A nucleic acid combination, kit and detection method for detecting schefflera virus A in Codonopsis pilosula

Abstract

The present invention discloses a nucleic acid combination, a kit and a detection method for detecting the A virus of Codonopsis pilosula in Codonopsis pilosula, and relates to the technical field of detection of pathogens of Chinese medicinal materials. The present invention provides a LAMP nucleic acid combination for the detection of Codonopsis pilosula AVA virus, which can be used for RT‑qLAMP, PAE‑RT‑qLAMP or PAE‑RT‑LAMP amplification reactions, and LAMP amplification recognizes 7 sequences of the AVA CP gene through 5 primers including F3, B3, FIP, BIP and LF, with the technical advantages of strong specificity and high accuracy. The nucleic acid combination and the kit provided by the present invention can be amplified on quantitative instruments such as real-time fluorescence quantitative PCR thermal cyclers, and can also be detected in a constant temperature device, and the test results can be directly judged by the naked eye or automatically analyzed by software, which provides technical support for the occurrence, spread, interspecies transmission, and biosafety and comprehensive prevention and control of Codonopsis pilosula virus pathogens.

Description

Technical Field

[0001] The present invention relates to the technical field of detection of pathogens in traditional Chinese medicines, and in particular to a nucleic acid combination, a kit and a detection method for detecting schefflera virus A in codonopsis pilosula. Background Art

[0002] Codonopsis pilosula is the dried root of Codonopsis pilosida (Franch.) Nannf., C.pilosula Nannf. var.modesta (Nannf.) LTShen or C.tangshen Oliv. of Campanulaceae. It is a commonly used bulk medicinal material with a long history of application in my country. Codonopsis pilosula is sweet and mild in nature. It has the effects of tonifying the middle and replenishing qi, strengthening the spleen and lungs. It is used to treat spleen and lung deficiency, shortness of breath and palpitations, poor appetite and loose stools, asthenia and cough, and internal heat and thirst. It is often used as a substitute for ginseng, commonly known as "little ginseng". It is one of the earliest famous medicinal materials planted and exported in China. In recent years, with the continuous deepening and improvement of the research on chemical composition and mechanism of action, the medicinal value of Codonopsis pilosula has been further developed, and its economic value has also been significantly improved.

[0003] Gansu Province is one of the important production areas of Chinese medicinal materials in my country. It is rich in germplasm resources and has a long history of planting authentic medicinal materials such as Codonopsis pilosula. In the past five years, the average planting area has accounted for more than 90% of the country. With the continuous expansion of the scale and area of ​​artificial planting and continuous planting, the source of Codonopsis pilosula has degraded, the quality of seeds has declined, and diseases in the place of origin have occurred frequently, especially the diseases caused by continuous cropping obstacles, which continue to occur and become more serious. The yield of medicinal materials has decreased and the quality has declined, causing serious economic losses to farmers. It has become a bottleneck restricting the current high-quality development of Chinese medicinal materials and rural revitalization.

[0004] At present, the research on diseases of Codonopsis pilosula mainly focuses on fungal and bacterial pathogens such as root rot and soft rot, and viral pathogens are rarely reported. In fact, viral disease is also a very serious plant disease, which is difficult to prevent and control. Once infected, the plant will be stunted, and the growth, photosynthetic physiological and biochemical processes and metabolic processes will be inhibited. The plant's species will decline, its resistance will weaken, and its immunity will be reduced, making it more susceptible to bacteria, fungi and other pathogens. In severe cases, it may even fail to produce a harvest.

[0005] The inventor team conducted a systematic investigation, detection and analysis of viral diseases in the main codonopsis production areas of Weiyuan County, Zhang County, Min County, Lintao County, Yongdeng County and Yuzhong County in Gansu Province from 2021 to 2023. Among the 61 field samples showing suspected viral disease symptoms such as yellowing, mottled and mosaic in different geographical production areas, 41 samples were detected with viral infection, with a positive rate of 67.2%. In some samples, Anemone nepovirus A (AVA) was identified using small RNA sequencing (sRNA-seq), which is the first time that AVA virus pathogen infection has been found in codonopsis. Through reverse transcription polymerase chain reaction (RT-PCR) analysis of field positive samples and observation of plant morphology and growth, it was found that after Codonopsis pilosula was infected with AVA virus, symptoms such as mosaic, mottled, yellowing and necrotic spots appeared on the leaves, and the plants became dwarfed. It is speculated that AVA virus is a harmful pathogen of Codonopsis pilosula, which can inhibit its growth, development, metabolism and quality formation. It is urgent to develop corresponding detection and prevention technologies.

[0006] At present, there are no reports on the Codonopsis virus pathogen and its gene sequence, and it is impossible to obtain specific antibodies and primer sequences for nucleic acid amplification. Commonly used immunological and molecular detection techniques for detection and diagnosis of known pathogens, such as enzyme-linked immunosorbent assay (ELISA) and RT-PCR, cannot be applied to the Codonopsis virus pathogen.

[0007] In addition, common technologies such as ELISA and immune capture IC-RT-PCR rely on specific antibodies, which have the problem of high detection costs and require experienced personnel with professional operating skills to complete. Therefore, their scope of use is subject to certain limitations and cannot meet the actual needs of grassroots and county agricultural technology promotion departments to popularize disease detection, diagnosis and prevention.

[0008] In view of this, the present invention is proposed. Summary of the invention

[0009] The object of the present invention is to provide a nucleic acid combination, a kit and a detection method for detecting Schefflera foetida A virus in Codonopsis pilosula to solve the above technical problems.

[0010] The existing ELISA and its derivative technologies rely on antibodies and are prone to false negative results due to limited sensitivity. RT-PCR and its derivative nucleic acid amplification technologies require the extraction of high-quality RNA, which makes detection difficult and time-consuming. They also require professional technicians with laboratory work experience to operate, and their promotion and application are subject to certain restrictions. There is an urgent need to develop simple, sensitive and rapid technologies and methods for the detection of new pathogens.

[0011] The inventors have improved the physical adsorption enrichment (PAE) method. First, the virus particles in the sample to be tested are enriched, and then the enriched virus particles are combined with the RT-qLAMP technology for amplification detection. The whole process does not rely on antibodies, and there is no need to extract nucleic acids, which can achieve the purpose of rapid, simple and quantitative detection of pathogens. The specific method is to first concentrate and purify the virus particles in the sample to be tested by a pretreatment device to increase the viral load per unit volume, and then physically adsorb and enrich the virus particles in the sample to be tested by the wall of the reaction container (such as a PCR tube), and then use the enriched virus particles and the selected target gene-specific reverse primers to reverse transcribe RT to synthesize the first chain of cDNA, and then use real-time fluorescent quantitative DNA loop-mediated isothermal LAMP technology (Quantitative Loop-mediated isothermal amplification, qLAMP) for nucleic acid amplification. The amplification product is monitored in real time according to the quantitative peak time to accurately judge the virus infection in the sample. In this way, the PAE-RT-qLAMP technology and method for specific detection of the new pathogen of Codonopsis pilosula, Goosefoot A virus, which does not require antibodies and nucleic acid extraction, has been successfully established. In addition, qPCR and PCR methods and kits were developed for detecting the emerging pathogen of Codonopsis pilosula, Schefflera a virus.

[0012] The present invention is achieved in that:

[0013] Goosefoot A virus is an unclassified virus of the genus Nepovirus, belonging to the family Secoviridae, subfamily Comovirinae. Nepoviruses are widely distributed in temperate regions around the world, and many members of this genus have a wide range of natural and experimental hosts, including annual and perennial herbaceous and woody plants. One-third of the nematode-transmitted polyhedra viruses are persistently transmitted by nematodes of the genera Xiphinema and Heterorhinus in the soil. At present, the vectors of many types of nematode-transmitted polyhedra viruses are still unknown, but all viruses can be transmitted by mechanical inoculation. Among the nematode-transmitted polyhedra viruses, many viruses can be transmitted over long distances through seeds, making them an important type of seed-transmitted virus in plants.

[0014] In 2023-2024, the inventor conducted germination culture and virus RT-PCR testing on commercial seeds of Codonopsis pilosula produced in different geographical regions across the country. The results showed that 12 out of 19 batches of seeds germinated, and among the 12 batches of germinated samples, 6 batches of samples were detected with AVA virus, and the seed AVA infection rate reached 50.0%. It is speculated that AVA may be a seed-transmitted virus of Codonopsis pilosula, which may be transmitted and spread over long distances through Codonopsis pilosula seeds, posing a high risk of harm and should be highly valued and concerned by seed quality supervision and testing departments.

[0015] AVA virus members have positive-sense single-stranded bipartite RNA genomes, consisting of two linear positive-sense RNAs, RNA1 and RNA2. Each RNA of the genus Polyhedravirus encodes a polyprotein, which is processed to produce functional gene products. The protein encoded by RNA1 is related to viral replication, while the protein encoded by RNA2 is the coat protein (CP) and intercellular movement protein. RNA2 only produces one open reading frame (ORF), which encodes a polyprotein precursor, which is cleaved by the protease produced by RNA1 to form coat protein, movement protein and N-terminal protein at the N-terminus. The coat protein CP of the genus Polyhedravirus is composed of a single polypeptide, ranging in size from 52 to 60 kDa.

[0016] In the first aspect, the present invention provides a LAMP nucleic acid combination for detecting Anemone nepovirus A (AVA) in Codonopsis pilosula, which includes: a reverse transcription primer as shown in SEQ ID NO.1, a LAMP forward outer primer F3 as shown in SEQ ID NO.2, a LAMP reverse outer primer B3 as shown in SEQ ID NO.3, a LAMP forward inner primer FIP as shown in SEQ ID NO.4, a LAMP reverse inner primer BIP as shown in SEQ ID NO.5 and a LAMP forward loop primer LF as shown in SEQ ID NO.6.

[0017] The nucleotide sequence of the nucleic acid combination is as follows:

[0018] SEQ ID NO.1:

[0019] Reverse transcription primer: 5′-GTAGGACCATACAACTTCAGGC-3′;

[0020] SEQ ID NO.2: F3: 5'-GTGCGCATACTATGTATGGT-3';

[0021] SEQ ID NO.3: B3: 5'-ACAACTTCAGGCCTGGTT-3';

[0022] SEQ ID NO.4: FIP:

[0023] 5'-TCACCCGCAACATATTGGAAGACGAGGACCTGTTCACTCTG-3';

[0024] SEQ ID NO.5: BIP:

[0025] 5'-CACCTCTGGTGATTCTGGCTTTGCCCTTGCTTGAGAGATG-3';

[0026] SEQ ID NO. 6: LF: 5'-TGTAGCGGCTGGGTAACCA-3'.

[0027] After a long period of extensive primer screening and optimization, the inventors finally obtained the above primer combination, which can detect the Codonopsis pilosula AVA virus pathogen in the target sample with high specificity and sensitivity.

[0028] In a second aspect, the present invention provides a nucleic acid combination for detecting schefflera virus A in Codonopsis pilosula, comprising: a reverse transcription primer as shown in SEQ ID NO.1, an upstream primer as shown in SEQ ID NO.7, and a downstream primer as shown in SEQ ID NO.8.

[0029] The upstream and downstream primers of the nucleic acid combination are qPCR detection primers. In other embodiments, the upstream and downstream primers can also be used as conventional PCR detection primers.

[0030] SEQ ID NO.7: GTTCCTCGTGTTCTTTGCGTTGAC;

[0031] SEQ ID NO. 8: GATAACCGGGCAGGGAATGTAGC.

[0032] In a third aspect, the present invention provides a nucleic acid combination for detecting the schefflera virus A in Codonopsis pilosula, comprising: a reverse transcription primer as shown in SEQ ID NO. 1, an upstream primer as shown in SEQ ID NO. 9, and a downstream primer as shown in SEQ ID NO. 10. The primers can be used as conventional PCR detection primers.

[0033] SEQ ID NO.9: GAGGTATTCTCGCTTGCGGA.

[0034] SEQ ID NO. 10: ATTCGACCTCCCCGGACATA.

[0035] In a fourth aspect, the present invention provides a kit for detecting the Herba Lycopodii virus A in Codonopsis pilosula, comprising at least one of the following nucleic acid combinations:

[0036] Detection of LAMP nucleic acid combination of Schefflera chinensis virus A in Codonopsis pilosula, detection of nucleic acid combination of Schefflera chinensis virus A in Codonopsis pilosula.

[0037] When the kit includes the above three nucleic acid combinations at the same time, the kit can simultaneously have the functions of LAMP amplification, qPCR detection and PCR detection; when the kit only includes the LAMP nucleic acid combination for detecting Schefflera a virus in Codonopsis pilosula, the kit has the function of LAMP amplification (including RT-qLAMP and RT-LAMP amplification); when the kit only includes the nucleic acid combination for qPCR detection of Schefflera a virus in Codonopsis pilosula, the kit has the function of RT-qPCR detection; when the kit only includes the nucleic acid combination for PCR detection of Schefflera a virus in Codonopsis pilosula, the kit has the function of RT-PCR detection.

[0038] In a preferred embodiment of the present invention, the kit further comprises: a reverse transcription reagent, which comprises a reverse transcriptase, a reverse transcriptase buffer, an RNase inhibitor, a dNTP mixture and water.

[0039] The reverse transcriptase includes but is not limited to AMV reverse transcriptase or M-MLV reverse transcriptase and mutants and conjugates of the above reverse transcriptases.

[0040] The RNase inhibitor can be DEPC, guanidine isothiocyanate or vanadyl ribonucleoside complex.

[0041] In a preferred embodiment of the present invention, when a kit is used for LAMP amplification, the kit further comprises: a LAMP amplification reagent, and the LAMP amplification reagent comprises: dNTPs, ThermoPol reaction buffer, Mg ions, DNA polymerase, LAMP fluorescent dye and water.

[0042] The DNA polymerase is for example selected from Bst DNA polymerase. In addition, in other embodiments, the type of the DNA polymerase can be selected as needed.

[0043] LAMP fluorescent dyes include but are not limited to SYBR series dyes and Dye. SYBR series dyes include but are not limited to: SYBRGreen I, SYBR Green II, SYBR Gold and SYBR Safe.

[0044] In a preferred embodiment of the present invention, when a kit is used for a fluorescent quantitative qPCR reaction, the kit further comprises: a qPCR fluorescent dye and a fluorescent quantitative PCR reaction premix. The qPCR fluorescent dye includes but is not limited to SYBR series dyes, ROX, and EvaGreen. The SYBR series dyes include but are not limited to: SYBR Green I, SYBR Green II, SYBR Gold, and SYBR Safe.

[0045] In a preferred embodiment of the present invention, when a kit is used for PCR reaction, the kit further comprises: a PCR reaction premix;

[0046] In a preferred embodiment of the present invention, the PCR reaction premix further comprises: DNA polymerase, PCR buffer, dNTPs and water.

[0047] In a preferred embodiment of the present invention, the kit further comprises: a positive control and a negative control. The positive control is a positive standard of Codonopsis pilosula AVA virus, specifically the CP gene of Ligusticum chuanxiong A virus. The negative control is water.

[0048] The sequence of the positive standard of Codonopsis pilosula AVA CP gene is as follows:

[0049]

[0050] In a preferred embodiment of the present invention, the kit further comprises: a physical adsorption enrichment device for tissue separation of the sample to be tested, the physical adsorption enrichment device comprising a filter and an ultrafiltration tube; the filter is provided with a hydrophilic filter membrane.

[0051] When used, the tissue (root, stem, leaf or seed) of Codonopsis pilosula is first ground in PBS buffer, and then the grinding liquid is centrifuged to take the supernatant as the crude tissue extract; the crude tissue extract is then filtered to remove cell debris and other large particle aggregates to achieve the purpose of clarification; and then further concentrated by ultrafiltration tube to increase the viral load per unit volume to obtain the diseased tissue concentrate; after incubating the diseased tissue concentrate, the diseased tissue concentrate is discarded, and after washing, the sample to be tested is obtained. In a preferred embodiment of the present invention, the washed sample to be tested is initially denatured and then used for reverse transcription reaction.

[0052] The physical adsorption enrichment (PAE)-RT-qLAMP kit provided by the present invention combines the physical adsorption enrichment PAE of target virus particles with the nucleic acid RT-qLAMP method, does not rely on virus-specific antibodies, does not need to extract nucleic acid RNA, has the technical advantages of simple operation, strong specificity, high sensitivity, simple operation and low cost, and the detection results can be analyzed by computer and analysis software in an integrated manner without the need for nucleic acid gel electrophoresis, thus saving detection time, improving detection efficiency and improving detection sensitivity. The kit is suitable for rapid screening and real-time monitoring of pathogens, and provides technical support for quality monitoring of Codonopsis pilosula seeds, tissue culture detoxification of viral pathogens, field management and comprehensive prevention and control.

[0053] In a fifth aspect, the present invention also provides a method for detecting schefflera virus A in Codonopsis pilosula, comprising the following steps:

[0054] The sample to be tested is subjected to reverse transcription reaction using the above-mentioned LAMP nucleic acid combination or the reverse transcription primer in the above-mentioned kit to obtain cDNA, and then the cDNA is subjected to LAMP reaction using the above-mentioned LAMP nucleic acid combination under the following reaction conditions: 58-66°C, 30-100min; 80°C, 5-10min.

[0055] Under the above reaction conditions, efficient amplification of the Codonopsis pilosula AVA CP gene can be achieved. The conditions of the LAMP reaction are, for example: 58°C, 59°C, 60°C, 61°C, 62°C, 62.5°C, 63°C, 64°C, 65°C or 66°C for 30-100 min; 80°C for 5-10 min.

[0056] During the LAMP reaction, the amplification time is any point value among 30-60min, 40-80min, 50-90min, 60-80min, and 70-100min.

[0057] In a preferred embodiment of the present invention, the LAMP reaction is carried out under the following conditions: 60-62°C, 30-100 min; 80°C, 5-10 min.

[0058] The LAMP reaction can be performed using equipment such as a real-time fluorescence quantitative PCR thermal cycler for qLAMP amplification. When this equipment is not available, a water bath, a constant temperature incubator, a common PCR thermal cycler or other constant temperature device can also be used to perform a common LAMP display reaction.

[0059] In a preferred embodiment of the present invention, the LAMP reaction system includes: LAMP reverse outer primer B3 with a final concentration of 0.2-0.4 μM, LAMP forward outer primer F3 with a final concentration of 0.2-0.4 μM, LAMP forward inner primer FIP with a final concentration of 1.5-1.7 μM, LAMP reverse inner primer BIP with a final concentration of 1.5-1.7 μM, and LAMP forward loop primer LF with a final concentration of 0.3-0.5 μM;

[0060] In a preferred embodiment of the present invention, the LAMP reaction system includes: Mg ions with a final concentration of 8.0-12.5 mM, a dNTP mixture with a final concentration of 1.4-2.8 mM, and a DNA polymerase with a final concentration of 0.32-0.64 U;

[0061] In a preferred embodiment of the present invention, before the reverse transcription reaction is carried out, the preparation of the sample to be tested is also included, which includes: using the tissue extract solution to perform rough sample extraction on the Codonopsis pilosula material to be tested, filtering through a filter, transferring the collected filtrate to an ultrafiltration tube for concentration; and then incubating and washing to obtain the product.

[0062] In a preferred embodiment of the present invention, the washed sample is subjected to initial denaturation and then used for reverse transcription reaction. The conditions for initial denaturation are: 85-95° C., 1-5 min; ice bath.

[0063] The PAE-qRT-LAMP kit and detection method overcome the defects of the existing technology that pathogen detection either requires the preparation or purchase of expensive antibodies in advance, or requires the extraction of high-quality nucleic acids for detection, which is costly, time-consuming and labor-intensive, and the detection personnel need strict training to complete the detection. Specifically, the crude extract of the sample to be tested is first filtered and concentrated using a filtering and concentrating device to purify the virus, and the virus particles are enriched by physical adsorption so that the virus particles are physically adsorbed on the wall of the reaction PCR tube. The first chain of cDNA is synthesized by reverse transcription RT reaction using the selected AVA gene-specific primers, and then qLAMP amplification is performed using the high sensitivity technical advantage of fluorescence quantification. The amplification product is directly analyzed by computer and analysis software. The entire detection process does not rely on virus-specific antibodies, and does not require cumbersome RNA extraction, which reduces the threshold and difficulty of detection. qLAMP amplification does not require the addition of any reagents, which reduces the risk of contamination and increases the application value, and has a very broad prospect.

[0064] When using LAMP nucleic acid combination to detect Schefflera virus A in Codonopsis pilosula, it can be qualitative or quantitative.

[0065] If an obvious fluorescent signal is detected in the sample reaction tube, it means positive, indicating that the sample contains Codonopsis AVA virus;

[0066] If no obvious fluorescent signal is detected in the sample reaction tube, it means negative, indicating that the sample does not contain Codonopsis pilosula AVA virus.

[0067] Optionally, if the content of AVA virus in the positive sample is to be determined, the number of copies of AVA virus in the positive sample needs to be quantitatively obtained based on the amplification Ct value of the positive sample and the standard curve;

[0068] Optionally, for a common LAMP color development reaction, after the above LAMP reaction is completed, the reaction tube is centrifuged or gently shaken without opening the cover to mix the SYBR Green I fluorescent dye on the inner wall of the reaction tube cover with the LAMP amplification product, and the tube is inverted upside down to mix, and the color change of the mixed solution in the reaction tube is observed with the naked eye.

[0069] If the color of the mixed solution changes to green, it means that the SYBR Green I dye binds to the double-stranded DNA, which is a positive reaction, indicating that the sample under test contains Codonopsis AVA virus;

[0070] If the color of the mixed solution is orange, it is a negative reaction, indicating that the sample does not contain Codonopsis pilosula AVA virus.

[0071] In a sixth aspect, the present invention further provides a method for detecting schefflera virus A in Codonopsis pilosula, comprising the following steps:

[0072] The reverse transcription primer in the nucleic acid combination or the reverse transcription primer in the kit is used to perform reverse transcription reaction on the sample to be tested to obtain cDNA, and then the upstream primer and downstream primer in the nucleic acid combination are used to perform qPCR amplification on the cDNA.

[0073] In a preferred embodiment of the present invention, the qPCR reaction conditions are: 95°C, 30s; 95°C 5s, 60°C 34s, and 30-40 cycles of amplification.

[0074] After the fluorescence quantitative qPCR reaction is completed, observe the fluorescence signal detected on the real-time fluorescence PCR instrument. If an obvious fluorescence signal is detected in the sample reaction tube, it means positive, indicating that the sample contains Codonopsis pilosula AVA virus;

[0075] If no obvious fluorescent signal is detected in the sample reaction tube, it means negative, indicating that the sample does not contain Codonopsis pilosula AVA virus.

[0076] When performing quantitative analysis, it is necessary to quantify the copy number of AVA virus in the positive sample based on the amplification Ct value of the positive sample and the standard curve.

[0077] In a preferred embodiment of the present invention, the qPCR reaction system includes an upstream primer with a final concentration of 0.2-0.7 μM and a downstream primer with a final concentration of 0.2-0.7 μM.

[0078] In a seventh aspect, the present invention further provides a method for detecting schefflera virus A in Codonopsis pilosula, comprising the following steps:

[0079] The reverse transcription primer in the nucleic acid combination or the reverse transcription primer in the kit is used to perform reverse transcription reaction on the sample to be tested to obtain cDNA, and then the cDNA is amplified by PCR using the upstream primer and downstream primer in the nucleic acid combination.

[0080] After the PCR amplification reaction is completed, the amplified product is loaded onto a sample and subjected to gel electrophoresis. The presence of the Herba Lycopodii virus A in Codonopsis pilosula is determined based on the size of the product band and the presence or absence of the band.

[0081] In a preferred embodiment of the present invention, the PCR reaction conditions are: 95°C, 3-5min; 95°C 5s, 54°C 30s, 70-72°C 45s, and 30-40 cycles of amplification;

[0082] In a preferred embodiment of the present invention, the PCR reaction system includes 0.2-1.0 μM upstream primer and 0.2-1.0 μM downstream primer.

[0083] The present invention has the following beneficial effects:

[0084] (1) The present invention provides a LAMP nucleic acid combination for detecting Codonopsis pilosula AVA virus, which can be used for RT-qLAMP, PAE-RT-qLAMP or PAE-RT-LAMP amplification reactions. LAMP amplification recognizes 7 sequences of the AVA CP gene through 5 primers, namely F3, B3, FIP, BIP and LF, and has the technical advantages of strong specificity and high accuracy.

[0085] (2) The present invention also provides a nucleic acid combination for detecting Codonopsis pilosula AVA virus, which can be used for both conventional PCR detection and qPCR detection, and has high detection specificity and accuracy.

[0086] (3) The RT-qLAMP rapid quantitative detection kit for the pathogen of Codonopsis pilosula AVA virus provided by the present invention has the technical advantages of simple operation, fast speed, low cost, etc. The detection primer composition can achieve sensitive and reliable detection of Codonopsis pilosula AVA virus in the target sample. In particular, the PAE-qRT-LAMP kit has the advantages of low cost, no need for nucleic acid extraction, and simple detection steps.

[0087] The present invention performs RT-qLAMP amplification with high specificity and sensitivity, improves the specificity of detection, and reduces the occurrence of false positives.

[0088] (4) The present invention provides a new technical idea for the detection of new pathogens of Codonopsis pilosula and other crops. It can be used for accurate quantification of AVA virus in Codonopsis pilosula and for routine qualitative analysis, providing technical support for monitoring the occurrence, spread, interspecies transmission of AVA virus, as well as biosafety and comprehensive prevention and control. BRIEF DESCRIPTION OF THE DRAWINGS

[0089] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings required for use in the embodiments are briefly introduced below. It should be understood that the following drawings only show certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other related drawings can be obtained based on these drawings without creative work.

[0090] Figure 1 This is a schematic diagram of the planar structure of a PAE purification device (i.e., a filter) for physical adsorption enrichment of Codonopsis pilosula AVA virus pathogens using PAE-qRT-LAMP in an embodiment of the present invention;

[0091] Figure 2 This is a schematic diagram of the planar structure of a PAE concentration device (i.e., an ultrafiltration tube) for physical adsorption enrichment of Codonopsis pilosula AVA virus pathogens by PAE-qRT-LAMP in an embodiment of the present invention;

[0092] Figure 3This is a graph of electrophoresis analysis of PCR amplification of the CP gene of the AVA-positive leaf sample of Codonopsis pilosula in the embodiment of the present invention: In the figure: lanes 1-2 correspond to positive amplification of the AVA CP gene; lane CK: negative control;

[0093] Figure 4 This is a fluorescence quantitative detection diagram of primer screening for detecting the pathogen of Codonopsis pilosula AVA virus by PAE-RT-qLAMP in an embodiment of the present invention; in the figure: curve CK: negative control; curve AVA1: AVA-qLAMP1 primer set; curve AVA2: AVA-qLAMP2 primer set; curve AVA3: AVA-qLAMP3 primer set; curve AVA4: AVA-qLAMP4 primer set;

[0094] Figure 5 This is a common color LAMP naked eye observation diagram of the reaction temperature of PAE-RT-qLAMP for detecting the pathogen of Codonopsis pilosula AVA virus in the embodiment of the present invention; in the figure: reaction tube CK: negative control; reaction tube 56°C-70°C corresponds to: 56°C; 58°C; 60°C; 62°C; 64°C; 66°C; 68°C; 70°C;

[0095] Figure 6 This is a common color LAMP naked eye observation experiment diagram of the reaction time of PAE-RT-qLAMP for detecting the pathogen of Codonopsis pilosula AVA virus in an embodiment of the present invention; in the figure: reaction tube CK: negative control; reaction tube 20min-100min corresponds to: 20min; 30min; 40min; 50min; 60min; 70min; 80min; 90min; 100min respectively;

[0096] Figure 7 This is a fluorescence quantitative detection diagram of the specificity of the AVA virus pathogen detected by PAE-RT-qLAMP in the embodiment of the present invention; in the figure: curve NC: negative control; curve HC: healthy Codonopsis pilosula control; curve LSV: lily infected with lily latent virus LSV tissue; curve CMV: lily infected with cucumber mosaic virus CMV tissue; curve LMoV: lily infected with lily mottle virus LMoV tissue; curve AMV: angelica infected with alfalfa mosaic virus AMV tissue; curve ALSV: angelica infected with apple latent spherical virus ALSV tissue; curve KoMV: angelica infected with konjac mosaic virus KoMV tissue; curve LycMoV: angelica infected with camphor mottle virus LycMoV tissue; curve AVA: AVA Codonopsis infected tissue;

[0097] Figure 8This is a naked eye observation diagram of the common color LAMP specific for detecting AVA virus pathogens by PAE-RT-qLAMP in an embodiment of the present invention; in the figure: reaction tube NC: negative control; reaction tube HC: healthy Codonopsis pilosula control; reaction tube LSV: lily infected with lily latent virus LSV tissue; reaction tube CMV: lily infected with cucumber mosaic virus CMV tissue; reaction tube LMoV: lily infected with lily mottle virus LMoV tissue; reaction tube AMV: angelica infected with alfalfa mosaic virus AMV tissue; reaction tube ALSV: angelica infected with apple latent spherical virus ALSV tissue; reaction tube KoMV: angelica infected with konjac mosaic virus KoMV tissue; reaction tube LycMoV: angelica infected with camphor mottle virus LycMoV tissue; reaction tube AVA: AVA Codonopsis pilosula infected tissue;

[0098] Fig. 9 This is a fluorescence quantitative detection diagram of the sensitivity of PAE-RT-qLAMP in detecting the pathogen of Codonopsis pilosula AVA virus in the embodiment of the present invention; in the figure: curve NC: negative control; curve HC: healthy Codonopsis pilosula control; curve 1: Codonopsis pilosula AVA positive cDNA; curve 10 -1 :Dilution 10 1 times of Codonopsis pilosula AVA positive cDNA; curve 10 -2 :Dilution 10 2 times of Codonopsis pilosula AVA positive cDNA; curve 10 -3 :Dilution 10 3 times of Codonopsis pilosula AVA positive cDNA; curve 10 -4 :Dilution 10 4 times of Codonopsis pilosula AVA positive cDNA; curve 10 -5 :Dilution 10 5 times of Codonopsis pilosula AVA positive cDNA; curve 10 -6 :Dilution 10 6 times of Codonopsis pilosula AVA positive cDNA; curve 10 -7 :Dilution 10 7 times of Codonopsis pilosula AVA positive cDNA; curve 10 -8 :Dilution 10 8 times of Codonopsis pilosula AVA-positive cDNA;

[0099] Fig.10 This is a fluorescence quantitative detection diagram of the sensitivity of PAE-RT-qPCR in detecting the pathogen of Codonopsis pilosula AVA virus in the embodiment of the present invention; in the figure: curve NC: negative control; curve HC: healthy Codonopsis pilosula control; curve 1: Codonopsis pilosula AVA positive cDNA; curve 10 -1 :Dilution 10 1 times of Codonopsis pilosula AVA positive cDNA; curve 10 -2 :Dilution 10 2 times of Codonopsis pilosula AVA positive cDNA; curve 10-3 :Dilution 10 3 times of Codonopsis pilosula AVA positive cDNA; curve 10 -4 :Dilution 10 4 times of Codonopsis pilosula AVA positive cDNA; curve 10 -5 :Dilution 10 5 times of Codonopsis pilosula AVA positive cDNA; curve 10 -6 :Dilution 10 6 times of Codonopsis pilosula AVA-positive cDNA;

[0100] Fig.11 This is a fluorescence quantitative dissolution curve diagram of the PAE-RT-qPCR detection of Codonopsis pilosula AVA virus pathogens in the embodiment of the present invention; in the figure: curve NC: negative control; curve HC: healthy Codonopsis pilosula control; curve 1: Codonopsis pilosula AVA positive cDNA; curve 10 -1 :Dilution 10 1 times of Codonopsis pilosula AVA positive cDNA; curve 10 -2 :Dilution 10 2 times of Codonopsis pilosula AVA positive cDNA; curve 10 -3 :Dilution 10 3 times of Codonopsis pilosula AVA positive cDNA; curve 10 -4 :Dilution 10 4 times of Codonopsis pilosula AVA positive cDNA; curve 10 -5 :Dilution 10 5 times of Codonopsis pilosula AVA positive cDNA; curve 10 -6 :Dilution 10 6 times of Codonopsis pilosula AVA-positive cDNA;

[0101] Fig.12 PCR electrophoresis analysis of the sensitivity of PAE-RT-PCR in detecting the pathogen of Codonopsis pilosula AVA virus in the embodiment of the present invention; Lane 1: Codonopsis pilosula AVA positive cDNA; Lane 10 -1 :Dilution 10 1 times the AVA-positive cDNA of Codonopsis pilosula; Lane 10 -2 :Dilution 10 2 times of Codonopsis pilosula AVA positive cDNA; Lane 10 -3 :Dilution 10 3 times of Codonopsis pilosula AVA positive cDNA; Lane 10 -4 :Dilution 10 4 times of Codonopsis pilosula AVA positive cDNA; Lane 10 -5 :Dilution 10 5 times of Codonopsis pilosula AVA positive cDNA; Lane 10 -6 :Dilution 10 6times of Codonopsis pilosula AVA positive cDNA; Lane CK: negative control;

[0102] Fig.13 This is a fluorescence quantitative dissolution curve diagram of the PAE-RT-qLAMP detection of Codonopsis pilosula AVA virus pathogens in the embodiment of the present invention; in the figure: curve NC: negative control; curve HC: healthy Codonopsis pilosula control; curve 10 -1 :Dilution 10 1 times of Codonopsis pilosula AVA positive cDNA; curve 10 -2 :Dilution 10 2 times of Codonopsis pilosula AVA positive cDNA; curve 10 -3 :Dilution 10 3 times of Codonopsis pilosula AVA positive cDNA; curve 10 -4 :Dilution 10 4 times of Codonopsis pilosula AVA positive cDNA; curve 10 -5 :Dilution 10 5 times of Codonopsis pilosula AVA positive cDNA; curve 10 -6 :Dilution 10 6 times of Codonopsis pilosula AVA positive cDNA; curve 10 -7 :Dilution 10 7 times of Codonopsis pilosula AVA positive cDNA; curve 10 -8 :Dilution 10 8 times of Codonopsis pilosula AVA-positive cDNA;

[0103] Fig.14 This is a standard curve diagram of the detection of Codonopsis pilosula AVA virus pathogen by PAE-RT-qLAMP in the embodiment of the present invention; in the figure, the starting concentration of the Codonopsis pilosula AVA virus positive standard is 2.18x10 10 copies / μL; after 10-fold dilution, the concentrations of the six 10-fold dilutions were 2.18x10 9 copies / μL; 2.18x10 8 copies / μL; 2.18x10 7 copies / μL; 2.18x10 6 copies / μL; 2.18x10 5 copies / μL; 2.18x10 4 copies / μL. DETAILED DESCRIPTION

[0104] References to embodiments of the present invention will now be provided in detail, one or more examples of which are described below. Each example is provided as an explanation rather than a limitation of the present invention. In fact, it will be apparent to those skilled in the art that various modifications and variations may be made to the present invention without departing from the scope or spirit of the present invention. For example, a feature illustrated or described as part of one embodiment may be used in another embodiment to produce a further embodiment.

[0105] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of cell biology, molecular biology (including recombinant techniques), microbiology, biochemistry, and immunology, which are within the capabilities of a skilled artisan. This technique is fully explained in the literature, such as Molecular Cloning: A Laboratory Manual, 2nd Edition (Sambrook et al., 1989); Oligonucleotide Synthesis (MJ Gait, ed., 1984); Animal Cell Culture (RI Freshney, ed., 1987); Methods in Enzymology (Academic Press, Inc.); Handbook of Experimental Immunology (DM Weir and CC Blackwell, eds.); Gene Transfer Vectors for Mammalian Cells (JM Miller and MP Calos, eds., 1987); Current Protocols in Molecular Biology (FM Ausubel et al., eds., 1987); PCR: The Polymerase Chain Reaction (PCR: The Polymerase Chain Reaction) (Academic Press, Inc., 1987). Reaction" (Mullis et al., eds., 1994); and Current Protocols in Immunology (JE Coligan et al., eds., 1991), each of which is expressly incorporated herein by reference.

[0106] In order to make the purpose, technical scheme and advantages of the embodiments of the present invention clearer, the technical scheme in the embodiments of the present invention will be described clearly and completely below. If the specific conditions are not specified in the embodiments, they are carried out according to conventional conditions or conditions recommended by the manufacturer. If the manufacturer of the reagents or instruments used is not specified, they are all conventional products that can be purchased commercially.

[0107] The features and performance of the present invention are further described in detail below in conjunction with the embodiments.

[0108] Example 1

[0109] This embodiment provides a PAE-RT-qLAMP kit for rapid quantitative detection of AVA, an emerging viral pathogen of Codonopsis pilosula, wherein the PAE-RT-qLAMP kit consists of four parts, namely, Figure 1 and Figure 2 The filter and ultrafiltration tube of Codonopsis pilosula AVA virus pathogen, RT-qLAMP specific primer combination, reverse transcription RT synthesis reagent and qLAMP amplification reaction reagent shown;

[0110] In addition, the PAE-RT-qLAMP kit also includes phosphate buffer PBS, phosphate wash buffer PBST, negative control and positive control.

[0111] The RT-qLAMP specific primer composition includes the RT reverse primer AVA-R as shown in SEQ ID NO.1, the LAMP forward outer primer F3 as shown in SEQ ID NO.2, the LAMP reverse outer primer B3 as shown in SEQ ID NO.3, the LAMP forward inner primer FIP as shown in SEQ ID NO.4, the LAMP reverse inner primer BIP as shown in SEQ ID NO.5 and the LAMP forward loop primer LF as shown in SEQ ID NO.6.

[0112] The specific primer sequences are as follows:

[0113] AVA-R: 5'-GTAGGACCATACAACTTCAGGC-3';

[0114] F3: 5'-GTGCGCATACTATGTATGGT-3';

[0115] B3: 5'-ACAACTTCAGGCCTGGTT-3';

[0116] FIP: 5'-TCACCCGCAACATATTGGAAGACGAGGACCTGTTCACTCTG-3';

[0117] BIP: 5'-CACCTCTGGTGATTCTGGCTTTGCCCTTGCTTGAGAGATG-3';

[0118] LF: 5'-TGTAGCGGCTGGGTAACCA-3'.

[0119] The reverse transcription RT synthesis reagent consisted of 10 mM dNTP mixture, 5× M-MLV reaction buffer, 30 U / μL RNase inhibitor, 200 U / μL M-MLV reverse transcriptase, and RNA-free H2O;

[0120] The qLAMP amplification reaction reagents consisted of 10 mM dNTP mixture, 10× Thermpopol reaction buffer, 100 mM MgSO4, 8 U / μL Bst DNA polymerase, 50× LAMP fluorescent dye Dye, and nuclease-free H2O;

[0121] The concentration of phosphate buffer PBS and phosphate wash buffer PBST was 0.02 M, and the pH value was 7.4;

[0122] The negative control was nuclease-free H2O;

[0123] The positive control substance was the positive standard substance of Codonopsis pilosula AVA virus.

[0124] This embodiment also provides a method for preparing a positive standard of Codonopsis pilosula AVA virus. The specific preparation method is as follows:

[0125] 1. Extraction of total RNA from Codonopsis pilosula leaves:

[0126] 50-100 mg of AVA-infected Codonopsis pilosula leaves were ground in liquid nitrogen, and total RNA from the infected Codonopsis pilosula leaf tissue was extracted using a plant total RNA extraction kit;

[0127] 2. Primer design and synthesis:

[0128] Based on the contigs of Codonopsis pilosula AVA obtained by small RNA sequencing, a pair of specific forward (AVA-F) and reverse primers (AVA-R) of the CP gene were designed and synthesized; the sequences of the primers are as follows:

[0129] AVA-F: 5'-ACGCTGCTAAGGTGACCTGTC-3'

[0130] AVA-R: 5'-GTAGGACCATACAACTTCAGGC-3';

[0131] 3. Preparation of positive control:

[0132] 1) RT reaction

[0133] The above-mentioned AVA reverse primer AVA-R and M-MLV reverse transcriptase were used for RT reaction to synthesize the first chain of cDNA; the 10μL RT reaction system was as follows: 2μL total RNA, 1μL 10μM AVA specific reverse primer AVA-R, 3μL RNA-free H2O, denatured at 70℃ for 10min, and quickly cooled on ice for 2min; then 2μL 5×M-MLV buffer, 1μL 10mM dNTP mixture, 0.34μL 30U / μL RNase inhibitor, 0.35μL 200U / μL M-MLV reverse transcriptase and 0.31μL RNA-free H2O were added; after mixing, the mixture was incubated in a 42℃ water bath for 1h, kept at 70℃ for 15min, and placed on ice for use.

[0134] 2) PCR reaction

[0135] Using the first strand of cDNA as a template, PCR amplification of the Codonopsis pilosula AVA CP gene was performed under the action of Ex Taq DNA polymerase;

[0136] The PCR reaction system was 25.0 μL, including: 50 ng cDNA 1.0 μL, 5 U / μL Ex Taq DNA polymerase 0.2 μL, 10× PCR buffer 2.5 μL, 2.5 mM dNTP mixture 2 μL, 10 μM forward primer AVA-F 0.5 μL, 10 μM reverse primer AVA-R 0.5 μL, and nuclease-free H2O supplemented to 25.0 μL;

[0137] PCR amplification conditions were as follows: pre-denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 54°C for 30 s, extension at 72°C for 45 s, 35 cycles of amplification, and a final extension at 72°C for 5 min;

[0138] Reference Figure 3As shown, after the PCR product was detected by 1.5% agarose gel electrophoresis, the target fragment was recovered, and the target fragment was connected to the pMD18-T vector using a cloning vector kit, transformed into DH5α competent cells, and blue-white plate screening was performed; 3 white-white colonies were randomly picked and inoculated on ampicillin LB culture medium, and the bacteria were shaken at 37°C for 12 to 16 hours; the plasmid was extracted using a plasmid micro-extraction kit; 1 μL of the plasmid was taken respectively, and PCR amplification was performed under the same conditions as the above-mentioned PCR reaction system; the positive recombinant plasmids obtained by PCR detection were sequenced; the positive plasmids with completely correct sequences confirmed by sequencing were the positive control substances, and the corresponding lengths of the gene fragments of Codonopsis pilosula AVA virus were 1493 bp; the plasmid concentration of the standard substance was determined using a NanoDrop ND-1000 nucleic acid / protein analyzer;

[0139] 4. Sequence of positive control

[0140] After sequencing, the positive standard of the Codonopsis pilosula AVA CP gene was completely consistent with expectations, and the sequence of the recovered reference fragment was as follows:

[0141] Codonopsis pilosula AVA CP gene positive standard sequence:

[0142]

[0143] Example 2

[0144] This embodiment also provides a method for rapidly detecting Codonopsis pilosula AVA virus pathogens using the PAE-RT-qLAMP kit.

[0145] 1. Concentration, purification and PAE adsorption enrichment of Codonopsis pilosula AVA virus particles:

[0146] 1) Take 50-100 mg of the tissue material such as Codonopsis pilosula leaves and seeds to be tested, add 1 mL of phosphate buffer PBS and grind, transfer the grinding solution into a 1.5 mL sterile centrifuge tube, centrifuge at 3000 rpm for 2 min, and the supernatant is the crude extract of the diseased tissue;

[0147] 2) filtering the crude extract of the infected tissue through a 0.45 μm hydrophilic membrane filter to remove cell debris and other large particle aggregates to achieve the purpose of clarification;

[0148] 3) The filtered and purified virus solution is further concentrated by a centrifugal ultrafiltration tube to obtain a diseased tissue concentrate;

[0149] 4) Take 100 μL of the above infected tissue concentrate and add it to a 0.5 mL PCR tube and incubate at 4°C for 15 minutes;

[0150] 5) Discard the crude extract of the infected tissue, wash once with phosphate-buffered saline (PBST), wash once with RNA-free H2O, centrifuge briefly, and remove the residual liquid.

[0151] 2. Initial denaturation of virus particles:

[0152] Take 10uL of DEPC water or RNA-free water containing 15 units (U) RNase inhibitor, add it to the bottom of the above PCR tube, incubate at 95℃ for 1 minute for denaturation, and then quickly ice bath for 1 minute for subsequent reactions.

[0153] 3.RT reaction:

[0154] 1) Take a new PCR tube, add 2 μL of the above denatured solution, 1 μL of 10 μM AVA-specific reverse primer AVA-R, and 2 μL of RNA-free H2O, mix, and keep at 70°C for 10 min, then quickly put on ice for 2 min;

[0155] 2) Add 2 μL of 5×M-MLV buffer, 1 μL of 10 mM dNTP mixture, 0.34 μL of 30 U / μL RNase inhibitor, 0.35 μL of 200 U / μL M-MLV reverse transcriptase, and RNA-free H2O to the above PCR tube to make up to 10 μL. Mix well, incubate at 42°C in a water bath for 1 hour, and keep warm at 70°C for 15 minutes to obtain the first-chain cDNA for subsequent LAMP amplification.

[0156] 4. Fluorescence quantitative qLAMP amplification reaction:

[0157] Take a new PCR tube and add the following reagents for fluorescent quantitative qLAMP amplification. The reaction system is 12.5 μL. The qLAMP amplification reagents include 50 ng cDNA 1.0 μL, 10×Thermpopol buffer 2.5 μL, 100 mM MgSO4 1.5 μL, 10 mM dNTP mixture 3.5 μL, 10 μM B3 and F3 Primer 0.5 μL each, 10 μM FIP and BIP Primer 2.0 μL each, 10 μM LF Prime 0.5 μL, 8 U / μL Bst DNA polymerase 1.0 μL, 0.25 μl LAMP fluorescent dye Dye, and nuclease-free H2O to make up to 12.5 μL. At the same time, add nuclease-free H2O was used as a negative control, and the positive standard of Codonopsis pilosula AVA virus was used as a positive control; LAMP amplification was performed on a real-time fluorescence quantitative PCR thermal cycler, and the reaction conditions were: 60°C amplification for 60 min, followed by denaturation at 80°C for 5 min to terminate the reaction;

[0158] In other embodiments, if the content of AVA virus in a sample is to be detected, when performing the above qLAMP amplification reaction, a 10-fold diluted Codonopsis pilosula AVA virus positive standard needs to be amplified simultaneously, and a standard curve is drawn.

[0159] 5. Analyze and determine the reaction products

[0160] After the above fluorescence quantitative qLAMP amplification reaction is completed, observe whether the real-time fluorescence PCR instrument detects the fluorescent signal in the PCR tube:

[0161] If an obvious fluorescent signal is detected in the sample PCR tube, it means positive, indicating that the sample contains Codonopsis AVA virus;

[0162] If no obvious fluorescent signal is detected in the sample PCR tube, it means negative, indicating that the sample does not contain Codonopsis AVA virus;

[0163] In other embodiments, if the content of AVA virus in a positive sample is to be determined, the copy number of AVA virus in the positive sample needs to be quantitatively determined based on the amplification Ct value of the positive sample in combination with a standard curve.

[0164] Example 3

[0165] This embodiment provides a method (PAE-RT-LAMP) for rapid detection of Codonopsis pilosula AVA virus pathogens using a common PCR thermal cycler based on the PAE-RT-qLAMP kit of Example 1, which does not use a real-time fluorescence quantitative PCR thermal cycler. In other embodiments, a constant temperature device such as a water bath, a constant temperature incubator, a metal bath, etc. can be used to perform a common LAMP display reaction.

[0166] Compared with Example 2, the only difference is the LAMP amplification reaction in step 4:

[0167] The reaction system was 12.5 μL, in which the LAMP amplification reagents included 50 ng cDNA 1.0 μL, 10×Thermpopolbuffer 2.5 μL, 100 mM MgSO4 1.5 μL, 10 mM dNTP mixture 3.5 μL, 10 μM B3 and F3 Primer 0.5 μL each, 10 μM FIP and BIP Primer 2.0 μL each, 10 μM LF Primer 0.5 μL, 8 U / μL Bst DNA polymerase 1.0 μL, and nuclease-free H2O was added to 12.5 μL; nuclease-free H2O was used as a negative control, and Codonopsis pilosula AVA virus positive standard was used as a positive control; after the reaction system was configured, 1 μL 100×SYBRGreen was added to the inner wall of the PCR tube cap. I fluorescent dye color developing solution, cover the PCR tube cap tightly, and perform LAMP amplification; the reaction conditions of LAMP are: amplification at 62℃ for 80min, followed by denaturation at 80℃ for 5min to terminate the reaction.

[0168] Analyze and judge the reaction products:

[0169] After the above LAMP reaction is completed, centrifuge or gently shake the PCR tube without opening the cover to mix the SYBR Green I fluorescent dye on the inner wall of the PCR tube cover with the LAMP amplification product, turn it upside down to mix, and observe the color change of the mixed solution in the PCR tube with the naked eye:

[0170] If the color of the mixed solution changes to green, it means that the SYBR Green I dye binds to the double-stranded DNA, which is a positive reaction, indicating that the sample under test contains Codonopsis AVA virus;

[0171] If the color of the mixed solution is orange, it is a negative reaction, indicating that the sample does not contain Codonopsis pilosula AVA virus.

[0172] Example 4

[0173] This embodiment provides a method for detecting Codonopsis pilosula AVA virus pathogens using an RT-qPCR method.

[0174] The primers for fluorescence quantitative qPCR amplification and conventional PCR amplification of the AVACP gene are as follows:

[0175]

[0176] The fluorescence quantitative qPCR reaction system was 10 μL, including 50 ng cDNA 1.0 μL, TB Green Premix ExTaq (2X) (Tli RNaseH Plus) 5.0 μL, 10 μM forward primer AVA-qPCR-F1 0.2 μL, 10 μM reverse primer AVA-qPCR-R1 0.2 μL, ROX Reference Dye (50X) 0.2 μL, and nuclease-free H2O was added to 10.0 μL; at the same time, nuclease-free H2O was used as a negative control, and qPCR amplification was performed on a real-time fluorescence quantitative PCR thermal cycler. The reaction conditions were: 95°C pre-denaturation for 30 s; 95°C denaturation for 5 s, 60°C annealing for 34 s, and 35 cycles of amplification;

[0177] In order to evaluate the accuracy of the method results, this example also performed melting curve amplification with parameters of 95°C for 15 s, 60°C for 60 s, and 95°C for 15 s.

[0178] Example 5

[0179] This embodiment provides a method for detecting the pathogen of Codonopsis pilosula AVA virus by RT-PCR.

[0180] The primers for conventional PCR amplification of the AVACP gene are as follows:

[0181]

[0182] The common PCR reaction system was 25.0 μL, including: 50 ng cDNA 1.0 μL, 5 U / μL Ex Taq DNA polymerase 0.2 μL, 10×PCR buffer 2.5 μL, 2.5 mM dNTP mixture 2 μL, 10 μM forward primer AVA-PCR-F1 0.5 μL, 10 μM reverse primer AVA-PCR-R1 0.5 μL, and nuclease-free H2O added to 25.0 μL; PCR amplification conditions were: 95°C pre-denaturation for 3 min; 95°C denaturation for 30 s, 54°C annealing for 30 s, 72°C extension for 45 s, 35 cycles of amplification, and finally 72°C extension for 5 min.

[0183] The amplified products were analyzed by gel electrophoresis.

[0184] Experimental Example 1

[0185] Screening experiment of qLAMP primer set:

[0186] To screen the optimal primer set for qLAMP amplification, four sets of LAMP primers were designed in the region including the Codonopsis pilosula AVA capsid protein CP gene using Primer Explorer 5 software and default settings. The primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. The cDNA of a healthy Codonopsis pilosula plant was used as a negative control, and the cDNA of the Codonopsis pilosula AVA-positive leaf sample in the above embodiment was used as a reaction sample. The qLAMP reaction was performed on an Mx3000p real-time PCR thermal cycler using the qLAMP detection system and detection method in the above embodiment. The reaction program was 60°C amplification for 60 minutes. After the amplification, the fluorescence signal amplification curve of each reaction sample was observed. The experiment was repeated 3 times; the sequences of each primer are shown in the following table:

[0187]

[0188]

[0189] The amplification results are as follows Figure 4 As shown in the figure, among the four primers, the AVA2 primer group did not produce a fluorescent signal and could not amplify the AVACP gene of Codonopsis pilosula; while the other three primers AVA1, AVA3 and AVA4 could quickly amplify the cDNA of Codonopsis pilosula AVA disease positive samples. The AVA4 primer group had the earliest peak time of 25 minutes, followed by the AVA1 primer group with a peak time of 34 minutes, and finally the AVA3 primer group with a peak time of 46 minutes. After a large number of screening and repeated verification, it was finally determined that the AVA4 primer group had the highest sensitivity to the cDNA of Codonopsis pilosula AVA disease positive samples and was used for subsequent experiments.

[0190] Experimental Example 2

[0191] This experimental example provides a fluorescent dye naked eye observation experiment of rapid detection of Codonopsis pilosula AVA virus by the PAE-RT-qLAMP kit in Example 2 at different reaction temperatures and reaction times. The detection method is shown in Example 2.

[0192] The amplification results of RT-LAMP amplification at 56°C, 58°C, 60°C, 62°C, 64°C, 66°C, 68°C and 70°C for 80 min were tested respectively. Figure 5 As shown in the figure: reaction tube CK: negative control; reaction tube 56°C-70°C corresponds to: 56°C, 58°C, 60°C, 62°C, 64°C, 66°C, 68°C and 70°C. It can be seen from the figure that the amplification primer combination provided in the embodiment of the present invention can achieve efficient amplification of the Codonopsis pilosula AVA CP gene under the condition of 58-66°C.

[0193] The amplification results of the RT-LAMP amplification time of 20min, 30min, 40min, 50min, 60min, 70min, 80min, 90min, and 100min with an amplification temperature of 62°C were tested respectively. Figure 6 As shown in the figure: reaction tube CK: negative control; reaction tube 20min-100min corresponds to: 20min, 30min, 40min, 50min, 60min, 70min, 80min, 90min, 100min. It can be seen from the figure that the amplification primer combination provided in the embodiment of the present invention can achieve efficient amplification of the Codonopsis pilosula AVACP gene under the condition of 30-100min.

[0194] Experimental Example 3

[0195] The specificity of the PAE-RT-qLAMP kit for rapid detection of Codonopsis pilosula AVA virus pathogens.

[0196] In order to analyze the specificity of the PAE-RT-qLAMP kit for detecting Codonopsis pilosula AVA virus, field infected leaves of eight plant viruses, including lily latent virus LSV, cucumber mosaic virus CMV and lily mottle virus LMoV that infect lily, alfalfa mosaic virus AMV, apple latent spherical virus ALSV, konjac mosaic virus KoMV and autumn vine mottle virus LycMoV that infect angelica, and goosefoot A virus AVA that infects Codonopsis pilosula, were used as samples. The infected tissue crude extract and concentrate were prepared after grinding with phosphate buffer PBS. RT-qLAMP amplification was performed according to the PAE-RT-qLAMP detection system and detection method in the above embodiment. The reaction procedure was amplification at 60°C for 60 min, followed by denaturation at 80°C for 5 min to terminate the reaction. After the amplification, the fluorescent signal detected on the real-time fluorescence PCR thermal cycler was observed. Nuclease-free H2O was used as a blank control, and healthy Codonopsis pilosula leaves were used as a negative control. The experiment was repeated 3 times.

[0197] Fluorescence signal observation results refer to Figure 7 As shown, only the Codonopsis leaves infected with AVA amplified the fluorescence curve, and no obvious fluorescence signals were detected in the amplified products of the other diseased leaves, the blank control, and the healthy Codonopsis leaves. This indicates that the PAE-RT-qLAMP method established in the present invention has high specificity for Codonopsis AVA virus and has no cross-reaction with other common Chinese medicinal material viruses.

[0198] As a comparative test, the field infected leaves of the above 8 plant viruses were used as samples, and the infected tissue crude extract and concentrate were prepared after grinding with phosphate buffer solution PBS. According to the detection system and detection method in the above Example 3, RT reaction was carried out to synthesize the first chain of cDNA, and then a common LAMP color development reaction was carried out. The reaction procedure was 62°C amplification for 80 min. After the amplification, the PCR tube was centrifuged or gently shaken without opening the cover to mix the SYBR Green I fluorescent dye on the inner wall of the PCR tube cover with the LAMP amplification product, and the tube was mixed upside down. The color change of the mixed solution in the PCR tube was observed with the naked eye under natural light; nuclease-free H2O was used as a blank control, and healthy Codonopsis pilosula leaves were used as a negative control. The experiment was repeated 3 times.

[0199] The color development results were observed with the naked eye under natural light, referring to Figure 8 It was shown that only the color of the mixed solution of the Codonopsis pilosula leaf samples infected with AVA turned green, while the colors of the mixed solutions of the remaining diseased leaves, the blank control and the healthy Codonopsis pilosula leaves were all orange, indicating that the PAE-RT-LAMP method established in the present invention has high specificity for the Codonopsis pilosula AVA virus and has no cross-reaction with other common Chinese medicinal material viruses.

[0200] The above results show that the specific detection results of Codonopsis pilosula AVA virus by PAE-RT-qLAMP and PAE-RT-LAMP are completely consistent.

[0201] Experimental Example 4

[0202] Sensitivity of PAE-RT-qLAMP kit for rapid detection of Codonopsis pilosula AVA virus.

[0203] In order to analyze the sensitivity of the PAE-RT-qLAMP kit for quantitative detection of Codonopsis pilosula AVA virus, the cDNA of the AVA-positive leaves infected with Codonopsis pilosula in the above example was used as a sample, and the cDNA sample was diluted 10 times with nuclease-free H2O and stored at -20°C as a template. 1.0 μL of each dilution after 10 times dilution was taken as a template, and the qLAMP reaction reagent in the above example was added to perform fluorescent quantitative qLAMP amplification. The reaction procedure was 60°C amplification for 60 minutes, followed by denaturation at 80°C for 5 minutes to terminate the reaction; after the amplification, the fluorescent signal detected on the real-time fluorescence PCR thermal cycler was observed; nuclease-free H2O was used as a blank control, and healthy Codonopsis pilosula leaves were used as a negative control. The experiment was repeated 3 times;

[0204] As a comparative test, each of the dilutions diluted 10 times above was subjected to fluorescence quantitative qPCR amplification (Example 4) and conventional PCR amplification (Example 5). After the qLAMP reaction was completed, the fluorescence signal detected in the real-time fluorescence PCR thermal cycler was observed, and the fluorescence signal was measured by referring to Fig. 9 As shown in the figure, the sensitivity of PAE-RT-qLAMP to the cDNA of AVA-positive leaf samples of Codonopsis pilosula was 10 -6 ;

[0205] After the fluorescence quantitative qPCR reaction is completed, observe the fluorescence signal detected on the real-time fluorescence PCR instrument and refer to Fig.10 As shown in the figure, the sensitivity of PAE-RT-qPCR to the cDNA of Codonopsis pilosula AVA positive samples was 10 -5 ; Melting curve analysis reference Fig.11 As shown, the melting temperature of the target product of AVA is around 82°C, the amplified product is single, forming a specific melting peak, no mixed peaks appear, and the peak values ​​are relatively consistent, indicating that the quantitative results of PAE-RT-qPCR are reliable.

[0206] After the PCR reaction, 5 μL of the amplified product was loaded and subjected to agarose gel electrophoresis. Fig.12 As shown in the figure, the product size was 920 bp, which was consistent with the expectation. The sensitivity of PAE-RT-PCR to cDNA of AVA-positive leaf samples of Codonopsis pilosula was 10 -4 .

[0207] In summary, the sensitivity of PAE-RT-qLAMP in detecting cDNA of Codonopsis pilosula AVA-positive samples is 10 times higher than that of PAE-RT-qPCR and 100 times higher than that of PAE-RT-PCR.

[0208] Experimental Example 5

[0209] PAE-RT-qLAMP kit was used to quickly detect the dissolution curve of Codonopsis pilosula AVA virus.

[0210] In order to analyze the melting curve of AVA virus quantitatively detected by PAE-RT-qLAMP kit, the cDNA of AVA-positive leaves infected with Codonopsis pilosula in Example 1 was used as a sample, and the cDNA sample was diluted 10 times with nuclease-free H2O and stored at -20°C. 1.0 μL of each dilution after 10 times dilution was taken as a template, and the qLAMP reaction reagent in Example 1 was added to perform fluorescent quantitative qLAMP amplification. The reaction procedure was 60°C amplification for 60 minutes, followed by denaturation at 80°C for 5 minutes, and then the melting curve was obtained at 50-95°C at a speed of 1°C / sec; nuclease-free H2O was used as a blank control, and healthy Codonopsis pilosula leaves were used as negative controls. The experiment was repeated 3 times.

[0211] After the qLAMP reaction is completed, observe the fluorescence signal and melting curve detected in the real-time fluorescence PCR thermal cycler, and refer to Fig.13 As shown, the original concentration and 10 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6 Each cDNA sample diluted 10-fold produced a single melting peak with a melting temperature of about 87°C, while 7 and 10 8 No fluorescence signals were amplified from the cDNA samples diluted 100 times, the blank control of nuclease-free H2O, and the cDNA negative control of healthy Codonopsis pilosula leaves, indicating that no non-specific products and dimers appeared in the qLAMP amplification, and the PAE-RT-qLAMP kit had good reliability in detecting the pathogen of Codonopsis pilosula AVA virus.

[0212] Experimental Example 6

[0213] Establishment of standard curve for quantitative detection of Codonopsis pilosula AVA virus using PAE-RT-qLAMP kit.

[0214] In order to accurately quantify the AVA virus particle content in the sample, the positive standard of Codonopsis pilosula AVA virus was used as the sample, and the starting concentration was 100 ng / μl, i.e. 2.18x1010 The positive standard of Codonopsis pilosula AVA virus was diluted 10-fold with nuclease-free H2O and stored at -20°C. 1.0 μL of the starting concentration and each of the dilutions after 6 consecutive 10-fold dilutions were taken as templates, and the qLAMP reaction reagent in the above example was added to perform fluorescent quantitative qLAMP amplification. The reaction procedure was 60°C amplification for 60 min, followed by denaturation at 80°C for 5 min; nuclease-free H2O was used as a negative control, and the experiment was repeated 3 times.

[0215] After the qLAMP reaction is completed, the fluorescence signal detected in the real-time fluorescence PCR thermal cycler and the cycle number of the fluorescence signal baseline (Cycle threshold, Ct value) are observed. Fig.14 As shown, the amplification curve was obtained, and the logarithm of the copy number was used as the x-axis and the Ct value was used as the y-axis to draw the standard curve. The PAE-RT-qLAMP standard curve of Codonopsis pilosula AVA was obtained as y=-3.185x+42.536, R 2 =0.99, indicating that the curve is at 2.18x10 10 -2.18x10 4 There is a good linear relationship in the range of copies / μL, which can accurately quantify Codonopsis pilosula AVA virus.

[0216] Experimental Example 7

[0217] PAE-RT-qLAMP kit was used to detect laboratory-detoxified or field-grown Codonopsis pilosula samples.

[0218] Take samples of Codonopsis pilosula leaves, seeds, etc. that have been detoxified in the laboratory or collected in the field, grind them with phosphate buffer PBS, filter, purify and concentrate them according to the PAE method in Example 2 above to obtain a concentrated solution of infected tissue, and then perform RT-qLAMP amplification using the PAE-RT-qLAMP detection system in Example 2 above, with nuclease-free H2O as a negative control and a 10-fold diluted Codonopsis pilosula AVA virus positive standard as a positive control, and repeat the experiment 3 times. After the amplification is completed, observe whether the fluorescent signal in the PCR tube is detected in the real-time fluorescent PCR thermal cycler:

[0219] If an obvious fluorescent signal is detected in the sample PCR tube, it means positive, indicating that the sample contains Codonopsis AVA virus;

[0220] If no obvious fluorescent signal is detected in the sample PCR tube, it means negative, indicating that the sample does not contain Codonopsis pilosula AVA virus.

[0221] Optionally, if the content of AVA virus in the sample to be tested is high, a 10-fold diluted positive standard of Goosefoot A virus needs to be amplified simultaneously, and a standard curve is drawn. According to the amplification Ct value of the test sample, combined with the standard curve, the copy number of Goosefoot A virus in the test sample is quantitatively obtained;

[0222] Optionally, when there is no experimental equipment such as a real-time fluorescent PCR thermal cycler, the PAE-RT-LAMP detection system in the above Example 2 can be used to perform a common RT-qLAMP color development reaction. After the LAMP reaction is completed, the PCR tube is centrifuged or gently shaken without opening the cover to mix the SYBR Green I fluorescent dye on the inner wall of the PCR tube cover with the LAMP amplification product, and the tube is turned upside down to mix well, and the color change of the mixed solution in the PCR tube is observed with the naked eye under natural light:

[0223] If the color of the mixed solution turns green, it is a positive reaction, indicating that the sample tested contains Codonopsis pilosula AVA virus;

[0224] If the color of the mixed solution is orange, it is a negative reaction, indicating that the sample does not contain Codonopsis pilosula AVA virus.

[0225] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. For those skilled in the art, the present invention may have various modifications and variations. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included in the protection scope of the present invention.

Claims

1. A LAMP nucleic acid combination for detecting Anemone nepovirus A in Codonopsis pilosula, characterized in that: It includes: Such as the reverse transcription primer shown in SEQ ID NO.1, the LAMP forward outer primer F3 shown in SEQ ID NO.2, the LAMP reverse outer primer B3 shown in SEQ ID NO.3, the LAMP forward inner primer FIP shown in SEQ ID NO.4, the LAMP reverse inner primer BIP shown in SEQ ID NO.5 and the LAMP forward loop primer LF shown in SEQ ID NO.

6.

2. A nucleic acid combination for detecting the Herba Lycopodii virus A in Codonopsis pilosula, characterized in that: It includes: Such as the reverse transcription primer shown in SEQ ID NO.1, the upstream primer shown in SEQ ID NO.7, and the downstream primer shown in SEQ ID NO.

8.

3. A nucleic acid combination for detecting the Herba Lycopodii virus A in Codonopsis pilosula, characterized in that: It includes: The reverse transcription primer is shown in SEQ ID NO.1, the upstream primer is shown in SEQ ID NO.9, and the downstream primer is shown in SEQ ID NO.

10.

4. A kit for detecting the Herba Lycopodii virus A in Codonopsis pilosula, characterized in that: It includes at least one of the following nucleic acid combinations: The LAMP nucleic acid combination for detecting the Schefflera foetida virus A in Codonopsis pilosula according to claim 1, the nucleic acid combination for detecting the Schefflera foetida virus A in Codonopsis pilosula according to claim 2, and the nucleic acid combination for detecting the Schefflera foetida virus A in Codonopsis pilosula according to claim 3.

5. The kit according to claim 4, characterized in that The kit further comprises: a reverse transcription reagent, which comprises a reverse transcriptase, a reverse transcriptase buffer, an RNase inhibitor, a dNTP mixture and water.

6. The kit according to claim 5, characterized in that When the kit is used for LAMP amplification, the kit further comprises: a LAMP amplification reagent, and the LAMP amplification reagent comprises: a dNTP mixture, a ThermoPol reaction buffer, Mg ions, a DNA polymerase, a LAMP fluorescent dye and water.

7. The kit according to claim 5, characterized in that When the kit is used to perform a fluorescent quantitative qPCR reaction, the kit further comprises: a qPCR fluorescent dye and a fluorescent quantitative PCR reaction premix.

8. The kit according to claim 5, characterized in that When the kit is used to carry out PCR reaction, the kit further comprises: PCR fluorescent dye and PCR reaction premix.

9. The kit according to claim 8, characterized in that The PCR reaction premix also includes: DNA polymerase, PCR buffer, dNTP mixture and water.

10. The kit according to claim 5, characterized in that The kit also includes a positive control and a negative control.

11. The kit according to claim 4, characterized in that The kit also includes: a physical adsorption enrichment device for tissue separation of the sample to be tested, the physical adsorption enrichment device includes a filter and an ultrafiltration tube; the filter is provided with a hydrophilic filter membrane.

12. A method for detecting the Herba Lycopodii virus A in Codonopsis pilosula, characterized in that: It includes the following steps: The sample to be tested is subjected to reverse transcription reaction using the reverse transcription primer in the LAMP nucleic acid combination of claim 1 or the kit of any one of claims 4 to 11 to obtain cDNA, and then the cDNA is subjected to LAMP reaction using the LAMP nucleic acid combination of claim 1 under the following reaction conditions: 58-66° C., 30-100 min; 80° C., 5-10 min.

13. The method for detecting the Herba Lycopodii virus A in Codonopsis pilosula according to claim 12, characterized in that: The LAMP reaction was carried out under the following conditions: 60-62°C, 30-100 min; 80°C, 5-10 min.

14. The method for detecting the Herba Lycopodii virus A in Codonopsis pilosula according to claim 12, characterized in that: The LAMP reaction system includes: LAMP reverse outer primer B3 with a final concentration of 0.2-0.4 μM, LAMP forward outer primer F3 with a final concentration of 0.2-0.4 μM, LAMP forward inner primer FIP with a final concentration of 1.5-1.7 μM, LAMP reverse inner primer BIP with a final concentration of 1.5-1.7 μM and LAMP forward loop primer LF with a final concentration of 0.3-0.5 μM.

15. The method for detecting schefflera virus A in Codonopsis pilosula according to claim 14, characterized in that: The LAMP reaction system includes: Mg ions with a final concentration of 8.0-12.5 mM, a dNTP mixture with a final concentration of 1.4-2.8 mM, and a DNA polymerase with a final concentration of 0.32-0.64 U.

16. The method for detecting schefflera virus A in Codonopsis pilosula according to claim 12, characterized in that: Before the reverse transcription reaction, the method also includes the preparation of the sample to be tested, which includes: using tissue extract to roughly extract the sample of the Codonopsis pilosula material to be tested, filtering through a filter, transferring the collected filtrate to an ultrafiltration tube for concentration; and then incubating and washing to obtain the product.

17. The method for detecting schefflera virus A in Codonopsis pilosula according to claim 16, characterized in that: The washed sample is subjected to initial denaturation and then used for reverse transcription reaction. The conditions of the initial denaturation are: 85°C-95°C, 1-5min; ice bath.

18. A method for detecting the Herba Lycopodii virus A in Codonopsis pilosula, characterized in that: It includes the following steps: The nucleic acid combination of claim 2 or the reverse transcription primer in the kit of any one of claims 4 to 11 is used to perform reverse transcription reaction on the sample to be tested to obtain cDNA, and then the cDNA is amplified by qPCR using the upstream primer and the downstream primer in the nucleic acid combination of claim 2.

19. The method for detecting schefflera virus A in Codonopsis pilosula according to claim 18, characterized in that: The qPCR reaction conditions are: 95°C, 30 s; 95°C 5 s, 60°C 34 s, and 30-40 cycles of amplification.

20. The method for detecting schefflera virus A in Codonopsis pilosula according to claim 18, characterized in that: The qPCR reaction system includes an upstream primer with a final concentration of 0.2-0.7 μM and a downstream primer with a final concentration of 0.2-0.7 μM.

21. A method for detecting the Herba Lycopodii virus A in Codonopsis pilosula, characterized in that: It includes the following steps: The nucleic acid combination of claim 3 or the reverse transcription primer in the kit of any one of claims 4 to 11 is used to perform reverse transcription reaction on the sample to be tested to obtain cDNA, and then the cDNA is amplified by PCR using the upstream primer and the downstream primer in the nucleic acid combination of claim 3.

22. The method for detecting the Herba Lycopodii virus A in Codonopsis pilosula according to claim 21, characterized in that: The PCR reaction conditions are: 95°C, 3-5min; 95°C 5s, 54°C 30s, 70-72°C 45s, and 30-40 cycles of amplification.

23. The method for detecting the Herba Lycopodii virus A in Codonopsis pilosula according to claim 21, characterized in that: The PCR reaction system includes 0.2-1.0 μM upstream primer and 0.2-1.0 μM downstream primer.

Images