Disease resistance function and application of the C / C domain of CNL protein 2541 involved in wheat stripe rust resistance
Overexpression of the 2541-CC gene domain in wheat enhanced wheat stripe rust resistance, addressing the lack of research on the function of other domains of the CNL protein 2541 and achieving a higher stripe rust resistance effect.
Patent Information
- Application Number
- CN202410245390.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-03-04
- Publication Date
- 2026-05-26
- Estimated Expiration
- 2044-03-04
Smart Images

Figure CN118086329B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of functional gene technology, specifically relating to the disease resistance function and application of the CC domain of CNL protein 2541, which is involved in wheat stripe rust resistance. Background Technology
[0002] Over long periods of evolution, plants have gradually developed a two-layered defense mechanism to resist pathogen attacks. Pattern recognition receptors (PRRs) on the cell surface recognize pathogen-associated molecular patterns (PAMPs) and activate the basal immune response (PTI, or pattern-triggered immunity). Pathogens evade or suppress the PTI by secreting effectors, leading to effector-triggered susceptibility (ETS). Plants have correspondingly evolved resistance (R) proteins to sense effectors and initiate a specific immune response (ETS). Most resistance proteins are nucleotide-binding leucine-rich repeat receptors (NLRs). NLR-like R proteins are often physiologically specific, specifically recognizing effectors secreted by pathogens and thus activating the resistance response.
[0003] The CC or TIR domain at the N-terminus of NLR proteins plays a role in transmitting immune signals downstream. NLR disease resistance proteins are broadly classified into CNL (CC-NBS-LRR) and TNL (TIR-NBS-LRR) based on their variable N-terminal domains. Both CNL and TNL types are usually present in dicotyledonous plants, while only CNL is generally present in monocotyledonous plants, including wheat.
[0004] Wheat stripe rust is a common wheat disease characterized by high frequency of outbreaks, wide range of incidence, and severe damage and losses. It is prevalent in wheat-producing areas worldwide. Liu et al. (Liu W, Frick M, Huel R, Nykiforuk CL, Wang X, Gaudet DA, Eudes F, Conner RL, Kuzyk A, Chen Q, Kang Z, Laroche A. The stripe rust resistance gene Yr10 encodes an evolutionary-conserved and unique CC-NBS-LRR sequence in wheat. Mol Plant. 2014 Dec;7(12):1740-55. doi:10.1093 / mp / ssu112. Epub2014Oct 20.PMID:25336565.) discovered that Yr10(2475) (GenBank:AF149114.1) is involved in the process of wheat resistance to stripe rust and is the first race-specific CNL-type wheat stripe rust resistance gene to be cloned. Luo Yi (Luo Yi. Preliminary study on the functional domains of wheat stripe rust resistance gene Yr10 [D]. Northwest A&F University, 2019.) found a sequence in wheat AvS+Yr10 and Moro that is highly similar to Yr10 (2475), named it Yr10-1, and believed that Yr10-1 may be an alternative splice variant of Yr10 (2475). The N-terminal CC domain sequences of the two are completely identical, the NBS domain in the middle is only different at one site, but the LRR domain at the C-terminus has a few different sequences. Therefore, the gene was renamed 2541. There is currently little research on the gene function and domain function of 2541. Summary of the Invention
[0005] The purpose of this invention is to provide the disease resistance function and application of the CC domain (2541-CC) of CNL protein 2541, which is involved in wheat stripe rust resistance. Wheat plants overexpressing 2541-CC showed higher stripe rust resistance, confirming that the CC domain is a key functional domain for 2541 to exert its disease resistance function.
[0006] This invention provides the application of the 2541-CC gene domain in regulating wheat stripe rust resistance.
[0007] Preferably, the nucleotide sequence of the 2541-CC gene domain is shown in SEQ ID No. 1.
[0008] Preferably, wheat that overexpresses the 2541-CC gene domain exhibits higher resistance to wheat stripe rust.
[0009] The present invention also provides a recombinant expression vector that overexpresses the 2541-CC gene domain.
[0010] Preferably, the base vector of the recombinant expression vector includes a pCub vector controlled by the maize Ubi promoter.
[0011] Preferably, the nucleotide sequence of the 2541-CC gene domain shown in SEQ ID No. 1 is inserted into the SmaI restriction site of the base vector.
[0012] The present invention also provides a method for constructing plant germplasm overexpressing the 2541-CC gene domain using the above-mentioned recombinant expression vector, comprising using genetic transformation to transfer the recombinant expression vector into a target plant, and obtaining the plant germplasm overexpressing the 2541-CC gene domain after screening.
[0013] Preferably, the target plant includes wheat.
[0014] This invention also provides the application of the 2541-CC gene domain or the above-mentioned recombinant expression vector in the breeding of wheat germplasm with high resistance to wheat stripe rust.
[0015] Preferably, the high resistance to wheat stripe rust includes at least one of the following: increased leaf allergic necrosis, reduced stripe rust fungal urediniospores, increased reactive oxygen species, increased plant cell necrosis, and inhibited growth and development of stripe rust fungus.
[0016] Beneficial Effects: This invention provides the application of the 2541-CC gene domain in regulating wheat stripe rust resistance. Specifically, by transiently expressing the full-length 2541 gene and its truncated domains CC, NBS, LRR, CC-NBS(CN), and NBS-LRR(NL) in *Nicotiana benthamiana*, it was found that only the 2541 and CC domains (2541-CC) could induce visible cell necrosis after *Agrobacterium* infection, while other domains, including NBS, LRR, CN, and NL, did not induce similar phenotypes. Furthermore, 2541 and CC induced the accumulation of reactive oxygen species (ROS), which may be the cause of cell death. In addition, compared with other proteins (NBS, LRR, CN, NL), 2541 and CC caused more severe ion leakage in *Nicotiana benthamiana*.
[0017] In this embodiment of the invention, the CC domain of the wheat stripe rust resistance gene 2541 was stably overexpressed in wheat Fielder using transgenic technology to obtain CC-overexpressing (CC-OE) wheat plants, thus obtaining wheat plants with resistance to wheat stripe rust. In an experiment where wheat was inoculated with wheat stripe rust fungus CYR32, the CC-OE wheat plants showed significant resistance. Compared to the control group wheat Fielder, they exhibited macroscopic traits such as increased leaf hypersensitive necrosis and reduced stripe rust urediniospores, and microscopic traits such as increased reactive oxygen species, increased cell necrosis, and inhibited growth and development of stripe rust fungus. Attached Figure Description
[0018] Figure 1 The results of transient expression of the full-length 2541 and its truncated domain in Nicotiana benthamiana are shown in Figure A, which is a schematic diagram of the full-length 2541 and its truncated domain; Figure B shows the tobacco phenotype at 120 h and its trypan blue staining results; Figure C shows the tobacco phenotype at 48 h and its DAB staining results; Figure D shows the statistical results of ion leakage rate; and Figure E shows the results of Western blot detection.
[0019] Figure 2 The results of stable overexpression of 2541-CC in wheat are shown in Figure A, which is a comparison of stripe rust uredinia on CC-OE plants and Fielder plants; B is a biomass statistics; C is a CC-specific high expression figure; and D is a statistical figure of disease-related gene expression.
[0020] Figure 3 The images show microscopic observations of CC-OE and Fielder wheat after Pst infection. A represents typical photographs of H2O2 accumulation and cell necrosis around the Pst infection site in CC-OE and Fielder wheat at 48 and 120 hpi. B represents the statistical results of the H2O2 accumulation area. C represents the statistical results of the cell necrosis area. D represents typical photographs of Pst growth and development in CC-OE and Fielder wheat lines. E represents the hyphal area of Pst at 48 and 120 hpi. F, G, H, and I represent the hyphal length (F), hyphal branch number (G), haustoria mother cell number (H), and haustoria number (I) of Pst at 48 hpi, respectively. Detailed Implementation
[0021] This invention provides the application of the 2541-CC gene domain in regulating wheat stripe rust resistance.
[0022] In this invention, the gene 2541 is the same gene as the gene Yr10-1 found by Luo Yi (Luo Yi. Preliminary study on the functional domain of wheat stripe rust resistance gene Yr10 [D]. Northwest A&F University, 2019.) in wheat AvS+Yr10 and Moro. It is highly similar to Yr10 (2475) and may be an alternative splice variant of Yr10 (2475). The gene sequence of 2541 is shown in SEQ ID No. 19. The N-terminal CC domain sequences of the two are completely identical, the NBS domain in the middle differs by only one site, but the LRR domain at the C-terminus has a few different sequences.
[0023] The preferred nucleotide sequence of the CC domain of the 2541 gene of this invention is shown in SEQ ID No. 1.
[0024] In this embodiment of the invention, the CC domain of the wheat stripe rust resistance gene 2541 was stably overexpressed in wheat Fielder using transgenic technology to obtain CC-overexpressing (CC-OE) wheat plants. In an experiment where wheat was inoculated with wheat stripe rust fungus CYR32, the CC-OE wheat plants exhibited significant resistance. Compared to the control group wheat Fielder, they showed macroscopic traits such as increased leaf hypersensitivity necrosis and reduced stripe rust urediniospores, and microscopic traits such as increased reactive oxygen species, increased cell necrosis, and inhibited stripe rust growth and development.
[0025] The present invention also provides a recombinant expression vector that overexpresses the 2541-CC gene domain.
[0026] The base vector of the recombinant expression vector of the present invention preferably includes a pCub vector controlled by the maize Ubi promoter, which is from the Plant Immunology Research Laboratory of the National Key Laboratory of Crop Stress Resistance and High-Efficiency Production and has been published in an article (Huai B, Yuan P, Ma X, Zhang X, Jiang L, Zheng P, Yao M, Chen Z, Chen L, Shen Q, Kang Z, Liu J. Sugartransporter TaSTP3 activation by TaWRKY19 / 61 / 82 enhancements stripe rustsusceptibility in wheat. New Phytol. 2022 Oct;236(1):266-282. doi:10.1111 / nph.18331. Epub 2022 Jul 14. PMID:35729085.), and the nucleotide sequence is shown in SEQ ID No. 20. In the example, the nucleotide sequence of the 2541-CC gene domain shown in SEQ ID No. 1 is preferably inserted into the SmaI restriction site of the base vector.
[0027] The present invention also provides a method for constructing plant germplasm overexpressing the 2541-CC gene domain using the above-mentioned recombinant expression vector, comprising using genetic transformation to transfer the recombinant expression vector into a target plant, and obtaining the plant germplasm overexpressing the 2541-CC gene domain after screening.
[0028] The present invention does not specifically limit the method of genetic transformation; conventional methods in the art can be used for genetic transformation. The target plant of the present invention preferably includes wheat.
[0029] This invention also provides the application of the 2541-CC gene domain or the above-mentioned recombinant expression vector in the breeding of wheat germplasm with high resistance to wheat stripe rust.
[0030] The preferred high resistance to wheat stripe rust described in this invention includes at least one of the following: increased leaf allergic necrosis, reduced stripe rust fungal urediniospores, increased reactive oxygen species, increased plant cell necrosis, and inhibited growth and development of stripe rust fungus.
[0031] To further illustrate the present invention, the following detailed description, in conjunction with embodiments, of the disease-resistant function and application of the CC domain of CNL protein 2541, which is involved in wheat stripe rust resistance, should not be construed as limiting the scope of protection of the present invention.
[0032] Example 1
[0033] Acquisition of genes
[0034] Sampling of AvS+Yr10 wheat seedlings (carrying the disease-resistant gene Yr10, published in the paper: Wellings CR, Singh RP, Yahyaoui AH, et al. The development and application of near-isogeniclines for monitoring cereal rust pathogens.[C] / / Oral Papers & Posters, Technical Workshop, Borlaug Global Rust Initiative, Cd Obregón, Sonora, Mexico, March. 2009.) was performed 48 hours after inoculation with stripe rust fungus CYR32. Approximately 100 mg of two leaves was cut using sterile scissors. The samples were then quickly transferred to a 2 ml RNA centrifuge tube containing three sterile steel beads and immediately immersed in liquid nitrogen to keep the leaves as dry as possible and minimize mechanical damage. The samples were then homogenized using a high-throughput tissue homogenizer.
[0035] Total RNA was extracted from wheat leaves using the HiPure HP Plant RNA Mini Kit (CAT:R4165) from Meiji Biosciences, following the manufacturer's instructions. DNA in the RNA samples was digested with DNase I. RNA was reverse transcribed into cDNA using Novizan Biosciences. For IIQ RT SuperMix for qPCR (CAT:R223), please refer to the manufacturer's kit instructions for extraction procedures.
[0036] Using this cDNA as a template, PCR amplification was performed using the primers shown in SEQ ID No. 2 and SEQ ID No. 3. The amplification product was subjected to agarose gel electrophoresis, and the 579bp DNA fragment was separated, purified, and sequenced. The sequence of this DNA fragment is shown in SEQ ID No. 1, which is 2541-CC.
[0037] SEQ ID No.2: 5'-ATGGAGGTCGTGACCGG-3'
[0038] SEQ ID No.3: 5'-ATGTTTCTTGAAGACCTCATC-3'
[0039] Example 2
[0040] Overexpression of 2541-CC in Tobacco Bunsenii, as shown in Example 1, induced cell necrosis.
[0041] The full-length sequence 2541 was ligated to the SpeI restriction site in the pBINGFP2.0 vector (backbone sequence SEQ ID No. 18, disclosed in the article Luo Yi. Preliminary study of the functional domain of wheat stripe rust resistance gene Yr10 [D]. Northwest A&F University, 2019.) using a one-step cloning method. The truncated sequences of its domain CC (SEQ ID No. 1), NBS (SEQ ID No. 16), LRR (SEQ ID No. 17), CC-NBS (CN), and NBS-LRR (NL) were ligated between KpnI and BamHI in the pBINGFP2.0 vector, respectively. The above vectors were then transformed into Agrobacterium EHA105 (pSoup) strain, and the transformation procedure was followed according to the instruction manual. After transformation, colony detection was performed using universal primers 35S-F and M13-R.
[0042] Subsequently, correctly identified positive clones were selected and inoculated into 10 mL of liquid LB medium containing KAN and RIF antibiotics, and incubated on a shaker at 28°C and 200 rpm until OD. 600 The value is around 2.0. After the bacterial culture is completed, it is subjected to appropriate treatment and activation.
[0043] The procedure is as follows: 1. Collect the cultured bacteria in a 50mL sterile centrifuge tube and centrifuge at 5000rpm for 5 minutes at room temperature. Discard the supernatant.
[0044] 2. Use 5–10 mL of MgCl2 solution (10 mmol·L⁻¹) -1 Resuspend the bacterial block, being careful not to be too vigorous to avoid damaging the bacterial cells. Then centrifuge at 5000 rpm for 5 minutes at room temperature, discard the supernatant, and repeat 3 times to wash the bacterial cells.
[0045] 3. Add 5-10 mL of staining buffer to the centrifuge tube to resuspend the bacterial cells.
[0046] 4. Take a small amount of the resuspended bacterial solution and measure its OD using a spectrophotometer. 600 The absorbance value was then measured, and the original bacterial culture was diluted to OD using staining buffer. 600 =0.6.
[0047] 5. After dilution, place the bacterial solution in a dark place for 1-2 hours to activate Agrobacterium. Once activated, it can be used to infect tobacco.
[0048] Select healthy 4-6 week old *Agrobacterium benzoate* plants, and choose 2-3 leaves from each plant for infection. First, use a clean needle to make a small hole on the underside of the leaf. Then, use a needleless 1mL syringe to draw up the pre-activated bacterial solution and inject it into the intercellular spaces of the mesophyll cells through the needle hole. Mark the injection area with a marker. After injection, water lightly and then return the tobacco to the greenhouse for further cultivation. Take tobacco leaves 48h and 120h after *Agrobacterium benzoate* infection to observe their macroscopic phenotype and record the data. Then, perform staining treatment: observe the production of reactive oxygen species using DAB (3,3'-Diaminobenzidine tetrahydrochloride) staining, and observe cell necrosis using trypan blue staining.
[0049] DAB staining produces a bright brownish-yellow color in the presence of H₂O₂, which can be used for immunohistochemical detection and various blot examinations. The DAB staining method is as follows: Immerse tobacco leaves in a pre-prepared DAB staining solution and allow them to stand at room temperature in the dark for approximately 12 hours. Then, remove the stained tobacco leaves from the DAB staining solution and boil them in anhydrous ethanol for 10 minutes to remove the pigment and facilitate observation. After this, continue to immerse the leaves in anhydrous ethanol for approximately 24 hours to decolorize. Once decolorization is complete, the leaves can be observed and photographed for recording.
[0050] Trypan blue is a cell viability dye commonly used to detect cell viability. Live cells will not be stained blue by trypan blue, while dead cells will be stained blue. The trypan blue staining method is as follows: Completely immerse tobacco leaves in a pre-prepared trypan blue staining solution, boil for 10 minutes for staining, then allow to cool naturally at room temperature for approximately 12 hours. After staining, remove the leaves and immerse them in saturated chloral hydrate (2.5 g / mL). -1 The leaves are decolorized in anhydrous ethanol or ddH2O for about 2-3 days, during which time chloral hydrate can be replaced. After decolorization, the leaves are flattened in anhydrous ethanol or ddH2O and observed and photographed.
[0051] Western Blot analysis of protein expression:
[0052] 1. Total Protein Extraction: Tobacco leaves infected with Agrobacterium 48 hours prior were collected. The leaves were immediately removed from the plant, chopped, and placed in a clean mortar filled with liquid nitrogen. The leaves were then rapidly and vigorously ground multiple times with a grinding stick until a uniform powder was obtained. The powder was transferred to a 2 mL centrifuge tube containing 1 mL of cell lysis buffer (Beyotime, CAT: P0013), with PMSF protease inhibitor added beforehand. The mixture was thoroughly vortexed, and the centrifuge tube was placed on a rotary mixer for lysis at 4°C for approximately 30 min. After centrifugation at 12000 rpm for 10 min at 4°C, the supernatant was transferred to a new centrifuge tube, yielding the total protein extract from the tobacco.
[0053] 2. Polyacrylamide gel electrophoresis (SDS-PAGE): Take 80 μL of total protein extract, add 20 μL of loading buffer (5×), mix well, and incubate in a boiling water bath for 10 min. Then, place the gel on ice to cool. Prepare the gel using the SDS-PAGE gel preparation kit (Beyotime, CAT: P0012A) and perform SDS-PAGE electrophoresis. Set the current to 80 mA for the stacking gel and 120 mA for the separating gel. After electrophoresis, trim off any excess protein from the gel and place it in transfer buffer for later use.
[0054] 3. Transfer: Take an appropriate size PVDF membrane (Beyotime, CAT: FFP39), activate it by soaking it in methanol for 1-2 minutes, and then place it in transfer buffer for later use. Place the membrane in a semi-dry transfer apparatus (Biosciences, CAT: 40000484) in the order of "negative electrode - filter paper - gel - PVDF membrane - filter paper - positive electrode," keeping it moist with transfer buffer. Transfer at 100mA for 1 hour.
[0055] 4. Immunological reaction: After transfer, remove the PVDF membrane and immerse it in blocking buffer, incubating at 4°C for 2 hours by rotation. Add 1 μL of GFP / HA mouse monoclonal antibody to the blocking buffer and incubate at 4°C for approximately 12 hours. After primary antibody incubation, wash the PVDF membrane three times with TBST buffer, 5 minutes each time. Then immerse it in blocking buffer containing secondary antibody and incubate at 4°C for 2-4 hours. After secondary antibody incubation, wash three more times with TBST buffer.
[0056] 5. Colorimetric reaction: Add the prepared colorimetric solution (Millipore, CAT: WBKLS0100) to the PVDF membrane and spread it evenly. Take pictures and observe them under a gel imaging system.
[0057] The results are as follows Figure 1 As shown, transient expression of the full-length 2541 and its truncated domains CC, NBS, LRR, CC-NBS (CN), and NBS-LRR (NL) in *Nicotiana benthamiana* revealed that only 2541 and its CC domain (2541-CC) induced visible cell necrosis 48 hours after *Agrobacterium* infection (hpi), while other domains, including NBS, LRR, CN, and NL, failed to elicit a similar phenotype. Figure 1 (A and B). DAB staining revealed that 2541 and CC induced the accumulation of reactive oxygen species (ROS), which may be the cause of cell death. Figure 1 (C). Furthermore, compared to other proteins (NBS, LRR, CN, NL), 2541 and CC cause more severe ion leakage in *Nicotiana benthamiana*. Figure 1 (D). Western blot (WB) experiments confirmed that all proteins were expressed normally. Figure 1 (E).
[0058] Example 3
[0059] Stable overexpression of 2541-CC as described in Example 1 in wheat improves wheat stripe rust resistance.
[0060] method:
[0061] The full-length coding sequence of 2541-CC-GFP was inserted into the pCub vector controlled by the maize Ubi promoter. The recombinant vector was transformed into Agrobacterium strain EHA105, which was then transformed into Fielder wheat embryos. Genomic DNA was extracted from the regenerated plants, and positive transgenic lines were detected by PCR using Ubi-F primers (SEQ ID No. 14: 5'CATACGCTATTTATTTGCTTGG 3') and gene-specific primers (SEQ ID No. 15: 5'CCTCATCTCCTTCCGTCA3').
[0062] Wheat leaves, approximately 4–6 cm long, were collected from infected sites 48 h and 120 h after inoculation. DAB staining was performed to observe the production of reactive oxygen species and cell necrosis. DAB staining of wheat leaves was performed using the vascular bundle uptake method. The steps are as follows:
[0063] One end of a wheat leaf was placed in DAB staining solution, ensuring the leaf was above the DAB surface, and left to stand at room temperature under light (20000 Lux) for 6–8 hours. After staining, the leaves were cut into segments approximately 2 cm long and placed in clean 2 mL centrifuge tubes. The samples were fixed and destained using a fixation and clearing solution (glacial acetic acid: anhydrous ethanol = 1:1), and then cleared with saturated chloral hydrate. Finally, the samples were stored in 50% glycerol. After completion, observation was performed using a fluorescence microscope (Olympus, CAT: BX53F). Reactive oxygen species (ROS) were observed using the white light channel, and autofluorescence from cell necrosis was observed using the BVW fluorescence channel. ROS and necrosis area were statistically analyzed using CellSens Entry software.
[0064] RNA was extracted from approximately 100 mg of infected wheat leaves at 48 h and 120 h post-inoculation and reverse transcribed into cDNA for quantitative analysis. The expression level of the wheat gene NACT was detected using this gene as an internal reference. New primers were designed to detect the expression levels of wheat disease-related genes TaPR1, TaPR2, and TaPR5. Twelve days post-inoculation, stripe rust uredinia began to appear on the surface of wheat leaves. Leaf phenotypes were observed daily thereafter, and the disease severity of seedling wheat was assessed and photographed according to the stripe rust resistance identification criteria.
[0065] NACT-F(SEQ ID No.6):5'-GTTCTACAACGAGCTCCGTGTC-3'
[0066] NACT-R(SEQ ID No.7):5'-GACATACATTGCTGGGCAAC-3'
[0067] 2541-CC-F(SEQ ID No.4):5'-GACATCAAGAGCCGCATCA-3'
[0068] 2541-CC-R(SEQ ID No.5):5'-CCTCATCTCCTTCCGTCA-3'
[0069] TaPR1-F (SEQ ID No.8): 5'-CTGGAGCACGAAGCTGCAG-3'
[0070] TaPR1-R (SEQ ID No.9): 5'-CGAGTGCTGGAGCTTGCAGT-3'
[0071] TaPR2-F (SEQ ID No.10): 5'-CTCGACATCGGTAACGACCAG-3'
[0072] TaPR2-R (SEQ ID No. 11): 5'-GCGGCGATGTACTTGATGTTC-3'
[0073] TaPR5-F (SEQ ID No. 12): 5'-ACAGCTACGCCAAGGACGAC-3'
[0074] TaPR5-R (SEQ ID No. 13): 5'-CGCGTCCTAATCTAAGGGCAG-3'
[0075] The results are as follows Figure 2 As shown, inoculation of CC-OE wheat leaves with CYR32 at the two-leaf stage resulted in a significant hypersensitive necrosis response in CC-OE wheat 14 days post-inoculation, compared to the fewer uredinia of the stripe rust fungus, as seen in Fielder. Figure 2 (A). Biomass analysis showed that the Pst content in CC-OE plants was significantly reduced ( Figure 2 (B). Real-time quantitative PCR detection of CC transcription levels revealed high expression of CC in CC-OE wheat lines before and after Pst inoculation. Figure 2 In addition, the transcriptional levels of three pathogenesis-related (PR) genes were measured, and it was found that the expression levels of TaPR1, TaPR2, and TaPR5 in CC-OE wheat lines were all higher than those in Fielder wheat lines at 0 and 120 h. Figure 2 (D).
[0076] To investigate the resistance characteristics induced by CC overexpression in wheat, this invention conducted microscopic observations of the host cell defense response and fungal growth in Pst-infected CC-OE wheat. H2O2 accumulation at each infection site was observed using DAB staining, and the area of cell necrosis at each infection site was measured using autofluorescence. Figure 3 (A). The results showed that Pst infection at 48 and 120 hpi ( Figure 3 In cases B and C), CC-OE plants accumulated more H2O2, inducing more cell death. Simultaneously, WGA staining was used to observe and analyze the infection area, hyphal length, hyphal branching number, haustoria mother cells, and haustoria of Pst CYR32. Figure 3(D). Clearly, at 48 and 120 hpi, the infection area of Pst in CC-OE plants was significantly reduced ( Figure 3 (E). At 48hpi ( Figure 3 When the mycelial length of CC-OE plants decreased slightly from F to I, the number of mycelial branches, haustoria mother cells, and haustoria was comparable to that of Fielder.
[0077] Although the above embodiments have provided a detailed description of the present invention, they are only some embodiments of the present invention, and not all embodiments. People can obtain other embodiments based on these embodiments without creative effort, and these embodiments all fall within the protection scope of the present invention.
Claims
1. 2541 The application of the -CC gene domain in regulating wheat stripe rust resistance, characterized by: The 2541 The nucleotide sequence of the -CC gene domain is shown in SEQ ID No. 1; The regulation is the overexpression of the... 2541 Wheat with the -CC gene domain exhibits higher resistance to wheat stripe rust.
2. Overexpression 2541 The application of the -CC gene domain in breeding wheat germplasm with high resistance to wheat stripe rust is characterized by, The 2541 The nucleotide sequence of the -CC gene domain is shown in SEQ ID No. 1.
Citation Information
Patent Citations
Application of TaHPPD protein in regulation and control of wheat stripe rust resistance
CN119241675A