Visualized LAMP detection primers, kit and detection method for bovine lumpy skin disease virus

Abstract

The present invention provides a visualized LAMP detection primer, a kit and a detection method for bovine nodular skin disease virus, and belongs to the field of biotechnology. The visualized LAMP detection primer, the kit and the detection method provided by the present invention have strong specificity, can effectively detect bovine nodular skin disease virus, and are not interfered or affected by FMDV (foot-and-mouth disease virus), BVDV (bovine viral diarrhea virus), IBRV (infectious bovine rhinotracheitis virus), GTPV (goat pox virus) and SPPV (sheep pox virus); the sensitivity is high, and the minimum detection limit is 100 copies / μL; the clinical sensitivity can reach 96.7%, which is higher than the detection rate of the visualized LAMP method recommended by WOAH. In addition, without the aid of laboratory special equipment, the conventional constant temperature heat block can complete the amplification reaction, and the positive and negative results can be identified by naked eyes. It is simple and fast, and can realize on-site sampling and detection of bovine nodular skin disease virus.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a visualized LAMP detection primer, a kit and a detection method for bovine nodular skin disease virus. Background Art

[0002] Lumpy skin disease (LSD), also known as cattle lumpy skin disease and cattle pimple skin disease, is a systemic infectious disease of cattle caused by the bovine lumpy skin disease virus (LSDV, a double-stranded DNA virus) of the genus Capropoxvirus of the family Poxviridae. Clinical features include nodular lesions on the skin of cattle, emaciation, fever, and swollen lymph nodes. LSD is an animal disease that must be reported to the World Organization for Animal Health (WOAH), and is also a Class II animal disease in my country's "List of Class I, II, and III Animal Diseases". LSD has occurred in many places in my country. Although the disease has a low mortality rate, LSDV can cause abortion in pregnant cows, mastitis in dairy cows, and orchitis in bulls. The disease will affect meat products, milk production in dairy cows, and leather quality, seriously affecting the development of the cattle industry.

[0003] At present, the main methods for detecting bovine nodular skin disease virus are molecular biology detection and serological detection. Among them, molecular biology detection includes polymerase chain reaction (PCR), fluorescent quantitative PCR (qPCR), etc., but these methods are often time-consuming, the detection process is cumbersome, and professional personnel and PCR or qPCR equipment are required. This also causes the molecular biology detection method for bovine nodular skin disease virus to be mostly completed in the laboratory, and it is difficult to achieve on-site sampling and testing. Serological tests include virus neutralization test (VNT), ELISA, agar gel immunodiffusion test (AGPT), etc. VNT is time-consuming, requires virus processing in a P2 laboratory, and has low sensitivity; although ELISA has high sensitivity and specificity, there is a serum cross-reaction; AGPT has a low detection rate and poor sensitivity. Therefore, there is an urgent need for a simple, fast, accurate, and on-site detection method for bovine nodular skin disease virus. Loop-mediated isothermal amplification (LAMP) is an isothermal amplification achieved under constant temperature conditions with the help of a heat-resistant Bst enzyme with strand displacement and 5'-3' polymerase activity. It has simple requirements for instruments and equipment (a constant temperature heat block is sufficient), has strong specificity, high sensitivity, and is easy to operate. It can make up for the shortcomings of conventional PCR and qPCR, is suitable for grassroots applications, and can meet the needs of on-site sampling and testing. Summary of the invention

[0004] In view of this, the purpose of the present invention is to provide a visualized LAMP detection primer, a kit and a detection method for bovine nodular skin disease virus. The visualized LAMP detection primer, the kit and the detection method provided by the present invention are simple, fast and accurate, and can realize the on-site detection of bovine nodular skin disease virus.

[0005] In order to achieve the above object, the present invention provides the following technical solutions:

[0006] Visualized LAMP detection primers for bovine lumpy skin disease virus, the visualized LAMP detection primers comprising an outer primer pair, an inner primer pair and a loop primer pair;

[0007] Among them, the outer primer pair includes 1-F3 and 1-B3, the specific nucleotide sequence of 1-F3 is as shown in Seq_1, and the specific nucleotide sequence of 1-B3 is as shown in Seq_2; the inner primer pair includes 1-FIP3 and 1-BIP3, the specific nucleotide sequence of 1-FIP3 is as shown in Seq_3, and the specific nucleotide sequence of 1-BIP3 is as shown in Seq_4; the loop primer pair includes 1-Floop23 and 1-Bloop; the specific nucleotide sequence of 1-Floop23 is as shown in Seq_5, and the specific nucleotide sequence of 1-Bloop is as described in Seq_6.

[0008] Specifically, the specific nucleotide sequences of Seq_1 to Seq_6 are as follows:

[0009] Seq_1: TTCTTTAGGAGATAAGATTGTCA;

[0010] Seq_2: CGGAAATGCATTTTTTTTAAACG;

[0011] Seq_3:

[0012] GAGATTTTATTATGAGTGGCTTCTTTTTTATAAATTGATTCGCCAC CTATT;

[0013] Seq_4:

[0014] CTGGAATAAATAATCCAGATATTCCTTTTTTCAACATTTAGTAATAG CGTTGTC;

[0015] Seq_5: ATGGGGTTAATTTTTTACCACA;

[0016] Seq_6: TTATTCTTAACACAGGCCGTAA.

[0017] In certain embodiments, the amplification target gene of the visualized LAMP detection primer is a gene encoding a protein of the poxvirus_F11 superfamily.

[0018] Specifically, the size of the ORF of the poxvirus_F11 superfamily protein encoding gene is 900bp.

[0019] The present invention also provides a visualized LAMP detection kit for bovine nodular dermatitis virus, which comprises a reaction premix and a crude nucleic acid extract; wherein the reaction premix comprises the visualized LAMP detection primers described in the above technical solution.

[0020] In certain embodiments, the reaction premix further includes ddH 2 O, Bst DNase, LAMP Mix buffer, dye.

[0021] In certain embodiments, the visualized LAMP detection primers, ddH 2 O, Bst DNA enzyme, LAMP Mix buffer, and dye can be mixed in advance and placed in a reaction tube. The present invention is not only easy to carry, but also can reduce the operation steps at the detection site, avoid aerosol pollution, and increase the accuracy of detection by first packaging all reactants except the DNA of the sample to be tested and placing them in the reaction tube.

[0022] In certain embodiments, the molar ratio of the outer primer pair, the inner primer pair, and the loop primer pair in the visualized LAMP detection primers is preferably 5:30:3.

[0023] In certain embodiments, the dye is cresol red, and the dye is dissolved in LAMP Mix buffer.

[0024] In certain embodiments, the final concentration of the dye in the LAMP Mix buffer is 0.04 mmol / L to 0.08 mmol / L.

[0025] In some embodiments, a crude nucleic acid extract is also included. The present invention can detect the DNA of the sample to be tested by only crudely extracting the DNA, without the need to purify the DNA.

[0026] In certain embodiments, the crude nucleic acid extract comprises a lysis solution and proteinase K.

[0027] Specifically, the volume ratio of the lysate to proteinase K is preferably (20-25): (1-2).

[0028] The present invention also provides a visual LAMP detection method for detecting bovine nodular skin disease virus for non-diagnostic and non-therapeutic purposes, comprising the following steps:

[0029] Add the crude nucleic acid extract to the sample to be tested, mix well and react for 5-10 minutes, centrifuge and take the supernatant to obtain crude DNA;

[0030] Add the crude DNA into the reaction premix and react at 60℃~68℃ for 30min~60min.

[0031] Specifically, the centrifugation is preferably performed at 5000 rpm to 6000 rpm for 8 min to 10 min.

[0032] Specifically, the amount of crude DNA added is preferably 1 μL to 2 μL.

[0033] In certain embodiments, if the color of the liquid in the reaction tube changes to yellow after the isothermal reaction, it is judged as positive; if the color of the liquid in the reaction tube remains unchanged and is still purple-red after the isothermal reaction, it is judged as negative. Cresol red is an acid-base indicator with a pH color change range of 2 to 8, and the color changes from yellow to purple-red. When LAMP is undergoing reaction amplification, a large amount of hydrogen ions are generated, the solution is acidic, and the color changes to yellow.

[0034] Beneficial technical effects: The present invention provides a visualized LAMP detection primer, a kit and a detection method for bovine nodular skin disease virus. The visualized LAMP detection primer, the kit and the detection method provided by the present invention have strong specificity, can effectively detect bovine nodular skin disease virus, and are not interfered or affected by FMDV (foot-and-mouth disease virus), BVDV (bovine viral diarrhea virus), IBRV (infectious bovine rhinotracheitis virus), GTPV (goat pox virus) and SPPV (sheep pox virus); the sensitivity is high, and the minimum detection limit is 100 copies / μL; the clinical sensitivity can reach 96.7%, which is higher than the detection rate of the visualized LAMP method recommended by WOAH. In addition, without the aid of special laboratory equipment, the amplification reaction can be completed by a conventional constant temperature heat block, and the positive and negative results can be identified by the naked eye. It is simple and fast, and can realize on-site sampling and detection of bovine nodular skin disease virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 is the primer screening result; wherein, curves 2, 4, 7, and 9 correspond to the amplification curves of the corresponding primer sets, and 13 is the blank control NC;

[0036] Figure 2 is the result of dye screening; among them, the dye of A is calcein, the dye of B is cresol red, the dye of C is neutral red, and the dye of D is hydroxynaphthol blue; "+" indicates positive, and "-" indicates negative;

[0037] Figure 3 To visualize the specific detection results of LAMP; among them, 1 is bovine lumpy skin disease virus, 2 is positive plasmid control, 3 is bovine infectious rhinotracheitis virus, 4 is goat pox virus, 5 is sheep pox virus, 6 is foot-and-mouth disease virus, 7 is bovine epidemic diarrhea virus, and 8 is blank control NC;

[0038] Figure 4 The electrophoresis analysis results of the visualized LAMP specific detection are shown in Figure 1. 1 is bovine infectious rhinotracheitis virus, 2 is goat pox virus, 3 is bovine lumpy skin disease virus, 4 is sheep pox virus, 5 is foot-and-mouth disease virus, 6 is the positive standard plasmid control, 7 is bovine epidemic diarrhea virus, 8 is the blank control NC, and M is Maker.

[0039] Figure 5 To visualize the sensitivity test results of LAMP; 1 is 10 7 , 2 is 10 6 , 3 is 10 5 , 4 is 10 4 , 5 is 10 3 , 6 is 10 2 , 7 is 10 1 , 8 is 10 0 , 9 is positive control, 10 is NC;

[0040] Figure 6 is the electrophoresis analysis result of visualizing LAMP sensitivity detection; where 1 is 10 7 , 2 is 10 6 , 3 is 10 5 , 4 is 10 4 , 5 is 10 3 , 6 is 10 2 , 7 is 10 1 , 8 is 10 0 , 9 is positive control, 10 is NC, and M is Maker;

[0041] Figure 7 This is the result of visualizing LAMP detection of some clinical samples; 1 is the positive control, 2 is NC, and 3-16 are samples No. 6 to No. 19 respectively;

[0042] Figure 8 The results of WOAH visualized LAMP detection of some clinical samples; 1 is the positive control, 2 is NC, and 3-16 are samples 6-19 respectively;

[0043] Fig. 9 Optimize the results for reaction temperature. DETAILED DESCRIPTION

[0044] In order to better understand the present invention, the content of the present invention is further explained in conjunction with the following examples, but the content of the present invention is not limited to the following examples. The materials, reagents, etc. used in the examples and test examples of the present invention, unless otherwise specified, can be obtained from commercial channels; the methods used in the examples and test examples of the present invention, unless otherwise specified, are conventional methods.

[0045] Example 1

[0046] 1.1 Primer design

[0047] The BLVD virus sequences published in NCBI were compared using MEGA5.0 software, and highly conserved regions of BLVD virus were selected. Specific BLVD virus LAMP primers were designed using online biological software Primer Explorer V4, and the GC content, Tm value, and 3' end dG size of the primers were compared to design 12 sets of primers (Tables 1 and 2). Primer design was completed by Beijing Mylabo Medical Technology Co., Ltd., and primers were synthesized by Shanghai Jierui Bioengineering Co., Ltd.

[0048] Table 1 Primer sequences

[0049]

[0050]

[0051] Table 2 Primer combinations

[0052]

[0053] 1.2 Construction of standard plasmid

[0054] The standard plasmid pUC57-Gene1 containing the ORF of the poxvirus_F11 superfamily protein encoding gene (genomic sequence such as Seq_14) was completed by General Biotechnology (Anhui) Co., Ltd.

[0055] 1.3 Primer screening of pUC57-Gene1

[0056] The pUC57-Gene1 standard plasmid was used as a template (DNA concentration was 1×10 5 copies / μL) to screen the best primers for visualized LAMP.

[0057] The screening reaction system was as follows: 10 μL of LAMP Mix buffer (Beijing Mylabo Medical Technology Co., Ltd.), 1 μL each of 1.5 μmol / L 1-FIP3 / 1-BIP3, 0.25 μmol / L 1-F3 / 1-B3, and 0.15 μmol / L 1-Floop23 / 1-Bloop3, 2 μL of DNA template, 1 μL of Bst DNA polymerase (NEB), 1 μL of 20× Eva green, and 1 μL of ddH 2 HO 5 μL, total volume 20 μL.

[0058] The screening reaction procedure was as follows: 65°C, 1 min per cycle, 60 cycles, a total of 60 min, collecting fluorescence signals, making melting curves at 65°C-95°C for 30 s, and terminating the reaction at 80°C for 5 min.

[0059] The LAMP primers were screened based on the Tp value (the time required to reach the fluorescence threshold, which was automatically set by the instrument in this experiment), the "S"-shaped amplification curve, the curve peak height, and the melting curve peak specificity. Figure 1 As shown. Figure 1 It can be seen that when the reaction was carried out to 11min (Tp), the second and ninth sets of primer DNA began to amplify; when the Tp value was 12min, the seventh set of primers began to amplify; when the Tp value was 15min, the fourth set of primers began to amplify; these curves all showed an "S" shape, and the melting curve peak was single and specific. Further comparison showed that the ninth set of primers took the shortest time to reach the threshold (Tp was 11min), and the peak of the "S" type amplification curve was higher. Therefore, the ninth set of primers was selected as the primer set for the subsequent development of visualized LAMP, and the reaction temperature was optimized.

[0060] 1.4 Optimization of reaction temperature

[0061] The optimal reaction temperature was determined based on primer screening. The reaction temperatures were set to 8 gradient temperatures, 59°C, 59.5°C, 60.4°C, 61.8°C, 63.5°C, 64.9°C, 65.6°C, and 66°C. The Tp values, "S"-shaped amplification curves, peak heights, and peak shapes of melting curves at different temperatures were comprehensively analyzed to determine the optimal reaction temperature. Fig. 9 It can be seen that the amplification under all temperature conditions presents an "S"-shaped amplification curve, but when the reaction temperature is 64.9℃, the Tp value is low, indicating that the reaction speed is fast and it takes a short time to reach the threshold; and the peak of the curve is higher, and the relative amount of amplified product is larger. Therefore, after comprehensive analysis, the optimal reaction temperature is set at 65℃.

[0062] 1.5 Dye screening

[0063] The reaction system was as follows: 10 μL of LAMP Mix buffer, 1 μL each of 1.5 μmol / L 1-FIP3 / 1-BIP3, 0.25 μmol / L 1-F3 / 1-B3, and 0.15 μmol / L 1-Floop23 / 1-Bloop3, 2 μL of DNA template, 1 μL of Bst DNA polymerase, and ddH 2 Make up to 20 μL with HO.

[0064] (1) Calcein: Add 1 μL of calcein to the above reaction system and react at 60°C to 68°C for 30 min to 60 min. The reaction results are as follows: Figure 2 As shown in A, the positive tube is grass green and the negative tube is orange-yellow.

[0065] (2) Cresol red: Add cresol red to the LAMP Mix buffer (final concentration in the buffer is 0.06 mmol / L) and react at 60°C to 68°C for 40 min to 60 min. Figure 2 As shown in B, the positive tube is yellow and the negative tube is purple-red.

[0066] (3) Neutral red: Add neutral red to the LAMP Mix buffer (final concentration in the buffer is 0.1 mmol / L) and react at 60°C to 68°C for 40 min to 60 min. Figure 2 As shown in C, the positive tube is pink and the negative tube is orange.

[0067] (4) Hydroxynaphthol blue: Add 4.2 μL of hydroxynaphthol blue to the reaction system and react at 60°C to 68°C for 30 min to 60 min. The reaction results are as follows: Figure 2 As shown in D, the positive tube is blue and the negative tube is purple.

[0068] Depend on Figure 2 It can be seen that the four dyes can distinguish between positive and negative samples, but the colors of negative and positive samples of calcein and hydroxynaphthol blue are closer; the negative samples of neutral red are orange-yellow, and when the concentration of the detected nucleic acid is low, the pink color of the positive samples becomes lighter, which can easily cause uncertainty in the results; and the positive samples of cresol red are yellow, and the negative samples are purple-red, with a greater color difference, which is more suitable for visual LAMP.

[0069] In summary, the present invention uses the ninth set of primers as visualized LAMP primers, the dye is cresol red, and the optimal reaction temperature is set to 65°C.

[0070] The final confirmation detection kit of the present invention comprises:

[0071] (1) Reaction premix: The molar ratio of LAMP detection primer set is outer primer (1-F3 and 1-B3): inner primer (1-FIP3 and 1-BIP3): loop primer (1-Floop23 and 1-Bloop) = 5:30:3, and the final concentration of cresol red is 0.06 mmol / L;

[0072] (2) Nucleic acid crude extract: lysis solution: proteinase K = (20-25): (1-2).

[0073] Non-diagnostic and non-therapeutic testing methods:

[0074] (1) Add the crude nucleic acid extract to the sample to be tested, mix well, react for 5 to 10 minutes, centrifuge at 5000 to 6000 rpm for 8 to 10 minutes, and take the supernatant to obtain crude DNA;

[0075] (2) Add 1 μL to 2 μL of crude DNA to the reaction premix and incubate at 60°C to 68°C for 30 min to 60 min.

[0076] Example 2 Specificity Detection

[0077] The specificity of visual LAMP in detecting bovine lumpy skin disease virus was evaluated by detecting five viruses: bovine infectious rhinotracheitis virus, goatpox virus, sheeppox virus, foot-and-mouth disease virus, and bovine epidemic diarrhea.

[0078] Steps:

[0079] (1) Add crude nucleic acid extract (lysis buffer: proteinase K = 25:1) to the five virus samples respectively, mix well, react for 8 min, centrifuge at 5000 rpm for 8 min, and collect the supernatant to obtain crude DNA;

[0080] (2) The reaction system was as follows: 10 μL of LAMP Mix buffer, 1 μL each of 1.5 μmol / L 1-FIP3 / 1-BIP3, 0.25 μmol / L 1-F3 / 1-B3, and 0.15 μmol / L 1-Floop23 / 1-Bloop3, 2 μL of DNA template, 1 μL of Bst DNA polymerase, and ddHO. 2 2. 4% dHO 1 μL.

[0081] (3) The reaction was carried out in a thermostatic metal bath at 65°C for 60 min.

[0082] The results are as follows Figure 3 As shown. Figure 3 It can be seen that the bovine nodular skin disease virus positive tube and the positive control tube are yellow, while the other five virus tubes and the negative control tube are purple-red. Therefore, the visual LAMP method for detecting bovine nodular skin disease virus of the present invention has no specific amplification for bovine infectious rhinotracheitis virus, goat pox virus, sheep pox, foot-and-mouth disease virus, bovine epidemic diarrhea virus and negative control, except for the specific amplification of LSDV. In other words, the visual LAMP primer of the present invention is highly specific to LSDV and does not cross-react with the above five common viruses.

[0083] The LAMP amplification products were analyzed by 1.5% agarose gel electrophoresis. Figure 4 As shown. Figure 4It can be seen that only the electrophoretic bands of the amplified product of bovine nodular dermatitis virus and the positive control plasmid showed a step-diffuse distribution, and the amplified products of the other viruses were not amplified, which was consistent with the detection results of the visual LAMP constant temperature amplification instrument.

[0084] Example 3 Sensitivity Detection

[0085] Use the plasmid in 1.2 to dilute to 10 7 copies / μL, 10 6 copies / μL, 10 5 copies / μL, 10 4 copies / μL, 10 3 copies / μL, 10 2 copies / μL, 10 1 copies / μL, 10 0 The operation steps in Example 2 were used to detect plasmids of different concentrations.

[0086] Test results such as Figure 5 As shown. Figure 5 It can be seen that the minimum detectable value of visual LAMP is 10 2 copies / μL.

[0087] The LAMP amplification products were analyzed by 1.5% agarose gel electrophoresis. Figure 6 As shown. Figure 6 It can be seen that 10 7 copies / μL~10 2 The electrophoretic bands of the amplified products were distributed in a step-wise manner. 1 copies / μL and 10 0 The amplification products of copies / μL were not amplified, and the results were consistent with the detection results of the visual LAMP naked eye observation method in the constant temperature amplification instrument.

[0088] Test Example 1

[0089] The extracted nucleic acid was detected and analyzed using the qPCR method for capripoxvirus nucleic acid detection recommended in the "WOAH Terrestrial Animal Diagnostic Manual (2018 Edition)", the visualized LAMP detection method established by the present invention, the visualized LAMP method for capripoxvirus nucleic acid detection recommended in the "WOAH Terrestrial Animal Diagnostic Manual (2018 Edition)", and the conventional PCR method for bovine nodular dermatitis virus nucleic acid detection published in GB / T39602-2020. The clinical samples used for analysis and evaluation came from different cattle farms and laboratories in Hebei Province in 2022-2023, totaling 100 samples, including 5 sera (samples 1-5), 20 blood (samples 6-25), 20 nasal swabs (samples 26-45), 8 throat swabs (samples 46-53), 2 skin scabs (samples 54-55), 20 cytotoxins (samples 56-75), 4 spleens (samples 76-79), 9 small intestines (samples 80-88), 8 kidneys (samples 89-96), and 4 livers (samples 97-100).

[0090] The visualized LAMP detection method established in the present invention was performed using the operating steps in Example 2, and the other three methods were performed using their respective standards.

[0091] The test results are shown in Table 3. According to Table 3, the detection rate of the qPCR method for nucleic acid detection of the genus Sheeppoxvirus recommended by the "WOAH Land Animal Diagnostic Manual (2018 Edition)" is 100%, that is, 30 positive samples and 70 negative samples, and this is used as the detection standard; the positive detection compliance rate of the visualized LAMP method established by the present invention is 96.7%; the positive detection compliance rate of the visualized LAMP method for nucleic acid detection of sheeppoxvirus published by Amaresh Das recommended by the "WOAH Land Animal Diagnostic Manual (2018 Edition)" is 93.3%, and the positive compliance rate of the national standard conventional PCR is 80%. The visualization LAMP method established by the present invention has a higher detection rate than the visualization LAMP method recommended by WOAH and the national standard conventional PCR method. The results of detecting some clinical samples by the visualization LAMP method established by the present invention and the visualization LAMP method recommended by WOAH are shown as follows: Figure 7 , Figure 8 shown.

[0092] Table 3 Test results of four detection methods

[0093]

[0094] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A visualized LAMP detection primer for bovine nodular skin disease virus, characterized in that: The visualized LAMP detection primers include an outer primer pair, an inner primer pair and a loop primer pair; Among them, the outer primer pair includes 1-F3 and 1-B3, the specific nucleotide sequence of 1-F3 is shown in Seq_1, and the specific nucleotide sequence of 1-B3 is shown in Seq_2; the inner primer pair includes 1-FIP3 and 1-BIP3, the specific nucleotide sequence of 1-FIP3 is shown in Seq_3, and the specific nucleotide sequence of 1-BIP3 is shown in Seq_4; the loop primer pair includes 1-Floop23 and 1-Bloop; the specific nucleotide sequence of 1-Floop23 is shown in Seq_5, and the specific nucleotide sequence of 1-Bloop is shown in Seq_6.

2. A visual LAMP detection kit for bovine nodular skin disease virus, characterized in that: The kit comprises a reaction premix and a crude nucleic acid extract; wherein the reaction premix comprises the visualized LAMP detection primer of claim 1.

3. The visual LAMP detection kit according to claim 2, characterized in that: The reaction premix also includes ddH2O, Bst DNA enzyme, LAMP Mix buffer and dye.

4. The visual LAMP detection kit according to claim 2, characterized in that: The molar ratio of the outer primer pair, the inner primer pair and the loop primer pair in the LAMP detection primers is 5:30:

3.

5. The visual LAMP detection kit according to claim 3, characterized in that: The dye is cresol red, and the dye is dissolved in LAMP Mix buffer.

6. The visual LAMP detection kit according to claim 5, characterized in that: The final concentration of the dye in the LAMP Mix buffer is 0.055 mmol / L to 0.065 mmol / L.

7. The visual LAMP detection kit according to claim 6, characterized in that: The crude nucleic acid extract comprises a lysis solution and proteinase K.

8. A visual LAMP detection method for detecting bovine nodular skin disease virus for non-diagnostic and therapeutic purposes, characterized in that: The following steps are involved: Add the crude nucleic acid extract to the sample to be tested, mix well and react for 5-10 minutes, centrifuge and take the supernatant to obtain crude DNA; Add the crude DNA to the reaction premix as described in claim 5, and react at a constant temperature of 60°C to 68°C for 30min to 60min; if the color of the liquid in the reaction tube turns yellow after the constant temperature reaction, it is judged as positive; if the color of the liquid in the reaction tube does not change after the constant temperature reaction and remains purple-red, it is judged as negative.

Images