A bivalent subunit vaccine for porcine epidemic diarrhea virus and preparation method thereof

Abstract

The invention discloses a porcine epidemic diarrhea virus bivalent subunit vaccine and a preparation method, and belongs to the field of veterinary biological products. The invention constructs recombinant eukaryotic plasmids pPEDV-2b-S and pPEDV-2a-S containing the S gene, purifies to obtain relatively pure recombinant proteins PEDV-2a-S and pPEDV-2b-S, mixes the two and constructs a porcine epidemic diarrhea virus bivalent subunit vaccine with an adjuvant, and after immunizing pigs with the vaccine, the recombinant protein can effectively stimulate piglets and sows to produce specific antibodies, and induces a high level of neutralizing antibodies in serum and milk, and the virus load in the feces of immunized piglets / piglets is low, indicating that the porcine epidemic diarrhea virus bivalent subunit vaccine prepared by the invention has good immunogenicity to pigs, and provides a basis for the research and development of porcine epidemic diarrhea virus subunit vaccines.

Description

Technical Field

[0001] The present invention relates to the field of veterinary biological products, and in particular to a porcine epidemic diarrhea virus bivalent subunit vaccine and a preparation method thereof. Background Art

[0002] Porcine epidemic diarrhea virus (PEDV) belongs to the Alphacoronavirus genus of the Coronavirus family and is the pathogen of porcine epidemic diarrhea (PED). The disease is characterized by rapid onset, strong infectiousness, and high mortality, with acute watery diarrhea, vomiting, and dehydration as the main symptoms. PEDV G1 type was first discovered in Europe in 1970. At present, mutant PEDV has become the main pathogen causing diarrhea and high mortality in piglets, causing significant economic losses to the global pig industry.

[0003] Vaccination is currently one of the main means of preventing and controlling PED. The porcine epidemic diarrhea vaccines currently sold on the market are mainly traditional PEDV inactivated vaccines and attenuated vaccines. PEDV inactivated vaccine is a vaccine that inactivates the live PEDV virus by heating or chemical reagents and is used in conjunction with an adjuvant. Inactivated vaccines are safer and easier to industrialize. However, during the virus inactivation process, the immunogenicity of the antigen may be damaged to a certain extent. Inactivated vaccines have limitations such as short immunity duration and the need for multiple immunizations, and usually require multiple immunizations. Compared with inactivated vaccines, attenuated vaccines are more immunogenic, and usually a single immunization can produce sufficient immune protection. However, the biggest harm of attenuated vaccines is the risk of degenerating into wild-type strains, which limits the applicability of attenuated vaccines.

[0004] The spike glycoprotein (S) encoded by PEDV ORF2 is a metastable class I fusion protein, which is mainly responsible for the adsorption and membrane fusion of the virus and host cells. It includes two parts: the receptor binding fragment S1 and the membrane fusion fragment S2. S1 contains the dominant antigen COE region (499-638aa) and two B lymphocyte sites (744-755 and 756-771aa), and the extracellular region of S2 has a trypsin cleavage site. The S protein plays an important role in the interaction with the host cell receptor and the process of entering the host cell. It is also closely related to the adaptive growth of the virus in vitro and the attenuation of virulence in vivo. More importantly, the S protein is a key protein that induces neutralizing antibody response in the body, so the S protein is the preferred antigen protein for the design and development of PEDV vaccines.

[0005] The eukaryotic expression system is to transfect the vector into eukaryotic cells, and perform a series of complex processing and folding on the exogenous gene products to form proteins with biological activity. However, its expression cycle is relatively long, and the conditions required are also relatively cumbersome and harsh. Among them, the most widely used are yeast expression systems, insect expression systems, and mammalian cell expression systems. Among them, the mammalian cell expression system makes recombinant genes easy to transfect, genetically stable, and repeatable, and can also identify and remove introns. The post-translational processing and modification system of mammalian cells is more perfect, and the exogenous proteins produced are closer to natural proteins. Its activity is far better than other expression systems, with high immunogenicity, can be transformed into human-like human-derived proteins, can also be secreted into the culture medium, and the purification process is simple to operate. Therefore, the present invention uses the HEK-293F cell eukaryotic expression system to prepare a bivalent subunit vaccine for different subtypes of PEDV S genes, and evaluates the immune effect of the vaccine through pig animal experiments, providing theoretical support for the research and development of PED subunit vaccines. Summary of the invention

[0006] The purpose of the present invention is to provide a porcine epidemic diarrhea virus bivalent subunit vaccine and a preparation method to solve the problems existing in the above-mentioned prior art. The bivalent subunit vaccine has an immune protection effect in pigs and provides a basis for the research and development of PEDV subunit vaccines.

[0007] To achieve the above object, the present invention provides the following solutions:

[0008] The present invention provides a porcine epidemic diarrhea virus bivalent subunit vaccine, comprising recombinant proteins PEDV-2a-S and PEDV-2b-S, wherein the amino acid sequence of the PEDV-2a-S is shown in SEQ ID NO: 2, and the amino acid sequence of the PEDV-2b-S is shown in SEQ ID NO: 4.

[0009] Preferably, the porcine epidemic diarrhea virus bivalent subunit vaccine further comprises an adjuvant.

[0010] Preferably, the volume ratio of the mixture of PEDV-2a-S and PEDV-2b-S to the adjuvant is 1:1.

[0011] Preferably, the mixture is a mixture of equal masses of the PEDV-2a-S and PEDV-2b-S, and the final concentration of the mixture in the porcine epidemic diarrhea virus bivalent subunit vaccine is 0.3 mg / mL.

[0012] Preferably, the adjuvant comprises M103 adjuvant.

[0013] Preferably, the preparation method of PEDV-2a-S comprises the following steps:

[0014] Introducing the target gene sequence into the expression vector to construct a recombinant expression vector;

[0015] The recombinant expression vector is transferred into eukaryotic cells for expression, and the PEDV-2a-S is obtained by protein purification;

[0016] Wherein, the nucleotide sequence of the target gene is shown as SEQ ID NO: 1.

[0017] Preferably, the preparation method of PEDV-2b-S comprises the following steps:

[0018] Introducing the target gene sequence into the expression vector to construct a recombinant expression vector;

[0019] The recombinant expression vector is transferred into eukaryotic cells for expression, and the PEDV-2b-S is obtained by protein purification;

[0020] Wherein, the nucleotide sequence of the target gene is shown as SEQ ID NO:3.

[0021] The present invention also provides a method for preparing a bivalent subunit vaccine of porcine epidemic diarrhea virus, comprising the following steps:

[0022] The recombinant proteins PEDV-2a-S and PEDV-2b-S are mixed with an equal volume of adjuvant, and then stirred and emulsified at room temperature to obtain a porcine epidemic diarrhea virus bivalent subunit vaccine; wherein the amino acid sequence of the PEDV-2a-S is shown in SEQ ID NO: 2, and the amino acid sequence of the PEDV-2b-S is shown in SEQ ID NO: 4.

[0023] Preferably, after the recombinant proteins PEDV-2a-S and PEDV-2b-S are mixed in equal masses, the final concentration of the mixture in the porcine epidemic diarrhea virus bivalent subunit vaccine is 0.3 mg / mL.

[0024] The present invention also provides the use of recombinant proteins PEDV-2a-S and PEDV-2b-S in the preparation of a bivalent subunit vaccine of porcine epidemic diarrhea virus, wherein the amino acid sequence of PEDV-2a-S is shown in SEQ ID NO: 2, and the amino acid sequence of PEDV-2b-S is shown in SEQ ID NO: 4. In the preparation of a bivalent subunit vaccine of porcine epidemic diarrhea virus, the recombinant proteins PEDV-2a-S and PEDV-2b-S may be included but are not limited to, and may also be encoding genes of PEDV-2a-S and PEDV-2b-S, or expression vectors or host cells containing encoding genes of PEDV-2a-S and PEDV-2b-S.

[0025] The present invention discloses the following technical effects:

[0026] The present invention proves through experiments that recombinant eukaryotic plasmids can specifically express PEDV G2a-S and G2b-S proteins, and can obtain relatively pure proteins; by mixing PEDV G2a-S and G2b-S proteins and constructing a bivalent subunit vaccine with an adjuvant, after immunizing piglets and sows with the vaccine, the recombinant protein can effectively stimulate piglets and sows to produce specific antibodies, and induce higher neutralizing antibody levels in serum and milk. Compared with the control group, the intestinal tissue lesions of the immunized piglets / piglets were significantly less, and only one or no piglets had mild diarrhea; however, in the challenge control group, all piglets / piglets had mild to watery diarrhea, and the viral load in the piglet feces was significantly increased, and the viral load in the feces of the piglets / piglets in the bivalent subunit vaccine immunization group was lower. The present invention clarifies the immune protection effect of the PEDV G2a-S / G2b-S bivalent subunit vaccine on pigs, and provides a basis for the research and development of PEDV subunit vaccines. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0028] Figure 1 The expression, purification and identification results of eukaryotic expression of PEDV G2a-S and PEDV G2b-S proteins; A is the plasmid map of pPEDV-2a-S and pPEDV-2b-S; B is the Western blot analysis result of the expression of PEDV-2b-S and PEDV-2a-S proteins; C is the indirect immunofluorescence analysis of the expression of PEDV-2b-S and PEDV-2a-S proteins; D is the Western blot analysis result of the purified PEDV-2b-S and PEDV-2a-S proteins; E is the SDS-PAGE analysis result of the purified PEDV-2b-S and PEDV-2a-S proteins; in the figure, M is the standard DNA molecule, G2a-S is the recombinant protein G2a-S, G2b-S is the recombinant protein G2b-S, and Control is the control;

[0029] Figure 2 A is the result of active immunogenicity analysis of bivalent subunit vaccine; A is the flow chart of active immunization of bivalent subunit vaccine; B is the titer of IgG antibody in serum sample detected by indirect ELISA method; C is the result of neutralizing antibody titer detection of serum sample;

[0030] Figure 3A is the diarrhea scoring result of 27-day-old piglets; A is the diarrhea scoring result of 27-day-old piglets infected with G2a (HK2021); B is the diarrhea scoring result of 27-day-old piglets infected with G2b (AH2012);

[0031] Figure 4 The following are the results of viral load test of 27-day-old piglets; A is the viral load of anal swab of 27-day-old piglets infected with G2a virus; B is the viral load of anal swab of 27-day-old piglets infected with G2b virus; C is the viral load of jejunum and ileum after G2a and G2b virus attack respectively;

[0032] Figure 5 To verify the protective effect of PEDV G2a-S / G2b-S bivalent subunit vaccine inoculated in 5-day-old piglets; a is the oral administration of DMEM in piglets in the PBS group; bc are the bivalent subunit vaccine immunization group and the PBS control group attacked with PEDV HK2021; d and e are the bivalent subunit vaccine immunization group and the PBS control group attacked with PEDV AH2012; f is the gross pathology of piglets in the PBS control group; g and i are the gross pathology of piglets in the bivalent subunit vaccine immunization group; h and j are the gross pathology of piglets in the attack control group;

[0033] Figure 6 To verify the protective effect of PEDV G2a-S / G2b-S bivalent subunit vaccine in 5-day-old piglets; ae are the HE staining results of piglet ileum, where a is the PBS control group; b and d are the bivalent subunit vaccine immunization groups; c and e are the challenge control groups; fj are the immunofluorescence results of piglet ileum, where f is the PBS control group; g and i are the bivalent subunit vaccine immunization groups; h and j are the challenge control groups;

[0034] Figure 7 A is the result of the passive immunogenicity analysis of the bivalent subunit vaccine; A is the flow chart of the passive immunization of the bivalent subunit vaccine; B is the titer of IgG antibodies in serum samples detected by indirect ELISA; C is the titer of IgA antibodies in serum and colostrum samples detected by indirect ELISA; D is the titer of neutralizing antibodies in serum and colostrum samples;

[0035] Figure 8 A is the diarrhea scoring result of 5-day-old piglets; A is the diarrhea scoring result of 5-day-old piglets infected with G2a (HK2021); B is the diarrhea scoring result of 5-day-old piglets infected with G2b (AH2012);

[0036] Fig. 9 The following are the results of viral load test of 5-day-old piglets; A is the viral load of anal swab of 5-day-old piglets infected with G2a virus; B is the viral load of anal swab of 5-day-old piglets infected with G2b virus; C is the viral load of jejunum and ileum after G2a and G2b virus attack respectively;

[0037] Fig.10 The protective effect of PEDV G2a-S / G2b-S bivalent subunit vaccine on sows aged one month before delivery; a is the oral administration of DMEM to piglets in the PBS group; bc are the bivalent subunit vaccine immunization group and the PBS control group attacked with PEDV HK2021, respectively; d and e are the bivalent subunit vaccine immunization group and the PBS control group attacked with PEDV AH2012, respectively; fj are the gross pathological results of piglets, among which f is the PBS control group, g and i are the bivalent subunit vaccine immunization group; h and j are the virus-challenged control group;

[0038] Fig.11 is the protective effect of PEDV G2a-S / G2b-S bivalent subunit vaccine inoculation on one-month-old sows during parturition; ae are the HE staining results of piglet ileum, where a is the PBS control group, b and d are the bivalent subunit vaccine immunization groups, and c and e are the challenge control groups; fj are the immunofluorescence results of piglet ileum, where f is the PBS control group, g and i are the bivalent subunit vaccine immunization groups, and h and j are the challenge control groups. DETAILED DESCRIPTION

[0039] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0040] It should be understood that the terms described in the present invention are only for describing a particular embodiment and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. The intermediate value in any stated value or stated range, and each smaller range between any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0041] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0042] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present invention description and examples are exemplary only.

[0043] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0044] The main experimental materials, kits and instruments involved in the following examples are:

[0045] (1) Cells, plasmids and strains

[0046] The eukaryotic expression vector, suspension-acclimated HEK-293F cells, Vero cells, AH2012 strain and HK2021 strain were all maintained by our laboratory; the optimized synthesis of the S gene codon of the HK2021 strain was completed by Nanjing GenScript Biotechnology Co., Ltd.

[0047] (2) Main reagents and instruments

[0048] Tans5α competent cells were purchased from Beijing Quanshijin Biotechnology Co., Ltd.; endotoxin-free plasmid extraction kit was purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.; Opti-MEM was purchased from Gibco, USA; Sinofection Transfection Reagent and SMM 293-TII Expression Medium were both purchased from Beijing Sino biological Company; Trypan blue stain (0.4%) was purchased from Invitrogen, USA; HRP-labeled goat anti-swine IgG (IgA) was purchased from Bethyl Laboratories, USA, and TMB substrate colorimetric solution was purchased from Huzhou Yingchuang Biotechnology Co., Ltd.; cell shake flasks were purchased from Guangzhou Jet biofil Co., Ltd.; CO2-resistant horizontal shaker (CO-06U) was purchased from Jingqi Co., Ltd., USA; HisTrap HP protein purification column was purchased from Cytiva, USA; BCA protein concentration determination kit was purchased from Shanghai Biyuntian Biotechnology Co., Ltd.

[0049] Example 1

[0050] 1. Extraction of pPEDV-2b-S and pPEDV-2a-S plasmids

[0051] Based on the S gene sequence of PEDVG2a strain HK2021 (GenBank: OL762457) and the S gene sequence of G2b strain AH2012 / 12 (GenBank: KU646831), the optimized synthesis was carried out by Nanjing GenScript Biotechnology Co., Ltd. and constructed into the pcDNA3.1 vector. The gene S contains the S protein gene (aa19-1383) and the T4 phage fiber protein fold (Fd) trimerization domain fragment. The sp10 signal peptide was cloned into the synthetic plasmid by homologous recombination to construct a recombinant plasmid pPEDV-2a-S (nucleotides as shown in SEQ ID NO: 1, amino acid sequence as shown in SEQ ID NO: 2) for expressing the G2a type PEDV S trimer recombinant protein and a recombinant plasmid pPEDV-2b-S (nucleotides as shown in SEQ ID NO: 3, amino acid sequence as shown in SEQ ID NO: 4) for expressing the G2b type PEDV S trimer recombinant protein.

[0052] The pPEDV-2b-S and pPEDV-2a-S recombinant plasmids were transformed into Tans5α competent cells, and monoclonal bacteria were screened using ampicillin-resistant LB solid medium. The monoclonal bacteria were then picked and inoculated into ampicillin-resistant LB liquid medium and cultured overnight at 37°C in a shaking incubator for 14 hours. The plasmids were then extracted according to the instructions of the endotoxin-free plasmid extraction kit and stored at -20°C after the concentration was measured.

[0053] PEDV-2a-S (SEQ ID NO: 1):

[0054]

[0055] PEDV-2a-S(SEQ ID NO:2):

[0056]

[0057] PEDV-2b-S(SEQ ID NO:3):

[0058] ATGGGCTGGAGCTGGATCTTCCTGTTCCTGCTGAGCGGCACAGCTGGCGTGCTGAGCCTCCCTCAGGATGTCACTAGATGCACCGCCAATACGAACTTTAGACGGTTCTTCAGCAAATTCAACGTGCAAGCCC

[0059] CTGCTGTGGTGGTGCTGGGGGGCTACCTGCCTATCGGAGAAAACCAGGGCGTGAACTCCACCTGGTA

[0060] CTGCGCCGGCCAACACCCCACAGCCAGCGGCGTGCACGGTATCTTCCTGAGCCACATCAGAGGCGGC

[0061] CACGGCTTCGAGATCGGCATCAGCCAGGAGCCCTTCGACCCTAGCGGATACCAGCTGTACCTGCATAA

[0062] GGCCACCAATGGCAACACCAACGCCACGGCCAGACTGCGGATCTGCCAGTTTCCTAGCATCAAGACG

[0063] CTGGGCCCTGCCGCTAACAACGACGTGACCACTGGCAGAAATTGTCTGTTCAACAAAGCCATCCCCG

[0064] CCCACATGAGCGAGCACAGCGTGGTGGGAATCACCTGGGACAACGACAGAGTGACAGTCTTTAGCG

[0065] ATAAGATCTACTACTTCTACTTCAAGAACGACTGGAGCCGGGTGGCCACCAAATGCTACAACAGCGG

[0066] AGGTTGTGCCATGCAGTACGTGTACGAGCCTACCTACTACATCCTAAACGTGACATCTGCCGGCGAGG

[0067] ATGGCATAAGTTATCAGCCCTGCACCGCCAACTGCATCGGCTATGCCGCCAATGTTTTCGCCACCGAG

[0068] CCTAACGGCCATATACCTGAAGGATTCTCCTTCAACAACTGGTTCCTCCTGAGCAATGACAGCACACT

[0069] TGTACACGGCAAGGTGGTCTCTAACCAGCCTCTGCTGGTGAACTGCCTGCTGGCCATCCCTAAGATCT

[0070] ATGGCCTGGGCCAGTTCTTTTCATTCAACCAGACAATCGACGGCGTGTGCAATGGCGCCGCTGTGCAA

[0071] AGAGCCCCTGAAGCCCTGAGATTCAACATCAACGACACCAGCGTTATCCTGGCCGAGGGCTCTATCGT

[0072] GCTGCACACCGCCCTTGGAACCAACTTCAGCTTCGTGTGCAGCAACAGCAGCGACCCCCACCTGGCC

[0073] ACATTCGCCATCCCCCTGGGCGCCATCCAAGTGCCCTACTACTGTTTCCTGAAAGTTGATACATATAAC

[0074] AGCACCGTGTACAAGTTCCTGGCAGTGCTACCCCCTACAGTGCGGGAAATCGTGATCACCAAGTACG

[0075] GCGATGTCTACGTAAACGGGTTCGGCTACCTGCACCTGGGCCTGCTCGATGCCGTAACCATCAACTTC

[0076] ACCGGCCATGGTACTGACGACGACGTGAGCGGCTTCTGGACCATCGCTTCCACAAACTTCGTGGATG

[0077] CCCTGATCGAAGTGCAGGGCACCGCCATTCAGAGGATTCTCTACTGCGACGATCCTGTGTCGCAGCTG

[0078] AAGTGCAGTCAGGTTGCCTTTGACCTGGACGATGGCTTCTACCGGATCAGCAGCACCAACCTGCTGT

[0079] CTCACGAGCAGCCAACCAGCTTCGTGACCCTCCCTAGCTTCAATGATCACTCTTTTGTGAACATCACT

[0080] GTTTCTGCTGCATTCGGCGGCCACAGCGGCGCCAACCTGATTGCAAGCGACACAACCATTAATGGCTT

[0081] CTCTAGCTTCTGTGTGGACACCAGACAGTTCACAATCTCACTCTTTTACAACGTGACCAACTCCTACG

[0082] GCTACGTGTCTAAGTCCCAGGACTCTAATTGCCCCTTCACCCTACAGAGTGTGAACGACTACCTGAGC

[0083] TTTAGCAAGTTTTGCGTGTCTACCAGCCTGCTGGCCTCCGCGTGTACAATCGACCTGTTCGGATACCCC

[0084] GAGTTCGGCTCCGGCGTGAAATTCACCTCTCTGTACTTTCAGTTCACGAAGGGCGAGCTGATCACCGG

[0085] CACACCCAAGCCTCTGGAGGGAGTGACAGACGTTTCCTTCATGACCCTGGACGTGTGCACAAAGTAC

[0086] ACAATCTACGGCTTTAAGGGCGAGGGCATCATCACACTGACCAACAGCAGCTTCCTGGCCGGAGTGT

[0087] ACTACACTTCTGACAGCGGCCAGCTGCTGGCCTTCAAAAACGTGACCAGCGGGGCCGTGTATTCTGT

[0088] GACACCATGTAGCTTCAGCGAACAGGCCGCTTACGTCGATGACGACATCGTCGGCGTGATCAGCAGT

[0089] CTGTCAAGCTCCACATTCAACTCTACACGGGAGCTGCCTGGCTTTTTCTACCACAGCAATGACGGCAG

[0090] CAACTGTACCGAGCCTGTGCTGGTGTACTCTAACATCGGCGTGTGTAAAAGCGGCAGCATCGGCTACG

[0091] TTAGATCCCAGTCCGGGCAGGTCAAGATCGCCCCTACAGTGACCGGCAATATCTCCATCCCTACAAAC

[0092] TTCAGCATGAGCATTAGAACCGAATACCTGCAGCTGTACAACACACCTGTGAGCGTGGACTGCGCCA

[0093] CATACGTGTGTAATGGCAACTCTAGATGCAAGCAGCTGCTGACCCAGTATACCGCCGCCTGCAAAACC

[0094] ATCGAGTCTGCTCTGCAGCTGTCTGCCAGACTAGAAAGCGCCGAAGTGAACAGCATGCTGACCATCA

[0095] GCGAGGAAGCGCTGCAACTGGCTACCATCAGCAGCTTCAATGGCGATGGATATAACTTCACCAATGTG

[0096] CTAGGCGTGTCTGTGTACGACCACGCCAGCGGCAGGGTGGTGCAGAAAATGTCCTTTATCGAGGACC

[0097] TGCTGTTCAACAAGGTGGTGACCAATGGCCTGGGCACCGTGGACGAGGACTACAAGCGGTGCAGCA

[0098] ATGGTAGATCTGTGGCCGATCTGGTCTGTGCTCAGTACTACAGCGGAGTTATGGTGCTGCCAGGAGTA

[0099] GTGGATGCTGAGAAGCTGCACATGTATAGCGCTAGCCTGATCGGCGGCATGGTCCTGGGCGGATTTAC

[0100] AGCTGCCGCCGCCTTACCATTCTCTTACGCCGTGCAGGCCAGACTTAACTACCTGGCCCTGCAGACTG

[0101] ATGTGCTGCAGCGGAACCAGCAGCTGCTGGCTGAAAGCTTTAATTCGGCCATTGGAAACATCACCCCT

[0102] GCCTTCGAGAGTGTGAAGGAAGCTATCAGTCAAACCTCTAAAGGCCTGAACACCGTGGCCCACGCGC

[0103] TGACCAAGGTCCAGGAGGTGGTGAACTCCCAGGGCGCTGCCCTCACCCAGCTGACAGTGCAGCTCC

[0104] AACACAACTTCCAGGCCATCAGCTCTAGCATCGATGATATCTACAGCAGACTGGACATCCTGTCTGCC

[0105] GACGTGCAGGTCGACAGACTGATCACCGGCAGACTGTCCGCCCTGAACGCATTTGTGGCCCAGACCC

[0106] TGACCAAGTACACAGAAGTGCAGGCTAGCAGAAAGCTGGCCCAACAGAAGGTAAACGAGTGCGTGA

[0107] AAAGCCAATCCCAGAGATACGGCTTCTGCGGCGGCGACGGCGAACACATCTTTTCCCTGGTTCAGGC

[0108] CGCCCCCCAGGGACTGCTGTTCCTGCACACCGTGCTGGTGCCTGGAGATTTCGTGAACGTGATCGCCA

[0109] TCGCAGGGCTGTGCGTCAACGACGAGATCGCCCTGACGCTGCGAGAGCCTGGCCTGGTGCTGTTTAC

[0110] ACACGAGCTGCAGGACACCGCCACCGAGTACTTCGTGAGCTCCCGGAGAATGTACGAGCCTAGAAA

[0111] GCCTACCGTGGGCGACTTCGTGCAGATCGAGTCTTGCGTGGTTACCTACGTCAACCTGACAAGAGATC

[0112] AGCTGCCTGAGGTGATCCCCGACTACATCGACGTGAACAAGACCCTCGATGAGATTCTGGCCAGCCT

[0113] GCCCAACCGGACCGGGCCCTCTCTGAGCTTGGACGTGTTCAATGCCACATACCTGAATCTGACCGGA

[0114] GAGATCGCCGATCTGGAACAGCGCAGCGAGTCGCTCCGCAACACCACAGAAGAGCTCCAGAGCCTC

[0115] ATCTACAACATCAATAACACCCTGGTGGATCTGGAATGGCTGAACAGAGTGGGATACATCCCAGAGGC

[0116] CCCGCGGGACGGCCAGGCCTATGTGCGGAAGGACGGCGAATGGGTCCTGTTATCAACCTTTCTGCACCACCACCACCACCATCATCACTGA.

[0117] PEDV-2b-S(SEQ ID NO:4):

[0118]

[0119] 2. Expression and purification of pPEDV-2b-S and pPEDV-2a-S proteins

[0120] pPEDV-2b-S and pPEDV-2a-S were transfected into 293F cells by transient transfection. The cell density and viability were determined one day before transfection. 6 The cells were passaged at a density of 3 × 10 cells / mL and cultured overnight in a shaker at 37°C, 5% CO2, and 150 rpm. On the day of transfection, the cell density and viability were measured and the cell density was adjusted to 3 × 10 6 cells / mL, and perform plasmid transfection. Loosen the bottle mouth 24 hours after transfection to meet the dissolved oxygen and CO2 emission requirements for subsequent high-density cell growth, affecting cell growth. 48-72 hours after transfection, SDS-PAGE and Western-blot can be used to detect the expression of the target gene to determine the optimal sampling time. Collect the expression supernatant and cells of 293F-2b-S and 293F-2a-S suspension cells, and use HisTrap HP nickel column for protein separation and purification. After purification, the concentration was determined by BCA protein quantification kit, and the aliquots were stored at -80°C.

[0121] 3. Bivalent subunit vaccine immunity experiment

[0122] Equal amounts of PEDV G2a-S and G2b-S recombinant proteins were mixed with M103 adjuvant in a volume of 1:1, and emulsified at room temperature to obtain subunit vaccines. The total final concentration of the vaccine proteins after mixing equal masses was 0.3 mg / mL. Twenty 5-day-old piglets and two sows one month into farrowing were randomly divided into two groups (n=10, n=1), PEDV G2a / G2b bivalent subunit vaccine immunization group and control group (PBS group). Intramuscular inoculation was used, 5-day-old piglets in the immunization group were immunized with 2 mL, and piglets in the control group were immunized with 2 mL DMEM (see Table 1). A second immunization was performed 14 days after immunization, and blood was collected from the anterior vena cava of the piglets on days 0, 14, and 27, and the serum was separated and stored at -20°C.

[0123] The sow immunization group was inoculated with 3 mL of PEDV G2a / G2b bivalent subunit vaccine (see Table 1). All sows were immunized 30 days before farrowing and a second immunization 15 days before farrowing. Serum was collected from sows on days 0, 15, and 30 after immunization. Milk was collected 5 days after farrowing.

[0124] Table 1 PEDV G2a / G2b bivalent subunit vaccine immunization schedule

[0125]

[0126] 4. ELISA test of immune piglet / sow serum and milk

[0127] The expressed and purified PEDV-S1 antigen was coated to detect the specific S1 antibody in the serum (milk) of immune piglets / sows. The S1 antigen coating amount was 25ng / well; during the detection, the serum (milk) was diluted 100 times, the incubation time was 30min, the goat anti-pig secondary antibody in the serum was diluted 1:20,000, the goat anti-pig secondary antibody in the milk was diluted 1:80,000, the incubation time was 30min, the substrate was acted for 20min, and the absorbance value at 450nm was finally measured.

[0128] 5. Neutralizing antibody determination in serum and milk of immunized piglets / sows

[0129] The collected serum (milk) was inactivated at 56°C for 30 min. After two-fold dilutions starting from 1:2, serum (milk) was diluted with PEDV (200 TCID 50 / 0.1mL) were mixed in equal volumes and incubated at 37°C for 1 hour. Then, the mixture was inoculated onto a Vero cell monolayer in a 96-well tissue culture plate, incubated at 37°C for 2.5 hours, discarded, and washed three times with DMEM. Then, DMEM trypsin (10μg / mL) required for virus entry into cells was added to each well and incubated at 37°C for 3 to 5 days.

[0130] 6. Piglet challenge protection test

[0131] 10 days after the second vaccination of 5-day-old piglets, use 30mL × 10 6.5 TCID 50 / mL of PEDV AH2012 and 20mL×10 5.5 TCID 50 / mL of PEDV HK2021 strain were orally challenged to 27-day-old piglets. During this period, the piglet status was observed, recorded and diarrhea scores were calculated every day (0 = solid; 1 = pasty; 2 = semi-liquid; 3 = watery).

[0132] After immunizing the sows, the piglets sucked colostrum for 5 days and used 4 mL × 10 6.5 TCID 50 / mL of AH2012 and 2mL×10 5.5 TCID 50 / mL of HK2021 strain was orally challenged in 5-day-old piglets. During this period, the piglet status was observed, recorded and diarrhea scores were calculated every day (0 = solid; 1 = pasty; 2 = semi-liquid; 3 = watery).

[0133] 7. Quantitative detection of viral RNA

[0134] To further study the protective ability of the bivalent subunit vaccine against PEDV, qRT-PCR was used to detect viral RNA in fecal swabs. The qRT-PCR primers are as follows:

[0135] qPEDV-NF: 5'-GTCTGAAAAGCCAATCATTC-3';

[0136] qPEDV-NR: 5'-TTGCCTCTGTTGTTACTC-3';

[0137] PEDV-N-probe: 5'-CTGTTGTTGCCATTGCCACGA-3';

[0138] Reaction system: 2×ACQ 10μl, qPEDV-NF 0.4μl, qPEDV-NR 0.4μl, PEDV-N-probe 0.2μl, DYE 0.4μl, cDNA 2μl, ddH2O 6.6μl, total volume 20μl.

[0139] Reaction program: pre-denaturation at 95°C for 5 min, 95°C for 10 s, 60°C for 30 s, and 40 cycles.

[0140] 8. Statistical analysis

[0141] GraphPad Prism 8 software was used to analyze the test data, and the data were expressed as mean ± standard deviation. The difference was considered statistically significant when P < 0.05.

[0142] 9. Results and Analysis

[0143] 9.1 Expression and purification of PEDV-2b-S and PEDV-2a-S recombinant proteins

[0144] pPEDV-2b-S and pPEDV-2a-S (map see Figure 1 A) After 48 hours of transfection of 293T cells, protein expression was identified by Western blot and IF. The results showed that PEDV-2b-S and PEDV-2a-S proteins both had specific bands at about 180 kDa and specific fluorescence, while untransfected cells had no specific fluorescence, which was consistent with the expected results (see Figure 1 B and C).

[0145] The purified proteins were subjected to Western blot and SDS-PAGE detection. The results showed that both PEDV-2b-S and PEDV-2a-S proteins could be purified, and the SDS-PAGE detection results were consistent with the Western blot detection size (see Figure 1D and E); 2 mg G2b-S protein and 1 mg G2a-S protein can be purified from 100 mL of cells using the BCA kit.

[0146] 9.2 Results of active immunization with PEDV G2a-S / G2b-S bivalent subunit vaccine

[0147] 9.2.1 Results of the determination of active immunogenicity of PEDV G2a-S / G2b-S bivalent subunit vaccine

[0148] In order to evaluate whether the PEDV G2a-S / G2b-S bivalent subunit vaccine can induce neutralizing antibodies against PEDV G2a and PEDV G2b in piglets, the present invention uses the PEDV G2a-S / G2b-S bivalent subunit vaccine to immunize piglets (see Figure 2 The results showed that the PEDV G2a-S / G2b-S bivalent subunit vaccine induced high titers of IgG and sIgA antibodies in serum (see Figure 2 In addition, the present invention also found that the S protein induced high titer neutralizing antibodies in the blood, with the titer in the blood of immunized piglets exceeding 1:32 (see Figure 2 Middle C).

[0149] In order to evaluate the changes in S protein-specific antibodies in piglets after immunization, PEDV-S1 indirect ELISA was used to detect the antibody levels of immunized piglets. The results of indirect ELISA showed that the specific antibody levels of piglets in each group were low 2 weeks after the first immunization, with no significant difference. After the second immunization, except for the control group, the S protein-specific IgG and sIgA antibodies in other groups increased, indicating that the bivalent subunit vaccine can stimulate piglets to produce specific antibodies (see Figure 2 (B).

[0150] 9.2.2 Statistical results of clinical symptoms of 27-day-old piglets

[0151] Each 27-day-old piglet was treated with 30 mL × 10 6.5 TCID 50 / mL of PEDV AH2012 and 20mL×10 5.5 TCID 50 / mL PEDV HK2021 was used for infection, and whether the piglets had symptoms such as vomiting and diarrhea was used to determine whether the piglets were sick. The results showed that for 27-day-old piglets, one piglet in the AH2012-immunized group had moderate diarrhea at 3dpc, and all six piglets in the control group had watery diarrhea; two piglets in the HK2021-immunized group had severe diarrhea at 3dpc, and all five piglets in the control group had watery diarrhea (see Figure 3 ).

[0152] 9.2.3 Results of quantitative detection of viral RNA in anal swabs of 27-day-old piglets

[0153] To further investigate the protective ability of the bivalent subunit vaccine against PEDV, the present invention used qRT-PCR to detect viral RNA in fecal swabs and intestines. Before the challenge, no PEDV RNA was detected in any fecal swab samples collected from the PBS group or any other pigs. After the challenge, viral RNA was detected in all anal swabs and intestines except the blank control group, but there was a significant difference between the immunized group and the control group (see Figure 4 ).

[0154] 9.2.4 Results of autopsy and pathological tissue examination of 27-day-old piglets

[0155] Autopsy and histopathological examination were also performed on 7 days after infection. The results showed that all experimental animals were killed 7 days after infection. Before killing, the control group piglets had severe diarrhea after infection with the virus, with a lot of sticky yellow feces, while the immunized group and the non-infected group showed normal results (see Figure 5 After autopsy, no gross intestinal tissue lesions were found in the immunized piglets ( Figure 5 The most severely infected control piglets had clear, thin-walled, gas-distended small intestines ( Figure 5 No macroscopic lesions were observed in the intestinal tissues of piglets in the PBS group ( Figure 5 (f)

[0156] Microscopic lesions of the small intestine of piglets. The villi in the ileum of the control piglets were blunted, fragmented, atrophied, and vacuolated ( Figure 6 c and e). However, no pathological changes occurred in the intestinal tissues of the immunized piglets ( Figure 6 b and d). No lesions were found in the intestinal tissues of piglets in the PBS group ( Figure 6 (a). Immunofluorescence analysis of PEDV nucleocapsid (N) protein (see Figure 6 Figures fj) show that the intestinal tissues of the control piglets contained cells expressing N protein, which was not seen in any of the immunized piglets or the PBS group piglets.

[0157] 9.3 Results of passive immunization with PEDV G2a-S / G2b-S bivalent subunit vaccine

[0158] 9.3.1 Results of passive immunogenicity test of PEDV G2a-S / G2b-S bivalent subunit vaccine

[0159] In order to evaluate the passive protection effect of PEDV G2a-S / G2b-S bivalent subunit vaccine on piglets, the present invention uses PEDV G2a-S / G2b-S bivalent subunit vaccine to immunize sows one month before parturition (see Figure 7The piglets were fed with breast milk for 5 days, and blood was collected from the sows on the day of farrowing and 5 days after farrowing, and the serum was separated. The results showed that the PEDV G2a-S / G2b-S bivalent subunit vaccine induced high titers of IgG and sIgA antibodies in the serum and colostrum of sows ( Figure 7 In addition, it was found that passive transfer of immune sow antibodies to suckling pigs could be detected in the serum of suckling pigs, and the neutralizing antibody titer reached 1:64 ( Figure 7 High titers of IgG and sIgA antibodies were also detected in the serum of suckling pigs.

[0160] 9.3.2 Statistical results of clinical symptoms of piglets

[0161] All piglets were healthy and normal. Each litter was randomly divided into groups. Each piglet that had sucked colostrum for 5 days was given 4 mL × 10 6.5 TCID 50 / mL of AH2012 and 2mL×10 5.5 TCID 50 / mL HK2021 for virus attack and control DMEM. After the virus attack, the mental state and health of the piglets were observed and recorded daily, the severity of diarrhea symptoms was scored, and the intestinal tissue lesions were recorded. During the experiment, the piglets in the control group were in good health, had a normal diet, and had no diarrhea symptoms. After infection with the viruses PEDVAH2012 and HK2021, the piglets produced by sows that were not vaccinated became ill between 24h and 72h after the virus attack, and the incidence rate reached 100%. The sick pigs were listless, unstable, and vomited. All piglets had diarrhea symptoms and most of them had continuous diarrhea and severe dehydration. In contrast, only one piglet from sows immunized with PEDV bivalent subunit vaccine had moderate diarrhea 24h after the virus attack AH2012, and only one piglet had severe diarrhea 24h after the virus attack HK2021, indicating that vaccination and breast milk have a great effect on piglets' resistance to PEDV infection. The above results show that the antibodies produced by the vaccine can be transferred to newborn piglets through breast milk, thereby producing effective passive immunity and preventing piglets from being infected with PEDV (see Figure 8 ).

[0162] 9.3.3 Viral RNA quantitative detection results

[0163] Before the challenge, no PEDV RNA was detected in any fecal swab samples collected from the PBS group or any other pigs. After the challenge, viral RNA was extracted from the anal swabs of each piglet every day. On the 7th day, the piglets were killed, and the intestinal tissues were collected and the viral RNA levels were detected by fluorescent quantitative PCR. The results showed that viral RNA could be detected in all anal swabs and intestines, but there was a significant difference between the immunized group and the control group (see Fig. 9 ).

[0164] 9.3.4 Results of autopsy and pathological tissue examination of 5-day-old piglets

[0165] All experimental animals were killed 7 days after the virus challenge. Before the animals were killed, the piglets in the control group had severe diarrhea and a lot of yellow loose feces after the virus challenge, while the immunized group and the non-challenged group showed normal symptoms (see Fig.10 (ae).

[0166] After the piglets were killed and the abdominal cavity was opened, it was observed that the piglets in the control group infected with PEDV and showing severe diarrhea had obvious intestinal lesions, the intestinal tissue was obviously thinned and transparent, filled with light yellow or bright yellow fluid, and had obvious flatulence (see Fig.10 h and j). The intestinal lesions of the immunized group piglets with mild diarrhea were mild, and most of the intestinal tissues of the piglets in this group showed no symptoms of PEDV infection. HE staining results showed that the intestinal tissues of piglets infected with PEDV had obvious abnormal symptoms, such as loss and atrophy of intestinal villi, accumulation of eosinophils, local tissue vacuolation or edema, etc. However, the strain had no obvious symptoms after infecting the immunized group piglets, and those with mild diarrhea only showed mild lesions in the jejunum and ileum. HE staining and immunofluorescence tests jointly showed that PEDV that caused ileal lesions concentrated on invading the ileal villus epithelial cells, which is similar to other PEDV infections (see Fig.11 ).

[0167] From the above experimental studies and experimental results, it can be seen that the present invention uses the full length of the S protein of PEDV G2a and G2b to immunize piglets and sows, and respectively performs a large amount of eukaryotic expression and purification of the S protein of PEDV GⅡ-a and GⅡ-b subtypes, and prepares subunit vaccines for immunogenicity research. By immunizing 5-day-old piglets and sows one month into the farrowing period, the immunogenicity of the prepared subunit vaccine is verified by measuring the IgG / IgA of the immunized piglet serum, sow serum and milk, and the serum neutralization test, and the titer of the immune antibody of the PEDV subunit vaccine is evaluated, so that the immune effect of the S protein can be observed more intuitively, providing a scientific basis for further research. The neutralizing antibody titer of the PEDV G2a-S / G2b-S experimental group of the present invention can reach up to 128. Therefore, it can be preliminarily considered that the PEDV G2a-S / G2b-S bivalent subunit vaccine developed by the present invention can play a good protective role. Afterwards, the present invention used HK2021 (G2a) and AH2012 strains (G2b) to study the protective effect of the challenge on 27-day-old piglets in the immunization group and PBS group and 5-day-old piglets that sucked colostrum for 5 days. The challenge test showed that serum antibodies had a protective effect on piglets. Only one piglet in the 27-day-old piglet vaccine immunization group had mild to moderate diarrhea, and only one piglet in the 5-day-old piglet vaccine immunization group had mild to moderate diarrhea, while all piglets in the infection control group had watery diarrhea. In addition, the PEDV antigen protein in the intestinal tissue of the immunized piglets was significantly different from that in the control group by qRT-PCR and immunofluorescence. The results showed that the subunit vaccine prepared by the eukaryotic expressed S protein in this experiment induced a strong humoral immune response and prevented piglets from being infected with PEDV G2a and G2b. These data show that the subunit vaccine based on the S protein is a promising candidate vaccine that can be used to prevent PEDV infection.

[0168] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. A bivalent subunit vaccine for porcine epidemic diarrhea virus, characterized in that: The porcine epidemic diarrhea virus bivalent subunit vaccine comprises recombinant proteins PEDV-2a-S and PEDV-2b-S, wherein the amino acid sequence of the PEDV-2a-S is shown in SEQ ID NO: 2, and the amino acid sequence of the PEDV-2b-S is shown in SEQ ID NO: 4; The porcine epidemic diarrhea virus bivalent subunit vaccine further comprises an adjuvant; the adjuvant is M103 adjuvant; The volume ratio of the mixture of PEDV-2a-S and PEDV-2b-S to the adjuvant is 1:1; The mixture is a mixture of equal masses of the PEDV-2a-S and PEDV-2b-S, and the final concentration of the mixture in the porcine epidemic diarrhea virus bivalent subunit vaccine is 0.3 mg / mL.

2. The porcine epidemic diarrhea virus bivalent subunit vaccine according to claim 1, characterized in that The preparation method of PEDV-2a-S comprises the following steps: Introducing the target gene sequence into the expression vector to construct a recombinant expression vector; The recombinant expression vector is transferred into eukaryotic cells for expression, and the PEDV-2a-S is obtained by protein purification; Wherein, the nucleotide sequence of the target gene is shown as SEQ ID NO:

1.

3. The porcine epidemic diarrhea virus bivalent subunit vaccine according to claim 1, characterized in that The preparation method of PEDV-2b-S comprises the following steps: Introducing the target gene sequence into the expression vector to construct a recombinant expression vector; The recombinant expression vector is transferred into eukaryotic cells for expression, and the PEDV-2b-S is obtained by protein purification; Wherein, the nucleotide sequence of the target gene is shown as SEQ ID NO:

3.

4. A method for preparing a bivalent subunit vaccine of porcine epidemic diarrhea virus, characterized in that: The following steps are involved: The recombinant proteins PEDV-2a-S and PEDV-2b-S are mixed in equal mass and then mixed with an equal volume of an adjuvant, and then stirred and emulsified at room temperature to obtain a porcine epidemic diarrhea virus bivalent subunit vaccine; wherein the amino acid sequence of the PEDV-2a-S is shown in SEQ ID NO: 2, and the amino acid sequence of the PEDV-2b-S is shown in SEQ ID NO: 4; The final concentration of the mixture of the recombinant proteins PEDV-2a-S and PEDV-2b-S in the porcine epidemic diarrhea virus bivalent subunit vaccine is 0.3 mg / mL.

Images