Development and application of InDel molecular markers related to drought resistance at flowering stage in maize

Abstract

The application discloses a corn flowering drought resistance related InDel molecular marker development and application. Specifically disclosed is the application of any one of the following A1), A2), A3) and A4) of an InDel molecular marker or a substance for detecting the InDel molecular marker, the InDel molecular marker being a DNA molecule with a nucleotide sequence of 91-102 in sequence 2: A1) application in identifying or assisting in identifying a corn silking period and a silking interval and / or application in preparing a product for identifying or assisting in identifying a corn silking period and a silking interval; A2) application in identifying or assisting in identifying a corn silking period and / or application in preparing a product for identifying or assisting in identifying a corn silking period; A3) application in identifying or assisting in identifying a silking interval and / or application in preparing a product for identifying or assisting in identifying a corn silking period; and A4) application in preparing a corn breeding product. By identifying the genotype of the InDel molecular marker, a corn silking period and a silking interval and / or a silking period and / or a silking period can be identified or assisted in identifying, or a related trait variety breeding.

Description

Technical Field

[0001] This invention specifically relates to the development and application of InDel molecular markers related to drought resistance during the flowering period of maize in genetic engineering. Background Technology

[0002] Maize (Zea mays L.) is one of the world's most important food crops and also the most widely planted and highest-yielding food crop in my country, playing a vital role in ensuring food security. However, 65% of my country's maize planting area is located in arid and semi-arid rainfed agricultural regions, and drought-induced maize yield reductions seriously threaten national food security. Breeding and promoting drought-resistant maize varieties is a major strategy to address drought damage. The flowering period is the most water-sensitive time for maize. As a cross-pollinated crop, drought during the flowering period will lead to a mismatch between pollen shedding and silking, resulting in an average yield reduction of about 40%. Drought during this period is the most severe stage of yield reduction among all growth stages. Therefore, utilizing superior drought-resistant maize germplasm resources, identifying superior alleles, and developing molecular markers have significant theoretical and applied value for molecular breeding of drought-resistant maize. Summary of the Invention

[0003] The technical problem solved by this invention is how to provide an InDel molecular marker related to drought resistance during the flowering period of maize.

[0004] To address the above problems, the present invention provides the following applications.

[0005] Applications of InDel molecular labeling or detection of InDel molecularly labeled substances in any of the following ways:

[0006] A1) Application in identifying or assisting in the identification of the interval between corn pollination and silking and / or in the preparation of products for identifying or assisting in the identification of the interval between corn pollination and silking;

[0007] A2) Application in identifying or assisting in the identification of corn pollen shedding period and / or application in the preparation of products for identifying or assisting in the identification of corn pollen shedding period;

[0008] A3) Application in identifying or assisting in the identification of the silking stage and / or application in the preparation of products for identifying or assisting in the identification of the silking stage of corn;

[0009] A4) Application in the preparation of maize breeding products;

[0010] The InDel molecular marker is a DNA molecule with nucleotide sequences from position 91 to 102 in sequence 2.

[0011] In the above text, the silking period is the number of days from sowing to when the silks of the female ear of the plant emerge 2 cm from the bracts. The pollen shedding period (flowering period) is the number of days from sowing to when the male ear of the plant begins to shed pollen. The pollen shedding-silking interval is the time interval between the pollen shedding period and the silking period.

[0012] In the above text, the interval between pollen shedding and silking can be the interval between pollen shedding and silking of maize under drought stress conditions.

[0013] The pollen shedding period mentioned above can refer to the pollen shedding period under drought stress conditions.

[0014] The silking period mentioned above can refer to the silking period under drought stress conditions.

[0015] The substance may be a product. The detection substance may include reagents, kits, and instruments for detecting the above-mentioned InDel molecular markers. Specifically, primers and / or other reagents and instruments required for in vitro nucleic acid amplification for detecting the above-mentioned InDel molecular markers.

[0016] To address the aforementioned problems, the present invention also provides a product.

[0017] The product is a substance containing the InDel molecular marker described above, and may be any one of the following G1)-G3):

[0018] G1) Products that detect the InDel molecular marker;

[0019] G2) Application in identifying or assisting in identifying the interval between corn pollination and silking and / or application in preparing products for identifying or assisting in identifying the interval between corn pollination and silking;

[0020] G3) Application in identifying or assisting in the identification of corn pollen shedding period and / or application in the preparation of products for identifying or assisting in the identification of corn pollen shedding period;

[0021] G4) Applications in identifying or assisting in identifying the silking interval of corn and / or in preparing products for identifying or assisting in identifying the silking period of corn;

[0022] G5) is used in the preparation of maize breeding products.

[0023] To address the aforementioned problems, this invention also provides a method for identifying or assisting in the identification of the interval between the pollen shedding period and silking period of corn.

[0024] The method includes detecting whether the maize genome contains the aforementioned InDel molecular marker, and identifying or assisting in identifying the interval between the pollination period and silking period of maize based on whether the maize genome contains the InDel molecular marker:

[0025] The interval between pollination and silking of the inserted maize genotype is shorter than or candidate to be shorter than the interval between pollination and silking of the deleted maize genotype. The inserted genotype is a homozygous genotype with the aforementioned InDel molecular marker, and the deleted genotype is a homozygous genotype without the aforementioned InDel molecular marker.

[0026] To address the aforementioned problems, the present invention also provides a method for identifying or assisting in the identification of corn pollen shedding period.

[0027] The method includes detecting whether the maize genome contains the aforementioned InDel molecular marker, and identifying or assisting in the identification of maize pollen shedding period based on the presence of the InDel molecular marker in the maize genome:

[0028] The pollination period of maize with the insertion genotype is earlier than or can be earlier than that of maize with the deletion genotype. The insertion genotype is a homozygous genotype with the aforementioned InDel molecular marker, and the deletion genotype is a homozygous genotype without the aforementioned InDel molecular marker.

[0029] To address the aforementioned problems, this invention also provides a method for identifying or assisting in the identification of the silking stage of corn.

[0030] The method includes detecting whether the maize genome contains the aforementioned InDel molecular marker, and identifying or assisting in the identification of the maize silking stage based on the presence of the InDel molecular marker in the maize genome:

[0031] The silking period of maize with the insertion genotype is earlier than or can be earlier than the silking period of maize with the deletion genotype. The insertion genotype is a homozygous genotype with the aforementioned InDel molecular marker, and the deletion genotype is a homozygous genotype without the aforementioned InDel molecular marker.

[0032] In the above text, the pollen shedding period of maize containing the InDel molecular marker is earlier than or can be earlier than the pollen shedding period of maize not carrying the InDel molecular marker.

[0033] In the above text, the silking period of maize containing the InDel molecular marker is earlier than or can be earlier than the silking period of maize not carrying the InDel molecular marker.

[0034] In the above text, the interval between the pollen shedding period and the silking period of corn containing the InDel molecular marker is shorter than or candidate to be shorter than the interval between the pollen shedding period and the silking period of corn without the InDel molecular marker.

[0035] In the above text, the silking period is the number of days from sowing to when the silks of the female ear of the plant emerge 2 cm from the bracts. The pollen shedding period (flowering period) is the number of days from sowing to when the male ear of the plant begins to shed pollen. The pollen shedding-silking interval is the time interval between the pollen shedding period and the silking period.

[0036] In the above text, the deletion type is the homozygous type of SEQ ID No. 1, where there is no nucleotide between positions 90 and 91 of sequence 3.

[0037] In the above text, the insertion type is the homozygous type of SEQ ID No. 1, where there is a nucleotide between positions 90 and 91 of sequence 3.

[0038] In the above text, both homologous chromosomes of the deletion genotype have the following characteristics: there are no nucleotides between positions 90 and 91 of sequence 3 (SEQ ID No. 3) that are insertions of the 12 nucleotides of SEQ ID No. 1. Maize with the deletion genotype is a single deletion plant.

[0039] In the above text, the two homologous chromosomes of the insert type genome both have the following characteristics: there is an insertion of 12 nucleotides from SEQ ID No. 1 between positions 90 and 91 of sequence 3 (SEQ ID No. 3) in the genome. Maize with the insert type genotype is an insert type single plant.

[0040] To address the aforementioned problems, this invention also provides a method for maize breeding.

[0041] The method includes selecting homozygous maize with the aforementioned InDel molecular marker in its genome as parents for breeding.

[0042] The above describes the application of the methods in maize breeding.

[0043] In the above-mentioned applications, product development methods, and breeding objectives, the breeding objectives include cultivating or selecting maize varieties with early pollen shedding and / or early silking and / or short intervals between pollen shedding and silking.

[0044] In the above-described applications, products, methods, or methods, the substance used to detect the InDel molecular marker is one of the following: D1), D2), D3), or D4):

[0045] D1) In vitro nucleic acid amplification primers containing specific InDel molecular markers;

[0046] D2) An in vitro nucleic acid amplification reagent containing the in vitro nucleic acid amplification primers described in D1);

[0047] D3) A kit containing the in vitro nucleic acid amplification primers described in D1) or the in vitro nucleic acid amplification reagents described in D2);

[0048] D4) A detection instrument containing the in vitro nucleic acid amplification primers described in D1), the in vitro nucleic acid amplification reagents described in D2), or the kit described in D3).

[0049] In the above-mentioned applications, products, methods, or methods, the substance for detecting InDel molecular markers or genotypes, or the substance for detecting haplotypes, is as follows: D1), D2), D3), or D4):

[0050] D1) In vitro nucleic acid amplification primers containing specific amplification sites of InDel molecular markers;

[0051] D2) An in vitro nucleic acid amplification reagent containing the in vitro nucleic acid amplification primers described in D1);

[0052] D3) A kit containing the in vitro nucleic acid amplification primers described in D1) or the in vitro nucleic acid amplification reagents described in D2);

[0053] D4) contains the in vitro nucleic acid amplification primers described in D1), the in vitro nucleic acid amplification reagents described in D2), or the reagents described in D3).

[0054] 10. A DNA molecule, characterized in that the DNA molecule is a DNA molecule with the nucleotide sequence of sequence 2. Summary of the Invention:

[0056] The in vitro nucleic acid amplification technology may be polymerase chain reaction (PCR), chain substitution amplification (SDA), ligase chain reaction (LCR), sequence-dependent amplification (NASBA), rolling circle nucleic acid amplification (RCA), loop-mediated isothermal amplification (lamp), helicase-dependent isothermal amplification (HDA), or Qβ replication technology.

[0057] This application uses polymerase chain reaction (PCR) as an amplification method to detect polymorphism.

[0058] In the above applications, methods, and products, the in vitro nucleic acid amplification primers may or may not be labeled with a marker. The marker refers to any atom or molecule that can be used to provide a detectable effect and can be linked to a nucleic acid. Markers include, but are not limited to, dyes; radioactive labels, such as 32P; binding moieties, such as biotin; haptens, such as digoxigenin (DIG); luminescent, phosphorescent, or fluorescent moieties; and fluorescent dyes alone or in combination with moieties whose emission spectra can be inhibited or shifted by fluorescence resonance energy transfer (FRET). The marker can provide a signal detectable by fluorescence, radioactivity, colorimetry, gravimetric determination, X-ray diffraction or absorption, magnetism, enzyme activity, etc. The marker can be a charged moieties (positive or negative) or, optionally, charge-neutral. The marker can include nucleic acid or protein sequences or combinations thereof, provided that the sequence containing the marker is detectable. In some embodiments, nucleic acids are detected directly without labeling.

[0059] The corn may be at least one of the following:

[0060] The corn can be a hybrid offspring of corn A and corn B, where corn A carries the InDel molecular marker and corn B does not carry the InDel molecular marker. The hybrid offspring can be F2 generation or higher, such as F2 generation, BC1F2, etc.

[0061] The breeding objectives include developing maize varieties with early pollination and / or early silking and / or short intervals between pollination and silking.

[0062] In the above applications, methods, and products, the substance may be a reagent and / or kit and / or instrument required to determine the InDel molecular marker or genotype by at least one of the following methods: in vitro nucleic acid amplification, DNA sequencing, restriction enzyme fragment length polymorphism, single-strand conformation polymorphism, denaturing high-performance liquid chromatography, and InDel chips. InDel chips include chips based on nucleic acid hybridization reactions, chips based on single-base extension reactions, chips based on allele-specific primer extension reactions, chips based on one-step reactions, chips based on primer ligation reactions, chips based on restriction endonuclease reactions, chips based on protein-DNA binding reactions, and chips based on fluorescent molecule-DNA binding reactions.

[0063] Beneficial effects

[0064] This invention discloses the development and application of InDel molecular markers related to drought resistance during maize flowering. Specifically, it discloses the following applications of the InDel molecular marker or substances that detect the InDel molecular marker, wherein the InDel molecular marker is a DNA molecule with the nucleotide sequence at positions 91-102 of sequence 2: A1) Application in identifying or assisting in identifying the interval between pollen shedding and silking in maize and / or application in preparing products for identifying or assisting in identifying the interval between pollen shedding and silking in maize; A2) Application in identifying or assisting in identifying the pollen shedding period in maize and / or application in preparing products for identifying or assisting in identifying the pollen shedding period in maize; A3) Application in identifying or assisting in identifying the silking period and / or application in preparing products for identifying or assisting in identifying the silking period in maize; A4) Application in preparing maize breeding products. Identifying the genotype of the InDel molecular marker can identify or assist in identifying the interval between pollen shedding and silking in maize kernels and / or the pollen shedding period and / or silking period, or, for the breeding of varieties with related traits. Attached Figure Description

[0065] Figure 1This is an association analysis of the ZmABI45 candidate gene. The horizontal axis represents the nucleotide position with the ZmABI45 start codon (ATG) as the origin (0 bp), and the vertical axis represents the significance of the association analysis. Circles represent INDEL variants, and triangles represent SNP variants. Below the horizontal axis is the gene structure of ZmABI45, with dark boxes representing exons, lines representing introns, and light boxes representing uncoding regions (UTRs).

[0066] Figure 2 These are the insertion sequences for INDEL-178. The boxes indicate the insertion sequences for INDEL-178, while the others are flanking sequences for INDEL-178.

[0067] Figure 3 This study analyzed the pollen-silking interval of different haplotypes of INDEL-178 maize inbred lines under drought and normal conditions. The left figure shows the difference in pollen-silking interval among different haplotypes of 105 maize inbred lines INDEL-178 under drought treatment, while the right figure shows the difference in pollen-silking interval among different haplotypes of 105 maize inbred lines INDEL-178 under normal conditions. ** represents the significance test Student's t-test P < 0.01.

[0068] Figure 4 The INDEL-178 genotype was identified in the H082183×Lv28 recombinant inbred line population. The leftmost lane in the figure represents the marker and corresponding band length. Lanes 1-25 correspond to the INDEL-178 genotypes RIL001-RIL025 in Table 2, lane 26 represents the INDEL-178 genotype of Lv28, and lane 27 represents the INDEL-178 genotype of H082183.

[0069] Figure 5 This study analyzed the pollen-firing intervals of different haplotypes of INDEL-178 in the H082183×Lv28 recombinant inbred line population under drought and normal conditions. The left figure shows the difference in pollen-firing intervals of different haplotypes of INDEL-178 in the H082183×Lv28 recombinant inbred line population under drought treatment, while the right figure shows the difference in pollen-firing intervals of different haplotypes of INDEL-178 in the H082183×Lv28 recombinant inbred line population under normal conditions. ** represents the significance test Student's t-test P < 0.01.

[0070] The present invention will now be described in further detail with reference to specific embodiments. The given embodiments are merely illustrative of the invention and not intended to limit its scope. The embodiments provided below can serve as a guide for further improvements by those skilled in the art and do not constitute a limitation on the invention in any way.

[0071] Unless otherwise specified, the experimental methods used in the following examples are conventional methods, performed according to the techniques or conditions described in the literature in this field or according to the product instructions. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0072] The following examples used SPSS 11.5 statistical software to process the data. The experimental results are expressed as mean ± standard deviation. The Student's t test was used. P < 0.05 (*) indicates a significant difference, P < 0.01 (**) indicates a highly significant difference, and P < 0.001 (***) indicates a highly significant difference.

[0073] Example 1: Discovery of the InDel-178 molecular marker

[0074] 1. Materials

[0075] 105 maize inbred lines with broad genetic diversity and drought resistance phenotypic variation (see Table 1 for details). These maize inbred lines are described in the following literature: Genomic insights into historical improvement of heterotic groups during modern hybrid maize breeding (NaTuRe PLaNTS|VOL8|JULY2022|750–763|, Genome-wide identification of gene expression in contrasting maize inbred lines under field drought conditions reveals the significance of transcription factors in drought Tolerance, PLOS ONE, and Genome-wide selection and genetic improvement during modern maize breeding, NaTuReGeNeTICS).

[0076] 2. Experimental Methods

[0077] 2.1 Field Trial Design and Phenotypic Identification

[0078] Using 105 representative maize inbred lines (as shown in Table 1), field drought resistance assessments were conducted over two years in Beijing (2021 and 2022) and Urumqi (2022). The Beijing trial was conducted in a dry-shed facility at the Changping Experimental Base of the Institute of Crop Science, Chinese Academy of Agricultural Sciences. In the arid area, a drip irrigation system was used, with one irrigation session after sowing, providing 450 m³ of water. 3 / hm 2 Watering was stopped until the end of the experiment, and rain was provided through dry shelters during rainfall; the watered areas were managed as usual. Each experimental site used a two-row randomized block design with three replicates, a row length of 3m, a row spacing of 0.6m, and 13 plants per row. The silking period, pollen shedding period (flowering period), and pollen shedding-silking interval were manually recorded. The silking period was the number of days from sowing to when the silks of the female ear emerge 2cm from the bracts. The pollen shedding period (flowering period) was the number of days from sowing to when the male ear begins to shed pollen. The pollen shedding-silking interval was the time interval between the pollen shedding period and the silking period. The best linear unbiased prediction (BLUP) value for the multi-environment phenotypic data was calculated using the lme4 package in R.

[0079] Using 105 representative maize inbred lines (as shown in Table 1), an experimental study was conducted at the Anningqu Experimental Farm of the Institute of Food Crops, Xinjiang Academy of Agricultural Sciences, in Xinjiang.

[0080] The experiment was divided into a water-fed zone and a dry zone. Both zones used a four-row randomized block design, with six replicates (blocks) in each zone. Each block contained 105 plots (numbered 1-105, corresponding to maize inbred lines listed in Table 1). Each plot consisted of four rows, 3m long, with a row spacing of 0.6m and 13 plants per row. The 105 plots (numbered 1-105) corresponded to the 105 maize inbred lines listed in Table 1. Drip irrigation was used in both zones to precisely control soil moisture. The water-fed zone was irrigated every two weeks, with each irrigation volume being 900m³. 3 / hm 2 In arid areas, irrigation is also carried out every two weeks, with each irrigation providing 450m³ of water. 3 / hm 2Each experimental site used a two-row randomized block design with three replicates. Rows were 3m long with a row spacing of 0.6m, and each row contained 13 plants. The silking period, pollen shedding (flowering) period, and pollen shedding-silking interval were manually recorded. The silking period was the number of days from sowing to when the silks of the female ear emerged 2cm from the bracts. The pollen shedding (flowering) period was the number of days from sowing to when the male ear began shedding pollen. The pollen shedding-silking interval was the time interval between the pollen shedding and silking periods. The best linear unbiased prediction (BLUP) value for the multi-environment phenotypic data was calculated using the lme4 package in R.

[0081] 2.2 DNA Extraction

[0082] Maize leaf tissue was collected during the seedling stage, and maize genomic DNA was extracted using the CTAB method. The specific operation steps are as follows.

[0083] (1) Place an appropriate amount of corn leaf tissue into a mortar, add two-thirds of the volume of liquid nitrogen, crush the sample as much as possible, repeat the crushing 2-3 times, and put the powdered sample into a centrifuge tube soaked in liquid nitrogen to about 0.3 mL.

[0084] (2) Add 800 μL of CTAB to the centrifuge tube, shake to mix, and fully lyse the plant tissue.

[0085] (3) Place the centrifuge tubes in a 65°C water bath for 30 minutes, shaking and mixing three times during the process.

[0086] (4) Remove the centrifuge tube, place it in a fume hood, add 800 μL of a 24:1 solution (chloroform: isoamyl alcohol), and shake gently a few times.

[0087] (5) Centrifuge using a high-speed centrifuge at 4°C and 12,500 r / min for 20 min.

[0088] (6) Pipette about 450 μL of the supernatant into a new 1.5 mL EP tube, being careful not to aspirate protein membranes or other impurities.

[0089] (7) Add 450 μL of pre-cooled isopropanol and shake to mix until flocculent DNA appears. Centrifuge again at the same time, speed and temperature as in step (5) and discard the supernatant.

[0090] (8) Add 450 μL of 75% ethanol for rinsing, and centrifuge again at the same time, speed and temperature as in step (5). Discard the supernatant. Wash twice.

[0091] (9) Place the centrifuge tubes in a fume hood and allow them to air dry at room temperature. After the centrifuge tubes are dry, add 200 μL of ddH2O to dissolve the DNA. Measure the concentration using a NanoDrop 2000 (Thermo Scientific) instrument.

[0092] 2.3 PCR amplification, sequencing, and variant detection

[0093] Based on the gene sequence of the target gene ZmABI45 (4797 bp) and its upstream and downstream 2KB sequences, totaling 8797 bp, nine amplicons were designed to perform segmented PCR amplification of the genomic region. The PCR primers were as follows:

[0094]

[0095]

[0096] PCR amplification was performed using a high-fidelity enzyme. The PCR reaction system is as follows:

[0097]

[0098] The PCR reaction procedure is as follows:

[0099]

[0100] The amplified target fragment was purified by agarose gel electrophoresis. After confirming the target band, it was cut and recovered under UV light. The detailed procedure is as follows:

[0101] (1) Place the cut gelatin strips into a 2.0 mL EP tube, add 400 μL of GDP Buffer, and incubate at 55 °C for 7 min until there are no lumps in the EP tube. Add the completely dissolved solution into the adsorption column, centrifuge for 30 s, and discard the filtrate.

[0102] (2) Place the FastPure DNA Mini Columns-G adsorption column into a 2mL Collection Tube. Transfer the solution to the adsorption column, centrifuge at 12500r / min for 50s, and discard the filtrate.

[0103] (3) Add 350 μL of GDP Buffer, let stand at room temperature for 90 s, centrifuge at 12500 r / min for 50 s, and discard the filtrate.

[0104] (4) Add 720 μL of GWBuffer (with anhydrous ethanol added) and centrifuge at 12500 r / min for 50 s. Repeat twice, centrifuging in an empty tube for 3 min to completely remove residual GWBuffer.

[0105] (5) Place a new EP tube and insert the adsorption column into it. Add 45 μL of ddH2O to the intermediate membrane of the adsorption column, let it stand for 3 min, then run at 12500 r / min for 2 min. Store the recovered DNA target fragment in a -20℃ freezer. The purified PCR product is used for Sanger sequencing.

[0106] 2.4 Candidate gene association analysis

[0107] Different amplified fragments were spliced ​​and compared to obtain a variation map, and candidate gene association analysis for flowering drought resistance was carried out. The specific operation steps are as follows:

[0108] (1) The bidirectional sequencing results were compared and spliced ​​using DNAMAN10 software to obtain 105 ZmABI45 genes and their upstream and downstream precise sequences.

[0109] (2) The 105 material gene sequences obtained by sequencing using MEGAX and SnapGene software were compared to obtain SNP and InDel variant sites.

[0110] (3) Using TASSEL5 software, construct the kinship matrix of 105 samples and perform principal component analysis (PCA) with the system default parameters selected.

[0111] (4) Using pollen-silkation interval phenotypic data of 105 materials under drought conditions, as well as genetic variation sites and population structure information, candidate gene association analysis was carried out using the general linear model (GLM) of TASSEL5.

[0112] 2.5 RNA extraction and cDNA library construction from leaf tissues

[0113] Leaf tissues were collected from each plot during V13, with 5 individual plants per plot. RNA samples were extracted from the tissues using the RNAEasy Fast Plant Tissue RNA Rapid Extraction Kit (Tiangen). The specific procedures are as follows:

[0114] (1) Sterilize the mortar and pestle at high temperature beforehand, then spray and wipe it with RNaseZap solution to remove RNase, and prepare sufficient liquid nitrogen for grinding.

[0115] (2) Add liquid nitrogen to the mortar to pre-cool, then add the plant tissue and grind quickly into a fine powder. Take about 50 mg of plant tissue powder and put it into a centrifuge tube without RNase.

[0116] (3) Add 600 μL of lysis buffer PRL to the centrifuge tube and vortex in a high-speed vortex shaker for 20 s to ensure that the sample is thoroughly mixed and lysed.

[0117] (4) After complete pyrolysis, use a high-speed centrifuge to centrifuge the pyrolysis products at 12500r / min, 12min, 4℃.

[0118] (5) After centrifugation, transfer 480 μL of the supernatant to a new EP tube, add 240 μL of anhydrous ethanol, and shake to mix. Add the mixture to the gDNA filter (no more than 720 μL each time), centrifuge at 13000 r / min for 2 min, discard the filtrate, and retain the filter column in the filter.

[0119] (6) Replace the filter column with a new 2.0 mL EP tube, add 500 μL of lysis buffer ARLT PLUS, centrifuge at 12500 r / min for 2 min. Collect the filtrate, add 0.5 times the volume of anhydrous ethanol, and immediately mix by pipetting.

[0120] (7) Immediately transfer the mixed solution (not exceeding 720 μL) to a new RNA adsorption column and centrifuge at 13000 r / min for 2 min. Discard the filtrate.

[0121] (8) Add 750 μL of protein removal solution RW1 to rinse the adsorption column containing RNA to remove residual protein on the adsorption column membrane. Let it stand for 60 s, centrifuge at 12500 r / min for 60 s, and discard the filtrate.

[0122] (9) Finally, rinse twice with RW rinse buffer containing anhydrous ethanol, adding 550 μL each time, at 11000 rpm for 30 s, and discard the filtrate. Place the RNA adsorption column back into the tube. Without adding any solution, rinse at 13000 rpm for 2 min. Discard the filtrate and allow to stand at room temperature until any residual rinse has evaporated.

[0123] (10) Place the adsorption column into a new RNase-Free centrifuge tube, add 35 μL of RNase-Free water (preheated in a 60°C water bath beforehand) to the membrane of the adsorption column, centrifuge at high speed to collect the RNA-containing solution, and use a NanoDrop2000 spectrophotometer to determine the concentration of the RNA solution. Store the RNA solution at -80°C in an ultra-low temperature freezer.

[0124] A cDNA library was constructed using reverse transcription using One-Step gDNA Removal and cDNA Synthesis SuperMix (TruGold). The specific steps are as follows:

[0125] Prepare a reverse transcription system in a 1.5 mL RNase-free tube.

[0126]

[0127]

[0128] The prepared system was incubated at 52°C for 15 min, followed by inactivation at 85°C for 5 s. 80 μL of ddH2O was added to the cDNA stock solution to dilute it, and the mixture was stored at -20°C.

[0129] 2.6 Gene Expression qRT-PCR Detection

[0130] qRT-PCR analysis was performed using SYBR qPCR Master Mix (Novizan) and an ABI Quantstudio 3 real-time quantitative PCR system (ThermoFisher). The primer sequences for qRT-PCR detection of the target gene were 5′-TTGGAGGACGAAGAGGGTCTTG-3′ and 5′-AATCCCCTTCCTCCAGGTTGTG-3′. The internal reference gene was GADPH, with primer sequences of 5′-GTGGTGGTAGGAATAC AGAACATG-3′ and 5′-GGGTTATTAGGGTCCAGACTG-3′.

[0131] The reaction system is as follows:

[0132]

[0133] The qRT-PCR reaction procedure is as follows:

[0134]

[0135] Gene expression levels were calculated using the 2-ΔΔCt method, with three replicates for each sample. The mean and standard deviation were calculated.

[0136] 3 Results Analysis

[0137] 3.1 Candidate gene association analysis

[0138] Previous research identified a drought-resistance gene for flowering in maize, ZmABI45. Transgenic maize overexpressing this gene exhibited a significantly shortened pollen-silking interval under drought conditions. This study analyzed natural variation sites in ZmABI45 regulating flowering drought resistance using 105 diverse maize inbred lines. Through multi-fragment PCR amplification and sequencing, 206 SNP variants and 54 InDel variants were detected in a 7635 bp sequence. Candidate gene association analysis was conducted using these variation site information and drought-resistance phenotypic data. The results showed that a 12 bp InDel marker in the promoter region of the ZmABI45 gene was significantly associated with flowering drought resistance. This variation site is located 178 bp upstream of the start codon and 32 bp upstream of the transcription start site. This InDel variant was named INDEL-178 (also known as InDel-12). Figure 1 As shown ( Figure 1 In the figure, the horizontal axis represents the physical location of the molecular marker, and the vertical axis represents the significance of the association analysis. INDEL represents the INDEL molecular marker, SNP represents the SNP molecular marker, and INDEL-178 is a 12bp insertion / deletion of the promoter of the ZmABI45 gene. The INDEL-178 (also known as InDel-12) deletion haplotype includes 78 inbred lines, and the insertion haplotype includes 40 inbred lines (as shown in Table 1).

[0139] INDEL-178 exists in two haplotypes (insertion haplotype or deletion haplotype), both of which have a 12-nucleotide insertion or deletion between positions 90 and 91 of sequence 3 (SEQ ID No. 3) in the genome. This 12-nucleotide insertion or deletion marker is abbreviated as InDe1-178 (also known as InDel-12). InDe1-178 (also known as InDel-12) is sequence 1 (SEQ ID No. 1; 5'-AGGCCACTTGCC-3'), specifically as follows... Figure 2 The rectangular area shown represents the insertion or deletion region of 12 nucleotides.

[0140] Sequence 2 is as follows:

[0141] GGTGTGTGTGGATTTTAGAATTCTTTTCTACTGAAGTACTCCGTATTAGTATAGAGAGAGAAAGGGCAGCCGGAGACGACGAGAGGGGAGAGGCCACTTGCCTGGCTTTTCAAACTCGAAACGAGCCGAAAGAGATTCCTCGTGGACGAGGACTCTGGAGAGAGTGGCCATCCAACGGGCCGGATTCAGGGTGACTAACACAAG.

[0142] Sequence 3 is as follows:

[0143] GGTGTGTGTGGATTTTAGAATTCTTTTCTACTGAAGTACTCCGTATTAGTATAGAGAGAGAAAGGGCAGCCGGAGACGACGAGAGGGGAGTGGCTTTTCAAACTCGAAACGAGCCGAAAGAGATTCCTCGTGGACGAGGACTCTGGAGAGAGTGGCCATCCAACGGGCCGGATTCAGGGTGACTAACACAAG.

[0144] An insertion haplotype is defined as an insertion of 12 nucleotides from SEQ ID No. 1 between positions 90 and 91 of sequence 3 (SEQ ID No. 2) in the genome. A deletion haplotype is defined as the absence of this insertion between positions 90 and 91 of sequence 3 (SEQ ID No. 3). The genotypes of the 78 maize inbred lines with the deletion haplotype are homozygous for the deletion haplotype, i.e., the genotype is deletion-type. The genotypes of the 40 maize inbred lines with the insertion haplotype are homozygous for the insertion haplotype, i.e., the genotype is insertion-type. This results in three genotypes (also known as the INDEL-178 genotype or the InDel-12 genotype).

[0145] The genomes of deletion genotypes (also known as deletion genotypes, INDEL-178 deletion genotypes, or InDel-12 deletion genotypes) have the following characteristics on both homologous chromosomes: there are no nucleotides between positions 90 and 91 of sequence 3 (SEQ ID No. 3) in the genome that are insertions of the 12 nucleotides of SEQ ID No. 1. Maize with the deletion genotype is a single deletion genotype plant.

[0146] The genomes of the insert genotype (also known as the insert genotype, INDEL-178 insert genotype, or InDel-12 insert genotype) share the following characteristics on both homologous chromosomes: an insertion of 12 nucleotides from SEQ ID No. 1 between positions 90 and 91 of sequence 3 (SEQ ID No. 3). Maize with the insert genotype is an insert genotype single plant.

[0147] A heterozygous genotype (also known as a heterozygous genotype, INDEL-178 heterozygous genotype, or InDel-12 heterozygous genotype) has one homologous chromosome with the following characteristics: an insertion of 12 nucleotides from SEQ ID No. 1 between positions 90 and 91 of sequence 3 (SEQ ID No. 3) in the genome; and the other homologous chromosome with the following characteristics: no insertion of 12 nucleotides from SEQ ID No. 1 between positions 90 and 91 of sequence 3 (SEQ ID No. 3) in the genome. A maize genotype that is heterozygous is a heterozygous single plant.

[0148] The silking period, pollen shedding period (flowering period), and pollen shedding-silking interval were manually recorded. The best linear unbiased prediction (BLUP) value for the multi-environment phenotypic data was calculated using the lme4 package in R. The results are shown in Table 1 (Table 1 shows the statistical results for maize in arid areas). Figure 3 As shown, Figure 3 ZmABI45 del-178 It is a genotype deletion plant, ZmABI45 in-178 It is an insertion-type plant; Figure 3 In the case of A, WS ASI represents the pollen-silking interval under arid conditions (dry areas); Figure 3 WWASI in B refers to the powder-spinning interval under normal moisture conditions (water zone).

[0149] The silking period is the number of days from sowing to when the silks of the female ear of the plant extend 2 cm out of the bracts.

[0150] The pollen shedding period (flowering period) is the number of days from sowing to the start of pollen shedding from the male inflorescence of the plant.

[0151] The powder-coating interval is the time interval between the powder-coating period and the coating period.

[0152] T-tests were performed on pollen-silking interval (ASI) data under drought and normal moisture conditions for both INDEL-178 deletion haplotype inbred lines (maize with deletion genotype) and INDEL-178 insert haplotype inbred lines (maize with insert genotype) and their respective inbred lines. The results showed that the ASI of the INDEL-178 deletion haplotype inbred lines was significantly smaller than that of the INDEL-178 insert haplotype inbred lines under both drought and normal moisture conditions. Under drought conditions, the average ASI for the 78 deletion haplotype inbred lines was 2.3 days, and for the 40 insert haplotype inbred lines it was 3.3 days. Under normal moisture conditions, the average ASI for the deletion haplotype was 1.9 days, and for the insert haplotype it was 2.8 days. This indicates that maize inbred lines with the INDEL-178 deletion genotype have strong drought resistance, while inbred lines with the insertion genotype exhibit a larger pollen-silking interval under drought conditions.

[0153] Table 1. Genotypes and related phenotypes of 105 diverse maize inbred lines in arid regions of different areas (Beijing and Urumqi).

[0154]

[0155]

[0156]

[0157]

[0158]

[0159]

[0160]

[0161]

[0162]

[0163] Note: Silking period is the number of days from sowing to when the silks of the female ear of the plant emerge 2 cm from the bracts. Pollen shedding period (flowering period) is the number of days from sowing to when the male ear of the plant begins to shed pollen. Pollen shedding-silking interval is the time interval between the pollen shedding period and the silking period.

[0164] Example 2: Validation of InDel-178 molecular marker function

[0165] I. Obtaining single plants of the recombinant inbred line (RIL) H082183×Lv28

[0166] H082183 and Lv28 are described in the following literature: Overexpression of ZmEXPA5 reduces anthesis-silking interval and increases grain yield under drought and well-watered conditions in maize. In this literature, H082183 is referred to as H082183 and Lv28 is referred to as Lv28.

[0167] The F1 hybrid plants were obtained by hybridizing the deletion material H082183 as the female parent and the insertion material Lv28 as the male parent. The F1 plants were self-pollinated to obtain F2 plants. 118 F2 plants were selected and self-pollinated for 5 consecutive generations to obtain a recombinant inbred line (RIL) population.

[0168] The experiment was divided into a water-grown area and a dry area. Both the water-grown and dry area experiments used a four-row randomized block design, with 6 replicates (blocks) in each area. Each block consisted of 105 plots (numbered 1-118, corresponding to the H082183×Lv28 recombinant inbred line (RIL) populations labeled 1-118 in Table 2). Each plot had four rows, with a row length of 3m, a row spacing of 0.6m, and 13 plants per row. Drip irrigation was used in both the water-grown and dry areas to precisely control soil moisture content. The water-grown area was irrigated every two weeks, with each irrigation being 900m³. 3 / hm 2 In arid areas, irrigation is also carried out every two weeks, with each irrigation providing 450m³ of water. 3 / hm 2 Each experimental site used a two-row randomized block design with three replicates. Rows were 3m long with a row spacing of 0.6m, and each row contained 13 plants. The silking period, pollen shedding (flowering) period, and pollen shedding-silking interval were recorded manually. The silking period was the number of days from sowing to when the silks of the female ear emerged 2cm from the bracts. The pollen shedding (flowering) period was the number of days from sowing to when the male ear began shedding pollen. The pollen shedding-silking interval was the time interval between the pollen shedding and silking periods. The best linear unbiased prediction (BLUP) value for the multi-environment phenotypic data was calculated using the lme4 package in R.

[0169] Genotyping

[0170] (1) DNA extraction

[0171] Using the DNA extraction method described in Example 1, Section 2.2, family genomic DNA of the H082183×Lv28 recombinant inbred line (RIL) population was obtained.

[0172] (2) Genotyping

[0173] Based on the characteristics of INDEL-178 (also known as InDel-12), detection primers InDel-178-F (CTT GTGTTAGTCACCCTGAAT) and InDel-178-R (GGTGTGTGTGGATTTTAGAA) were designed. If the amplification result is 192bp, the genotype of the sample is deletion; if the amplification result is 204bp, the genotype of the sample is insertion; if the amplification results are 192bp and 204bp, the genotype of the sample is heterozygous.

[0174] Using the genomic DNA obtained in step 1 as a template, PCR amplification was performed on the InDel-178 genotypes of families in the H082183×Lv28 recombinant inbred line (RIL) population. The primers used were: InDel-178-F: CTTGTGTTAGTCACCCTGAAT, InDel-178-R: GGTGTGTGTGGATTTTAGAA. The deletion amplification length was 192 bp, and the insertion amplification length was 204 bp.

[0175] Genotyping was performed using polyacrylamide gel electrophoresis, and the results identified two genotypes: insertion type and deletion type. The deletion type genotype had the following characteristic on both homologous chromosomes: the nucleotides between positions 90 and 91 of sequence 2 (SEQ ID No. 3) were not inserted as the 12 nucleotides of SEQ ID No. 1. Maize plants with the deletion type genotype were identified as deletion type individual plants.

[0176] Both homologous chromosomes of the insert-type genome share the following characteristic: an insertion of 12 nucleotides from SEQ ID No. 1 exists between positions 90 and 91 of sequence 3 (SEQ ID No. 3) in the genome. Maize with the insert-type genotype is an insert-type single plant, as shown in the results. Figure 4 (The leftmost lane represents the marker and the corresponding band length. Lanes 1-25 correspond to the INDEL-178 genotypes RIL001-RIL025 in Table 2, lane 26 corresponds to the INDEL-178 genotype Lv28, and lane 27 corresponds to the INDEL-178 genotype H082183.) and Table 2 (Statistical results of maize phenotypes in arid areas) are shown.

[0177] The silking period, pollen shedding period (flowering period), and pollen shedding-silking interval were manually recorded. The silking period was the number of days from sowing to when the silks of the female ear emerge 2 cm from the husks. The pollen shedding period (flowering period) was the number of days from sowing to when the male ear begins to shed pollen. The pollen shedding-silking interval was the time interval between the pollen shedding period and the silking period. The results are shown in Table 2 (Statistical Results of Maize Phenotypic Characteristics in Arid Regions). Figure 5 As shown, Figure 5 ZmABI45 del-178 It is a genotype deletion plant, ZmABI45 in-178 It is an insertion-type plant; Figure 5 In the case of A, WS ASI represents the pollen-silking interval under arid conditions (dry areas); Figure 5 In the middle B, WWASI stands for the powder-silk interval under normal moisture conditions (water zone).

[0178] For the INDEL-178 deletion haplotype and INDEL-178 insertion haplotype inbred lines of the H082183×Lv28 recombinant inbred line (RIL) population, t-tests were performed on pollen-silking interval (ASI) data under drought and normal moisture conditions. The results showed that in the RIL population, the ASI of the INDEL-178 deletion haplotype inbred lines was significantly smaller than that of the INDEL-178 insertion haplotype inbred lines under both drought and normal moisture conditions. Under drought conditions, the average ASI for the 51 deletion haplotype inbred lines was 2.8 days, and the average ASI for the 67 insertion haplotype inbred lines was 4.1 days. Under normal moisture conditions, the average ASI for the deletion haplotype was 1.5 days, and the average ASI for the insertion haplotype was 2.3 days. This indicates that maize inbred lines with the INDEL-178 deletion genotype have strong drought resistance, while inbred lines with the insertion genotype exhibit more severe flowering mismatch under drought conditions.

[0179] Table 2. Genotypes and related phenotypes of the H082183×Lv28 recombinant inbred line (RIL) population in arid regions.

[0180]

[0181]

[0182]

[0183]

[0184] Note: Silking period is the number of days from sowing to when the silks of the female ear of the plant emerge 2 cm from the bracts. Pollen shedding period (flowering period) is the number of days from sowing to when the male ear of the plant begins to shed pollen. Pollen shedding-silking interval is the time interval between the pollen shedding period and the silking period.

[0185] The present invention has been described in detail above. For those skilled in the art, the invention can be practiced in a wide range of ways with equivalent parameters, concentrations, and conditions without departing from its spirit and scope, and without requiring unnecessary experiments. Although specific embodiments have been given, it should be understood that further modifications can be made to the invention. In summary, according to the principles of the invention, this application is intended to include any changes, uses, or improvements to the invention, including changes made using conventional techniques known in the art that depart from the scope disclosed herein. Some of the essential features can be applied within the scope of the following appended claims.

Claims

1. Application of InDel molecular markers in identifying or assisting in the identification of the length of the interval between pollen shedding and silking in maize; The InDel molecular marker is a DNA molecule with nucleotide sequences at positions 91-102 in sequence 2.

2. Applications for detecting InDel-labeled substances in any of the following ways: A1) Application in identifying or assisting in identifying the length of the interval between corn pollination and silking and / or in preparing products for identifying or assisting in identifying the length of the interval between corn pollination and silking; A2) Application in the preparation of maize breeding products; the purpose of the breeding is to cultivate or select maize with a short interval between pollen shedding and silking periods; The InDel molecular marker is a DNA molecule with nucleotide sequences from position 91 to 102 of sequence 2.

3. The application according to claim 2, characterized in that, The substance used to detect the InDel molecular marker is either D1), D2), D3), or D4): D1) Contains in vitro nucleic acid amplification primers that specifically amplify the InDel molecular marker; D2) An in vitro nucleic acid amplification reagent containing the in vitro nucleic acid amplification primers described in D1); D3) A kit containing the in vitro nucleic acid amplification primers described in D1) or the in vitro nucleic acid amplification reagents described in D2); D4) A detection instrument containing the in vitro nucleic acid amplification primers described in D1), the in vitro nucleic acid amplification reagents described in D2), or the kit described in D3).

4. A method for identifying or assisting in identifying the length of the interval between the pollen shedding period and silking period of corn, characterized in that, The method includes detecting whether the maize genome contains the InDel molecular marker as described in claim 1, and identifying or assisting in identifying the length of the interval between the pollination period and silking period of maize based on whether the maize genome contains the InDel molecular marker: The interval between pollen shedding and silking in the deletion-type maize is shorter than or candidate to be shorter than the interval between pollen shedding and silking in the insertion-type maize, wherein the insertion-type maize is a homozygous maize with the InDel molecular marker described in claim 1, and the deletion-type maize is a homozygous maize without the InDel molecular marker described in claim 1.

5. A method for breeding maize, comprising selecting homozygous maize with the InDel molecular marker missing in the genome of claim 1 as a parent for breeding; the purpose of the breeding is to cultivate or select maize with a short interval between pollen shedding and silking periods.

Images