzymatic activity of α-glucosidase to hydrolyze glucose was measured by an α-glucosidase inhibitor screening kit (ab284520). The results showed that compared with the non-inhibitory effect of the blank medium MRS, the fermentation supernatant of strain SM1 significantly inhibited the ability of α-glucosidase to hydrolyze glucose, and the inhibition rate was about 35.72%, indicating that the fermentation broth of Lactiplantibacillus plantarum SM1 can effectively inhibit the activity of α-glucosidase Figure 6 )

[0084] α-Glucosidase is an enzyme that plays a role in carbohydrate decomposition and is related to type 2 diabetes. Inhibiting α-glucosidase is one of the methods to control postprandial hyperglycemia, thus contributing to the treatment of diabetes. Therefore, α-glucosidase inhibitors help maintain blood glucose levels and can improve diabetic complications. In addition, inhibiting the activity of α-glucosidase can control obesity.

[0085] It can be seen that the probiotic Lactiplantibacillus plantarum strain SM1 has the effect of inhibiting the activity of α-glucosidase, making it a potential probiotic for reducing blood sugar and inhibiting obesity.

[0086] (6) Lactiplantibacillus plantarum strain SM1 can inhibit the activity of xanthine oxidase (XOD)

[0087] The Lactiplantibacillus plantarum strain SM1 cultured in MRS liquid medium until the stationary phase was expanded in a new MRS liquid medium at a dilution ratio of 1:30. The bacterial suspension was collected 24 h after culturing to the stationary phase. After centrifugation at 10,000×g for 10 min at 4 °C, the supernatant of the fermentation broth was collected, and then the activity of xanthine oxidase in the supernatant of the fermentation broth was measured by a xanthine oxidase activity assay kit (Sangon Biotech, Cat: AKAO006M). The results showed that compared with the blank medium MRS, which had no inhibitory effect on the activity of xanthine oxidase, the fermentation supernatant of strain SM1 had a significant inhibitory effect on the activity of xanthine oxidase, with an inhibition rate of 55.82% (*P<0.05), indicating that Lactiplantibacillus plantarum SM1 can produce and secrete metabolites during the stationary phase to inhibit the activity of xanthine oxidase (XOD) ( Figure 7 ).

[0088] Xanthine oxidase is a key enzyme in the catabolism of purines and can catalyze the direct formation of uric acid from hypoxanthine and xanthine. Therefore, when the activity of xanthine oxidase in the body is abnormally active, it will lead to the generation of a large amount of uric acid, thus causing hyperuricemia or gout.

[0089] Xanthine oxidase inhibitors, such as allopurinol, can inhibit the activity of xanthine oxidase, prevent the metabolism of hypoxanthine and xanthine into uric acid, thereby reducing uric acid production and improving gout and hyperuricemia. Xanthine oxidase inhibitors can also reduce the stress response and tissue damage caused by free radicals, and are expected to be clinically used to treat gout and diseases caused by peroxide free radicals. Currently, allopurinol is one of the main drugs for the treatment of hyperuricemia and gout, and is also the only chemical drug that inhibits uric acid production in clinical practice. However, this drug has many side effects, not only causing fever, but also triggering allergic rashes, abdominal pain, diarrhea, leukopenia, thrombocytopenia and multi-organ damage, and there are even reports of deaths, so its safety is questioned. Due to its good inhibitory effect on xanthine oxidase, it has been used until now. Therefore, it is of great significance to study new xanthine oxidase inhibitors with low toxicity and high efficiency.

[0090] Therefore, the probiotic Lactiplantibacillus plantarum strain SM1 is expected to control uric acid levels and prevent gout attacks by inhibiting the activity of xanthine oxidase, reducing purines in the body, and decreasing uric acid production.

[0091] (7) The fermentation broth of Lactiplantibacillus plantarum strain SM1 can effectively inhibit renin activity

[0092] Lactiplantibacillus plantarum strain SM1 cultured to the stationary phase in MRS liquid medium was expanded to a new MRS liquid medium at a dilution ratio of 1:30. The bacterial suspension was collected at 24 h when cultured to the stationary phase, and the supernatant of the fermentation broth was collected after centrifugation at 10,000×g for 10 min at 4°C. Then, the inhibitory ability of the fermentation broth supernatant on renin was measured using a renin inhibitor screening kit (KA1361). The results showed that compared with the non-inhibitory effect of the blank medium MRS, the fermentation supernatant of strain SM1 had the ability to inhibit renin, and its inhibition rate was approximately 29.05% (**P<0.01), indicating that the fermentation broth of Lactiplantibacillus plantarum strain SM1 could effectively inhibit renin ( Figure 8 ).

[0093] Renin is an aspartic protease of approximately 40 kDa that can convert angiotensinogen into angiotensin I. Angiotensin-converting enzyme (ACE) is a monomeric zinc metalloenzyme found in vascular endothelium that can convert angiotensin I into angiotensin II, and angiotensin II is the final active messenger of the renin-angiotensin system (RAS) pathway. Angiotensin II can inhibit renin secretion by directly acting on juxtaglomerular cells. Angiotensin II has many physiological effects, the most important of which is that it can act as a powerful vasoconstrictor and increase blood pressure by altering peripheral vascular resistance. Since angiotensinogen is the only known substrate of renin, and cleavage of angiotensinogen by renin is the key to affecting the final activity of the RAS pathway, inhibiting renin would be an attractive strategy for controlling hypertension. In addition, renin inhibitors can prevent the formation of angiotensin I and angiotensins. Therefore, the renin inhibitory effect of renin inhibitors can be utilized to prevent and treat hypertension as well as other cardiovascular and kidney diseases.

[0094] It can be seen that the probiotic Lactiplantibacillus plantarum strain SM1 has the ability to inhibit renin, making it a potential probiotic for reducing blood pressure and protecting the kidneys.

[0095] In summary, the newly isolated Lactiplantibacillus plantarum strain SM1 of the present invention has multiple probiotic effects: (1) it has superior protease activity; (2) it has superior cellulase activity; (3) it can produce and secrete glutathione; (4) it can produce and secrete γ-aminobutyric acid; (5) it can inhibit α-glucosidase activity; (6) it can inhibit xanthine oxidase activity; (7) it can inhibit renin activity. It can be seen that the newly isolated Lactiplantibacillus plantarum strain SM1 of the present invention has important application value and economic value in the fields of gastrointestinal regulation and weight loss.

[0096] The above has described the embodiments of the present invention in detail, but the present invention is not limited to the described embodiments. For those skilled in the art, without departing from the principles and spirit of the present invention, various changes, modifications, substitutions, and variations made to these embodiments still fall within the protection scope of the present invention.

Claims

1. Use of Lactiplantibacillus plantarum strain SM1 in the preparation of a renin inhibitor, characterized in that, The Lactiplantibacillus plantarum SM1 strain was deposited at the China Center for Type Culture Collection on September 27, 2022, with the deposit number: CCTCC NO: M 20221500; the complete 16S rDNA sequence of the Lactiplantibacillus plantarum SM1 strain is shown in SEQ ID No: 1.

Images