Application of transcription factor OsbZIP62 in negative regulation of rice seed vigor

Abstract

The present invention provides an application of transcription factor OsbZIP62 in negative regulation of rice seed vigor, belonging to the field of seed biotechnology. In the early stage of the present invention, three varieties with different storage tolerance (non-storage-tolerant variety Hang 2, medium-storage-tolerant variety Fuhui 7185 and storage-tolerant variety Fuxiangzhan) were artificially aged and transcriptome sequencing analyzed, and two core transcription factors that may regulate seed vigor were obtained, one of which is Os07g0686100 (OsbZIP62). The present invention first obtains homozygous transgenic strain materials by constructing knockout and overexpression vectors, Agrobacterium-mediated genetic transformation, and knockout and overexpression transgenic plant detection, and then observes the seed vigor phenotype, and finally clarifies the negative regulatory role of OsbZIP62 in the regulation of rice seed vigor. The present invention can lay a more solid theoretical foundation for molecular design breeding of rice seed vigor.

Description

Technical Field

[0001] The invention belongs to the field of seed biotechnology, and particularly relates to application of transcription factor OsbZIP62 in negative regulation of rice seed vitality. Background Art

[0002] It is known in the art that in plants, bZIP transcription factors are involved in seed germination and abiotic stress responses and other processes, including the regulation of seed vigor. For example, ZouM et al. found that overexpression of rice OsABI5 would make rice sensitive to ABA, thereby reducing rice seed vigor. For example, a recent study by Wang W-Q et al. described the detoxification pathway of rice bZIP seed vitality. They performed RNA-seq on rice varieties with different seed vitality and obtained OsbZIP23 as a candidate gene through analysis of sequencing results. The experiment found that overexpression of OsbZIP23 enhanced rice seed vitality, while knockout of OsbZIP23 reduced rice seed vitality, indicating that the protein of OsbZIP23 has a positive regulatory effect. Based on the fact that peroxide-reducing protein (1-CYSPEROXIREDOXIN, PER1) is a seed-specific antioxidant in plants and a key role in encoding detoxification pathways, they also conducted experiments on overexpression and knockout of PER1A. The results showed that overexpression of PER1A increased rice seed vitality, while knockout of PER1A reduced rice seed vitality. Therefore, they concluded that OsbZIP23 can directly bind to the promoter of PER1A and activate the expression of PER1A, and the ABA signaling pathway may be involved in OsbZIP23-PER1A, thereby mediating the regulation of rice seed vitality.

[0003] However, there are relatively few studies on the involvement of the bZIP family in regulating seed vigor, and its molecular mechanism needs further study. Summary of the invention

[0004] In order to solve the above technical problems, the present invention provides for the first time the application of transcription factor OsbZIP62 in negative regulation of rice seed vigor. In the early stage of the present invention, three varieties with different storage tolerance (non-storage-tolerant variety Hang 2, medium-storage-tolerant variety Fuhui 7185 and storage-tolerant variety Fuxiangzhan) were artificially aged and transcriptome sequencing analyzed, and two core transcription factors that may regulate seed vigor were obtained, one of which is Os07g0686100 (OsbZIP62). The present invention first obtains homozygous transgenic strain materials by constructing knockout and overexpression vectors, Agrobacterium-mediated genetic transformation, and knockout and overexpression transgenic plant detection, and then observes the seed vigor phenotype, and finally clarifies the negative regulatory role of OsbZIP62 in the regulation of rice seed vigor. The present invention can lay a more solid theoretical foundation for molecular design breeding of rice seed vigor.

[0005] To achieve the above object, the present invention adopts the following technical solutions:

[0006] One of the purposes of the present invention is to provide an application of the transcription factor OsbZIP62 in the negative regulation of rice seed vitality. The base sequence of the transcription factor OsbZIP62 is shown in SEQ ID No.1.

[0007] Furthermore, in the application, knocking out the transcription factor OsbZIP62 can increase the vigor of rice seeds and thus increase their germination rate.

[0008] The second object of the present invention is to provide a recombinant expression vector for knocking out the transcription factor OsbZIP62 for use in the screening / cultivation of rice varieties with high seed vigor.

[0009] The third object of the present invention is to provide an application of a host bacteria containing the recombinant expression vector in the screening / cultivation of rice varieties with high seed vigor, wherein the host bacteria is Escherichia coli.

[0010] Compared with the prior art, the present invention has the following beneficial effects:

[0011] The present invention obtains homozygous transgenic strain material by constructing knockout and overexpression vectors, Agrobacterium-mediated genetic transformation, knockout and overexpression transgenic plant detection, and the like, and then observes the seed vigor phenotype. The germination rates of the OsbZIP62 knockout strain and the control group Fuxiangzhan wild type at 0d, 21d, and 28d of artificial aging are respectively counted, and it is found that: (1) when no artificial aging is performed, the germination rates of each strain are consistent and have no significant difference; (2) when aging for 21d, there is no significant difference in the germination rate between the knockout strain and the wild type; (3) when aging for 28d, the germination rates of the knockout strain are 70.6% and 70.0%, which are significantly higher than the germination rate of the wild type of 61.0%. The germination rates of the OsbZIP62 overexpression strain and the control Kittake wild type at 0d, 14d, 16d, 17d and 18d of artificial aging were statistically analyzed. The results showed that: (1) When no artificial aging was performed, the germination rates of the strains were consistent and there was no significant difference; (2) After 14d of aging, the germination rates of the overexpression strains were only 29.3% and 10.6%, which were significantly lower than the germination rate of the wild type (82%); (3) After 16d of aging, the germination rates of the overexpression strains were only 27.3% and 9.3%, which were significantly lower than the germination rate of the wild type (42.6%); (4) After 17d of aging, the germination rates of the overexpression strains were only 13.3% and 4.6%, which were significantly lower than the germination rate of the wild type (30.0%); (5) After 18d of aging, the overexpression strains almost did not germinate, with germination rates of only 8.0% and 2.7%, which were significantly lower than the germination rate of the wild type (21.0%). That is, the present invention clarifies for the first time the negative regulatory role of OsbZIP62 in regulating rice seed vitality, which can lay a more solid theoretical foundation for the molecular design breeding of rice seed vitality. BRIEF DESCRIPTION OF THE DRAWINGS

[0012] Figure 1 The enzyme cleavage and ligation system used in Example 1 of the present invention;

[0013] Figure 2 The expression level of OsbZIP62 in the overexpressed transgenic strain of Example 1 of the present invention is detected. Note: Data are mean ± error (n = 3), and the significance of the difference is determined by t test, *, P < 0.05; **, P < 0.01;

[0014] Figure 3 The detection results of the knockout transgenic strains in Example 1 of the present invention, wherein: ... and - are deleted bases; the bases marked in red are added bases; #1-#5 are transgenic strains of OsbZIP62; Target1 / 2 are knockout targets of OsbZIP62;

[0015] Figure 4The artificial aging and germination experiments of the OsbZIP62 knockout strain in Example 2 of the present invention, wherein: (A) 28d artificial aging phenotype; (B) germination rate statistical line graph; (C, D, E) germination rates of the OsbZIP62 knockout strain at 0, 21 and 28d after artificial aging; Note: Data are mean ± error (n=3), and the significance of the difference was determined by t test, *, P<0.05; **, P<0.01;

[0016] Figure 5 This is the artificial aging and germination experiment of the OsbZIP62 overexpression strain in Example 2 of the present invention, wherein: (A) 14d artificial aging phenotype; (B) germination rate statistical line graph; (C, D, E, F, G) germination rate of the OsbZIP62 overexpression strain at 0, 14d, 16d, 17d and 18d after artificial aging treatment; Note: Data are mean ± error (n=3), t-test was used to determine the significance of the difference, *, P<0.05; **, P<0.01. DETAILED DESCRIPTION

[0017] The following examples will further illustrate the specific steps and features of the invention, which are for illustrative purposes only and are not intended to limit the present invention. The methods used in the present invention are conventional methods in the art unless otherwise specified. The reagents, materials, and instruments involved in the present invention are commercially available unless otherwise specified.

[0018] The present invention is further described in detail below with reference to the embodiments and drawings:

[0019] Example 1 Obtaining Rice OsbZIP62 Transgenic Material

[0020] 1. Construction of OsbZIP62 knockout and overexpression vectors

[0021] To obtain OsbZIP62 overexpression transgenic plants, the full-length coding region (sequence as shown in SEQ ID No.1) was constructed into pCUBi-1390 driven by a ubiquitination promoter, with restriction sites of PstI and BamHI. The 1390-OsbZIP62 recombinant plasmid was obtained according to the homology and group method. To obtain OsbZIP62 knockout transgenic plants, the exon gRNA of OsbZIP62 was predicted by the CRISPR-PLANT website, and the off-target analysis of the screened targets was performed by the CRISPR RGEN Tools website, and the target primers were selected for design (sequence as shown in SEQ ID No.2 and SEQ ID No.3). The target gene was amplified using the pCBC-MT1T2 plasmid as a template. The product was used Figure 1 The knockout vector plasmid was obtained by ligation and then transformed into competent E. coli.

[0022] SEQ ID No.1:

[0023] ATGGGAGTCCACGCAATGTCGTGCCACGGCGGCGGCGGCGGTGGCGGCGAAGGGGCACTGTCGCGGCAGGGGTCGGTGTACAGCCTGACGCTGAACGAGGTGGAGAGCCACCTGGGCGAGCCGCTGCGGAGCATGAACCTGGACGACCTCCTGCGCACGGTGCTCCCCGCCGCGGCGGCGGCGGCGGAGACGGCGGGGAGGAAGACGGTGGACGAGGTGTGGCGCGACATCCAGGGCGCCAGCACCGGCCGGCACCACGCGACGCCCATGGGCGAGATGACGCTCGAGGACTTCCTCTCGCGCGCCGGCGTCGCCGTCGACGGTGCCGCCTCCGCCGCCGGCGCGCATTGGCTGCGTGGGCACTACCCGCCGCCGCCGCCGCCGACGACGACGACGCTGCAGTACGTGGGCGGCTCCGGGGCGGTGGTGGACGGCGTGTATAACCGCGTGGACGGGCACGGCGTCGCGGGGTTCCTCTCGCAGGTGGGCGTGGCGGGGCGGAAGCGCGGCGGCGGCGTGGACGGCGTGGTGGAGAAGACGGTGGAGCGGAGGCAGAAGCGCATGATCAAGAACCGCGAGTCGGCGGCGCGGTCCCGAGCACGGAAGCAGGCATACACGAACGAGCTCGAGAACAAGATCTCGCGGTTGGAGGAGGAGAACCAGCGCCTCAGGGAGCACAAGGCTGTTGCTGATTTCTCAACATTCCCTAGCTGCGTCGATTTCCTGAAAGCATTCTTGACGCAGAAGCTGGAACCAGTAATGCAGATTGTGCCCCAGCCGGAGCCGAAGCAGCAGCTGCGACGAACTACTTCGGCCTCTTTCTAA

[0024] SEQ ID No.2:

[0025] AATAATGGTCTCAGGCGAGGACTTCCTCTCGCGCGCGTTTTAGAGCTAGAAATAGCSEQ ID No.3:

[0026] ATTATTGGTCTCTAAACCGAGCGTCATCTCGCCCATGGCTTCTTGGTGCC

[0027] 2. Agrobacterium-mediated genetic transformation

[0028] The recombinant plasmid obtained above was transformed into Agrobacterium according to the following steps:

[0029] (1) Thaw the competent culture medium of EHA105 Agrobacterium on ice, add 2.5 μg of plasmid into the competent culture medium, pipette slowly to mix, and place on ice for 25 min.

[0030] (2) Preheat the water bath to 37°C, freeze the reaction tubes in liquid nitrogen for 3 min, and then immediately heat shock at 37°C for 3 min.

[0031] (3) Add 500 μL of resistance-free LB liquid culture medium and culture at 28°C and 220 rpm in a shaking incubator for 5-6 h.

[0032] (4) After the culture is completed, centrifuge at 1500 rpm for 1 min, discard part of the supernatant on a clean bench, mix the precipitate with the remaining liquid, apply solid culture medium containing Kan and Rif resistance, and culture inverted at 28°C for 2-3 days.

[0033] (5) The grown clones are subjected to bacterial liquid PCR detection, and the positive clones that are successfully detected are reactivated and preserved and stored at -80°C.

[0034] Rice genetic transformation was carried out using indica rice Fuxiangzhan and japonica rice Kittae as genetic background materials. The following operations were all performed on an ultra-clean sterile workbench.

[0035] First, rice callus induction was performed. The rice seed shell was peeled off and placed in a sterilized conical flask, and about 100 mL of sterilized water was added. The bottle was shaken at a constant speed for 3 minutes, and then the waste liquid was discarded, and the process was repeated 3 times; then 100 mL of 75% anhydrous ethanol was added, and the bottle was shaken at a constant speed for 3 minutes, and then the waste liquid was discarded, and then sterilized water was added for rinsing, and the above operation was repeated 3 times; then 100 mL of 25% sodium hypochlorite was added, and the shaker was shaken at 220 rpm for 10 minutes, and the waste liquid was discarded, and then sterilized water was added for rinsing, and the above operation was repeated 8-10 times; the washed seeds were spread on sterilized qualitative filter paper, and the water was blown dry, and the rice seeds were placed in NB solid culture medium, and cultured at 28°C in the dark for 15 days to obtain callus tissue.

[0036] Next, remove the buds of rice callus and subculture. Remove the buds of induced rice tissue, leaving the light yellow callus in the new culture medium, and culture for 2 days; then use sterile tweezers to divide the callus into small pieces in the new culture medium for subculture, and continue to culture for 15 days before subculture 1-2 times.

[0037] Finally, rice genetic transformation was carried out, and the specific steps were as follows:

[0038] (6) First, the previously stored Agrobacterium with knockout and overexpression plasmids was cultured on solid culture medium of Kan and Rif for 1-2 days. At the same time, rice callus tissue of about 2 mm was selected and pre-cultured in a new culture medium for 2 days.

[0039] (7) The Agrobacterium was rinsed with AAM solution and its OD value was adjusted. The OD value can be adjusted according to the state of the callus tissue, and then the callus was cultured at 28°C for 1-2 hours.

[0040] (8) Soak the pre-cultured callus in the activated bacterial solution for 10 min.

[0041] (9) Use qualitative filter paper to absorb the bacterial liquid on the surface of the callus tissue and continue to leave it for 5 minutes.

[0042] (10) The callus tissue was transferred to a co-cultivation solid medium and cultured at 28°C for 2 days.

[0043] (11) The callus in the co-cultivation medium was transferred to a screening medium containing 50 mg / L Hyg and cultured at 28°C for 15 days. The screening was performed three times.

[0044] (12) The callus tissue grown during the screening process was transferred to a pre-differentiation medium and cultured under light for 15 days until it differentiated into green young shoots.

[0045] (13) The green seedlings were transferred to the rooting medium and cultured under light for 15 days (lighting time: 14 h light / 10 h dark; light intensity: 200 μmol*m -2 *s -1 ; Temperature: 25℃, humidity: 75%;), carefully wash off the solid culture medium at the roots, and use rice nutrient solution to train the seedlings.

[0046] 3. Knockout and overexpression transgenic plant detection

[0047] When detecting overexpressed transgenic materials, RNA was extracted from rice leaves after seedling training, specific primers for the target gene were designed (sequences are shown in SEQ ID No.4 and SEQ ID No.5), and the expression of OsbZIP62 at the mRNA level was detected by qRT-PCR, with the corresponding wild-type materials as the control. Figure 2 shown.

[0048] SEQ ID No.4: TGCCTTCATACGCTATTTATTTGC

[0049] SEQ ID No.5: AAGAGGCCGAAGTAGTTC

[0050] The results showed that the expression of OsbZIP62 gene was upregulated in the corresponding OE#1, OE#2 and OE#3 overexpression transgenic lines. Finally, OE#1 and OE#2 were selected for phenotypic experiments ( Figure 2 ).

[0051] When testing knockout transgenic materials, DNA was extracted from rice leaves during seedling training using the 2×CTAB method, and specific primers near the target site were designed (sequences are shown in SEQ ID No.6 and SEQ ID No.7), and PCR amplification was performed. The product was then sent to a sequencing company for sequencing, and the sequencing results of the knockout transgenic materials were compared with the wild-type sequence using Snapgene. The homozygous transgenic plants were propagated for subsequent phenotypic experiments. Figure 3 shown.

[0052] SEQ ID No.6: TGACGCTGAACGAGGTGGAG

[0053] SEQ ID No.7: GTTATACACGCCGTCCACCA

[0054] The results showed that 5 positive clones were obtained by knocking out OsbZIP62. The knockout of OsbZIP62 deleted 1, 4, and 2 bp, and increased 2 bp, respectively. The materials with 4 and 2 bp deletion were denoted as bzip62#4 and bzip62#5 for subsequent phenotypic experiments ( Figure 3 ).

[0055] Example 2 Experiment on negative regulation of rice seed vitality by OsbZIP62

[0056] After obtaining the above homozygous transgenic strain materials, the seed vigor phenotype was observed. Select homozygous transgenic seeds and wild-type seeds with mature and full appearance and consistent seed size, 2 strains of OsbZIP62 knockout and overexpression materials, 3 replicates for each strain, 100 seeds for each replicate, place seed net bags, and artificially accelerate seed aging in a high temperature and high humidity (temperature 42°C, humidity 88%) incubator, aging for 0d, 14d, 21d and 28d respectively. After aging, the seeds were counted for germination rate. The germination method was as follows: rice seeds were placed in a glass culture dish with two layers of filter paper, placed in a standard light culture room (28°C light environment conditions for 16h, 28°C dark environment for 8h) and cultured in clear water, and the seed germination rate was counted after 10d.

[0057] The germination rates of the OsbZIP62 knockout strain and the control group Fuxiangzhan wild type at 0d, 21d, and 28d were counted and analyzed. Figure 4 shown.

[0058] The results showed that: (1) without artificial aging, the germination rates of the strains were consistent and had no significant differences ( Figure 4 C); (2) After aging for 21 days, there was no significant difference in germination rate between the knockout strain and the wild type ( Figure 4 D); (3) After aging for 28 days, the germination rates of the knockout strains were 70.6% and 70.0%, which were significantly higher than the wild type germination rate of 61.0% ( Figure 4 E).

[0059] The germination rates of the OsbZIP62 overexpression strain and the control Kittake wild type at 0d, 14d, 16d, 17d, and 18d were counted and analyzed. The results are as follows Figure 5 shown.

[0060] The results showed that: (1) when no artificial aging was performed, the germination rates of the strains were consistent and there was no significant difference ( Figure 5 C) (2) After aging for 14 days, the germination rates of the overexpression lines were only 29.3% and 10.6%, which were significantly lower than the wild type germination rate of 82% ( Figure 5 D); (3) After aging for 16 days, the germination rates of the overexpression lines were only 27.3% and 9.3%, which were significantly lower than the wild type germination rate of 42.6% ( Figure 5 E); (4) After aging for 17 days, the germination rates of the overexpression lines were only 13.3% and 4.6%, which were significantly lower than the wild type germination rate of 30.0% ( Figure 5 F); (5) After aging for 18 days, the overexpression lines almost did not germinate, and the germination rates were only 8.0% and 2.7%, which were significantly lower than the wild type germination rate of 21.0% ( Figure 5 G).

[0061] In summary, OsbZIP62 negatively regulates rice seed vigor.

[0062] The embodiments described above are only descriptions of the preferred modes of the present invention, and are not intended to limit the scope of the present invention. Without departing from the design spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by ordinary technicians in this field should all fall within the protection scope determined by the claims of the present invention.

Claims

1. Knockout of transcription factors OsbZIP62 Application in breeding of rice varieties with high seed vigor, It is characterized in that The transcription factor OsbZIP62 The base sequence is shown in SEQ ID No. 1; the germination rate of the high seed vigor rice variety is still ≥ 70% after 28 days of aging; the aging conditions are: temperature 42° C., humidity 88%.

2. Knockout of a transcription factor OsbZIP62 Application of recombinant expression vector in breeding of rice varieties with high seed vigor, It is characterized in that The transcription factor OsbZIP62 The base sequence is shown in SEQ ID No. 1; the germination rate of the high seed vigor rice variety is still ≥ 70% after 28 days of aging; the aging conditions are: temperature 42° C., humidity 88%.

3. Use of a host bacteria containing the recombinant expression vector of claim 2 in the cultivation of rice varieties with high seed vigor, It is characterized in that The host bacteria is Escherichia coli, and the germination rate of the high seed vigor rice variety is still ≥70% after 28 days of aging.

Images