Long-chain lnc-malat1 and application thereof

CN118109592BActive Publication Date: 2026-03-03JIANGSU UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2024-03-08
Publication Date
2026-03-03

AI Technical Summary

Technical Problem

但是目前并没有一种可在TME中实现靶向抑制以提高化疗疗效的lncRNA

Benefits of technology

[0017]本发明通过荧光定量PCR检测到Lnc-MALAT1在胃癌肿瘤相关巨噬细胞外泌体中的高表达。本发明通过敲除Lnc-MALAT1或抑制Lnc-MALAT1表达可明显降低胃癌细胞糖酵解水平,提高胃癌的化疗敏感性。因此,Lnc-MALAT1表达抑制剂可用于治疗胃癌或与化疗药物联合治疗胃癌,为胃癌诊断、治疗提供新的思路和方案。

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118109592B_ABST
    Figure CN118109592B_ABST
Patent Text Reader

Abstract

This invention provides a long-chain Lnc-MALAT1 and its applications, belonging to the field of genetic engineering technology. The nucleotide sequence of the long-chain Lnc-MALAT1 described in this invention is shown in SEQ ID NO:1, and it is highly expressed in the exosomes of tumor-associated macrophages in gastric cancer. This invention also provides the application of Lnc-MALAT1 expression inhibitors in the preparation of drugs for treating gastric cancer, and their combined application with chemotherapeutic drugs in the preparation of drugs for treating gastric cancer. Knocking out or inhibiting Lnc-MALAT1 expression can significantly reduce the glycolytic level of gastric cancer cells and improve the chemosensitivity of gastric cancer. This invention also provides primer pairs and kits for quantitative real-time PCR detection of the Lnc-MALAT1 gene, which can be used for related prediction or diagnosis of gastric cancer treatment.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, and in particular relates to a long-chain Lnc-MALAT1 and its applications. Background Technology

[0002] Gastric cancer (GC) is a common malignant tumor of the digestive tract. Surgery combined with chemotherapy regimens such as cisplatin (DDP) or oxaliplatin (OXA) is currently the main treatment for gastric cancer, and progress has been made in the early treatment of gastric cancer. However, the survival rate of patients with advanced and metastatic disease remains relatively low, and the occurrence of metastasis and treatment resistance after surgery remains a major obstacle to improving patient survival. Therefore, a better understanding of the pathological mechanisms of gastric cancer metastasis and treatment resistance may lead to more effective treatment methods.

[0003] M2-type macrophages promote tumor growth and metastasis by promoting tumor cell proliferation and EMT, inducing tumor angiogenesis and pre-metastatic niche formation, and mediating tumor immunosuppression. Therefore, macrophage-targeted therapies are suggested to complement and synergize with existing treatment regimens for better cancer treatment. Various bioactive substances in exosomes, including proteins, miRNAs, lncRNAs, and circRNAs, play important biological functions. In particular, exosomal lncRNAs from different donor cells have been shown to participate in the pathogenesis, diagnosis, and treatment of many diseases, including cancer. However, currently, there is no lncRNA that can be targeted and inhibited in the macrophage to improve the efficacy of chemotherapy. Summary of the Invention

[0004] In view of this, the purpose of the present invention is to provide a long non-coding RNA marker associated with aerobic glycolysis and chemotherapy resistance in gastric cancer cells. The long non-coding RNA marker is Lnc-MALAT1. Inhibiting Lnc-MALAT1 expression can improve the chemotherapy sensitivity of gastric cancer, thereby achieving better treatment results for gastric cancer.

[0005] To achieve the above-mentioned objectives, the present invention provides the following technical solution:

[0006] This invention provides a long non-coding RNA marker associated with aerobic glycolysis and chemotherapy resistance in gastric cancer cells. The long non-coding RNA marker is Lnc-MALAT1, and its nucleotide sequence is shown in SEQ ID NO:1.

[0007] The present invention also provides the application of Lnc-MALAT1 expression inhibitors in the preparation of drugs for treating gastric cancer.

[0008] This invention also provides the combined use of Lnc-MALAT1 expression inhibitors and chemotherapeutic drugs in the preparation of drugs for treating gastric cancer.

[0009] Preferably, the chemotherapy drugs include cisplatin and oxaliplatin.

[0010] Preferably, the Lnc-MALAT1 expression inhibitor comprises siRNA of the Lnc-MALAT1 gene.

[0011] Preferably, the siRNA has the positive strand nucleotide sequence as shown in SEQ ID NO:2 and the antisense strand nucleotide sequence as shown in SEQ ID NO:3; or the siRNA has the positive strand nucleotide sequence as shown in SEQ ID NO:4 and the antisense strand nucleotide sequence as shown in SEQ ID NO:5.

[0012] Preferably, the drug further includes a pharmaceutically acceptable carrier.

[0013] The present invention also provides a primer pair for the real-time PCR detection of the Lnc-MALAT1 gene, comprising: an upstream primer, such as the nucleotide sequence shown in SEQ ID NO:6; and a downstream primer, such as the nucleotide sequence shown in SEQ ID NO:7.

[0014] The present invention also provides a real-time PCR detection kit for the Lnc-MALAT1 gene, comprising the above-mentioned real-time PCR detection primer pair.

[0015] Preferably, it also includes RNA extraction reagents, reverse transcription reaction system and real-time PCR reaction system.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] This invention detects high expression of Lnc-MALAT1 in exosomes of tumor-associated macrophages in gastric cancer using quantitative real-time PCR. By knocking out or inhibiting Lnc-MALAT1 expression, this invention significantly reduces glycolysis levels in gastric cancer cells and improves chemosensitivity. Therefore, Lnc-MALAT1 expression inhibitors can be used to treat gastric cancer or in combination with chemotherapeutic drugs, providing new ideas and strategies for the diagnosis and treatment of gastric cancer. Attached Figure Description

[0018] Figure 1 High-throughput sequencing results of M0-EX and M2-EX;

[0019] Figure 2 Statistical analysis of Lnc-MALAT1 expression in each group;

[0020] Figure 3 Results of experiments related to the level of glycolysis in gastric cancer cells in each group;

[0021] Figure 4 Apoptosis of gastric cancer cells after oxaliplatin treatment was detected by flow cytometry.

[0022] Figure 5 IC50 results of oxaliplatin-treated gastric cancer cells;

[0023] Figure 6 Apoptosis of gastric cancer cells after cisplatin treatment was detected by flow cytometry.

[0024] Figure 7 IC50 results of cisplatin-treated gastric cancer cells;

[0025] Figure 8 Changes in tumor size in mice of different groups;

[0026] Figure 9 Changes in tumor weight and corresponding protein expression in tumors in mice of each group;

[0027] Figure 10 Immunohistochemical detection of relevant indicators in gastric cancer cells before OXA injection;

[0028] Figure 11 Immunohistochemical detection of relevant indicators in gastric cancer cells after OXA injection;

[0029] Figure 12 Changes in tumor size in mice of different groups;

[0030] Figure 13 Tumor growth curves and changes in the expression of corresponding proteins in tumors in each group of mice;

[0031] Figure 14 Immunohistochemical detection of corresponding indicators of gastric cancer cells in each group of mice. Detailed Implementation

[0032] This invention provides a long non-coding RNA marker associated with aerobic glycolysis and chemotherapy resistance in gastric cancer cells. The long non-coding RNA marker is Lnc-MALAT1, with a nucleotide sequence of 8708 bp, as shown in SEQ ID NO:1.

[0033] This invention also provides the application of Lnc-MALAT1 expression inhibitors in the preparation of drugs for treating gastric cancer. Knocking out or inhibiting Lnc-MALAT1 expression can significantly reduce the glycolytic level of gastric cancer cells. The Lnc-MALAT1 expression inhibitors of this invention include siRNAs of the Lnc-MALAT1 gene. Preferably, one set of siRNAs in this invention has the following positive strand nucleotide sequence: S: GGCCAAAUGUUGAAGUUAATTA as shown in SEQ ID NO:2, and the antisense strand nucleotide sequence: AS: UUAACUUCAACAUUUGGCCTT as shown in SEQ ID NO:3; the other set of siRNAs has the following positive strand nucleotide sequence: S: GGUCGGCCUUGUAGAUUAATT as shown in SEQ ID NO:4, and the antisense strand nucleotide sequence: AS: UUAAUCUACAAGGCCGACCTT as shown in SEQ ID NO:5. (The nucleotide sequence of the synthesized siRNA can be replaced with T at the 3' end to save costs; T in the sequence of this invention can also be replaced with U).

[0034] This invention also provides the combined use of Lnc-MALAT1 expression inhibitors and chemotherapeutic drugs in the preparation of drugs for treating gastric cancer. Knocking out or inhibiting Lnc-MALAT1 expression can significantly improve the chemosensitivity of gastric cancer. The Lnc-MALAT1 expression inhibitors described in this invention include siRNA of the Lnc-MALAT1 gene. The chemotherapeutic drugs described in this invention include cisplatin and oxaliplatin.

[0035] The drug described in this invention also includes a pharmaceutically acceptable carrier.

[0036] The present invention also provides a primer pair for the real-time PCR detection of the Lnc-MALAT1 gene, comprising: an upstream primer with the nucleotide sequence GGGTGTTTACGTAGACCAGAACC, as shown in SEQ ID NO:6; and a downstream primer with the nucleotide sequence CTTCCAAAAGCCTTCTGCCTTAG, as shown in SEQ ID NO:7.

[0037] This invention also provides a quantitative real-time PCR detection kit for the Lnc-MALAT1 gene, comprising the aforementioned quantitative real-time PCR detection primer pair. Preferably, it further includes RNA extraction reagent, reverse transcription reaction system, and quantitative real-time PCR reaction system.

[0038] This invention utilizes quantitative real-time PCR detection of the Lnc-MALAT1 gene to predict or evaluate the therapeutic effects of gastric cancer.

[0039] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0040] Unless otherwise specified, the following embodiments are all conventional methods.

[0041] Unless otherwise specified, all materials and reagents used in the following examples are commercially available.

[0042] Example 1

[0043] 1. Screening for lncRNAs specifically highly expressed in M2-EX using high-throughput sequencing:

[0044] High-throughput sequencing analysis was performed on exosomes derived from M0 macrophages (M0-EX) and M2 tumor-associated macrophages (M2-EX), respectively. Results are shown in [Table / Reference]. Figure 1 . Figure 1 In the left volcano plot, the horizontal axis represents the sequencing groups M0-EX and M2-EX; the vertical axis represents the expression abundance of lncRNA; green represents low expression and red represents high expression. Figure 1 The right side of the image shows a scatter plot of lncENA values ​​increasing and decreasing in M0-EX and M2-EX. Analysis of the lncRNA high-throughput sequencing results indicates that Lnc-MALAT1 is abnormally highly expressed in M2-EX.

[0045] 2. Add 20 μg of M2-EX to cells with a cell count of 1.5-2 × 10⁻⁶. 5 HGC-27 and MGC-803 cells were co-cultured for 24 hours. HGC-27 cells and MGC-803 cells co-cultured with M2-EX for 24 hours were obtained for subsequent experiments.

[0046] Primers were designed based on Lnc-MALAT1 (F: GGGTGTTTACGTAGACCAGAACC, SEQ ID NO:6; R: CTTCCAAAAGCCTTCTGCCTTAG, SEQ ID NO:7). Real-time quantitative PCR was used to determine the expression of Lnc-MALAT1 in M0 macrophages and M2 macrophages, M0-EX and M2-EX, M2-EX and M2-EX co-cultured for 24 h in HGC-27 cells, and MGC-803 cells co-cultured for 24 h in M2-EX cells.

[0047] RNA sample preparation: The cell number is approximately 1.5-2 × 10⁻⁶. 51 mL of trizol was added to the cell sample to lyse the cells; 200 μL of chloroform was added, vortexed and mixed, and incubated for 3 min; centrifuged at 10000×g for 15 min at 4 °C, and the upper aqueous phase was transferred to a new EP tube; 500 μL of isopropanol was added, mixed and incubated at room temperature for 10 min; centrifuged at 10000×g for 10 min at 4 °C, and the supernatant was discarded; 1 mL of 75% ethanol was added to wash the precipitate, centrifuged at 7500×g for 5 min, and the supernatant was discarded; the sample was dried at room temperature, dissolved in RNase-free water, and the concentration and purity were measured.

[0048] RNA reverse transcription: The HiScript 1st Strand cDNA Synthesis Kit (Vazyme) was used. The reagent components and reaction system were as follows: 10 μL of 2×RT Mix, 1 μL of Oligo(dT), 1 μL of Random hexamers, 2 μL of HiScriptEnzyme Mix, 1 μL of RNA template, and RNase-free double-distilled water to a total volume of 20 μL.

[0049] The reverse transcription program on the PCR instrument was: 25℃ for 5 min, 50℃ for 15 min, and 85℃ for 5 min. After the run, the cDNA product was stored at 4℃.

[0050] Real-time quantitative PCR: AceQ qpcr sybr green master mix (Vazyme) was used. The reagent components and reaction system were as follows: 10 μL of 2×Mixture, 0.5 μL of 10 μM upstream primer, 0.5 μL of 10 μM downstream primer, 1 μL of cDNA template, and RNase-free double-distilled water to a total volume of 20 μL.

[0051] The real-time quantitative PCR reaction program was as follows: 95℃ for 5 min pre-denaturation; 95℃ for 10 s denaturation, 55℃ for 30 s annealing, 72℃ for 30 s extension, 40 cycles; melting curve analysis from 72℃ to 95℃.

[0052] See results Figure 2 .according to Figure 2 As a result, in all experimental groups, M2-EX showed significant high expression of Lnc-MALAT1, and Lnc-MALAT1 can be used as a specific molecule.

[0053] Example 2

[0054] Glycolysis and drug resistance-related experiments were conducted to determine the role of Lnc-MALAT1 in M2-EX for gastric cancer.

[0055] Two small interfering RNAs (SI-MALAT1) targeting Lnc-MALAT1 were designed and synthesized by Gemma. Their sequences are: S: GGCCAAAUGUUGAAGUUAATTA, SEQ ID NO:2, AS: UUAACUUCAACAUUUGGCCTT, SEQ ID NO:3; S: GGUCGGCCUUGUAGAUUAATT, SEQ ID NO:4, AS: UUAAUCUACAAGGCCGACCTT, SEQ ID NO:5. Knocking down Lnc-MALAT1 on these RNAs yielded M2-EX-SI-1 and M2-EX-SI-2.

[0056] (1) Transfect M2 macrophages that have been successfully induced and are in good growth condition;

[0057] (2) Discard the culture medium, add 1 mL of PBS to wash twice, discard the PBS waste liquid, and add 800 μL of serum-free blank culture medium;

[0058] (3) Take 5 μL of Lipofectamine TM 2000 transfection reagent was placed in an EP tube containing 100 μL of serum-free blank culture medium, mixed by pipetting, and allowed to stand at room temperature for 5 min.

[0059] (4) Pipette 5-10 μL of the dissolved siRNA solution into another EP tube containing 100 μL of serum-free blank culture medium, mix by pipetting, and let stand at room temperature.

[0060] (5) After 5 minutes, combine the two tubes into one, mix them by blowing and stirring, let them stand at room temperature for 20 minutes, then add them to a 6-well plate, gently shake the culture plate, and incubate in an incubator.

[0061] (6) After 4-6 hours, aspirate the liquid from the 6-well plate, add 2 mL of complete culture medium without antibiotics, and incubate in an incubator. After 24 hours of culture, extract cellular RNA to verify the knockdown efficiency. Subsequent experiments can be carried out provided that the knockdown efficiency is guaranteed.

[0062] PBS, M2-EX-NC (containing Lnc-MALAT1), M2-EX-SI-1 (Lnc-MALAT1 knockout), and M2-EX-SI-2 (Lnc-MALAT1 knockout) were co-cultured with gastric cancer cells (HGC-27 / MGC-803) for 24 h. Each cell group received 20 μg of exosomes, and an equal volume of PBS was added. The cell count in each sample was 1.5–2 × 10⁻⁶ cells / mL. 5 This was then used to detect changes in glycolysis levels and sensitivity to chemotherapy in gastric cancer cells.

[0063] 1. Detecting the glycolysis level of gastric cancer cells:

[0064] Glucose uptake assay: Supernatant from treated gastric cancer cells was collected from each group, and the cell count was determined. The glucose oxidase assay (GOD) kit (Beijing Pulilai Co., Ltd., China) was used for determination. 5 μL of standard (500 μM) or the test sample was mixed thoroughly with 200 μL of freshly prepared test solution (a 4:1 mixture of reagent 1 and reagent 2) in a 96-well plate. The mixture was incubated at 37°C for 20 min, and the absorbance was measured at 550 nm using a microplate reader. The remaining glucose content in the supernatant was calculated, and the average glucose uptake by neutrophils in each group was calculated based on the cell count.

[0065] Lactic acid production assay: Supernatant from treated gastric cancer cells in each group was collected, and the number of cells in each group was counted. Lactic acid content in the samples was determined according to the instructions of the lactate content assay kit (Beijing Solarbio Science & Technology Co., Ltd., China). 100 μL of supernatant was added to 1 mL of extraction buffer one, centrifuged at 12000 g for 10 min at 4℃, and 0.8 mL of supernatant was collected. Then, 0.15 mL of extraction buffer two was added, and the mixture was centrifuged at 12000 g for 10 min. The supernatant was then collected for testing.

[0066] ATP assay: Gastric cancer cells from each group were collected, and the procedure was performed according to the ATP assay kit instructions (Shanghai Beyotime Biotechnology Co., Ltd., China). Cells were lysed on ice with ATP lysis buffer, thoroughly mixed, and centrifuged at 12000g for 5 min at 4°C. The supernatant was collected for analysis. Protected from light, 100 μL of freshly prepared working solution (a 1:9 mixture of test solution and diluent) was mixed with 10 μL of sample in an EP tube. The RLU value was measured using a Luminometer chemiluminescence analyzer. The ATP concentration was calculated based on the standard curve, and the average ATP content was calculated using the sample protein concentration.

[0067] Lactate dehydrogenase activity assay: The procedure was performed according to the instructions of the lactate dehydrogenase assay kit (Nanjing Jiancheng Bioengineering Institute, China). Neutrophils were collected after 12 hours of treatment with gastric cancer-derived exosomes. The neutrophils were resuspended in PBS, and cell homogenates were prepared using an ultrasonic homogenizer in an ice bath for analysis. The assay steps are as follows:

[0068] Table 1. Procedure for lactate dehydrogenase assay

[0069]

[0070] The experimental results are shown in Figure 3 , Figure 3The results show changes in glucose uptake, lactate production, ATP levels, and lactate dehydrogenase activity in gastric cancer cells of each group. The results indicate that the glycolysis level of gastric cancer cells in the M2-EX-NC group was significantly increased compared to those in PBS alone, while it was significantly downregulated in the Lnc-MALAT1 knockdown groups M2-EX-SI-1 and M2-EX-SI-2.

[0071] 2. Detect changes in the sensitivity of gastric cancer cells to chemotherapy.

[0072] To verify the effect of Lnc-MALAT1 in M2-EX on chemotherapy of gastric cancer cells (HGC-27 / MGC-803). The drug-time and concentration gradient curves of cisplatin and oxaliplatin on gastric cancer cell lines were detected using the CCK-8 assay to determine the drug regimen. The culture medium for gastric cancer cells (cell number 1.5-2 × 10⁻⁶) was used. 5 20 μg of M2-EX-SI-NC / M2-EX-SI-1 / M2-EX-SI-2 (added in equal volume to PBS) were added to each of the cells, followed by the addition of 10 μM of the chemotherapy drug cisplatin (DDP) or oxaliplatin (OXA). Apoptosis was detected by flow cytometry and drug resistance concentration was detected by IC50.

[0073] Flow cytometry detection of apoptosis:

[0074] (1) Gastric cancer cells co-cultured with PBS / M2-EX-SI-NC / M2-EX-SI-1 / M2-EX-SI-2 for 24 hours were removed from the cell culture incubator. The culture medium was discarded, and the cells were washed twice with 1 mL of pre-cooled PBS. Then, an equal volume of EDTA-free trypsin was added for digestion, and the digestion was terminated with complete culture medium. The cell suspension was transferred to 15 mL centrifuge tubes, and the cells were counted. The cells containing 1×10⁻⁶ cells were then centrifuged. 6 The suspension of cells was centrifuged at 800 rpm for 5 min at 4°C, and the supernatant was discarded.

[0075] (2) Add 1 mL of pre-cooled PBS to wash, resuspend the cell pellet, centrifuge at 4°C and 1000 rpm for 5 min, discard the supernatant, and repeat the operation once.

[0076] (3) Add 100 μL of 1× binding buffer and gently pipette to mix and prepare a single-cell suspension;

[0077] (4) Add 5 μL Annexin V-FITC staining solution and 5 μL PI staining solution, mix well and incubate at room temperature in the dark for 10 min;

[0078] (5) Add 400 μL of 1× binding buffer, gently pipette to mix, and detect the percentage of apoptosis by flow cytometry within 1 h. Perform statistical analysis on GraphPad Prism 9 software.

[0079] IC50 (the concentration of chemotherapy drugs when 50% of gastric cancer cells have died) detection:

[0080] (1) After co-culturing with cisplatin or oxaliplatin for 24 hours, discard the culture medium, add 100 μL of serum-free culture medium containing 10% CCK-8 working solution to each well, incubate in a cell culture incubator for 1-4 hours, and detect the absorbance at 450 nm using an ELISA reader and record the results.

[0081] (2) Calculate IC50 based on OD value and perform statistical analysis on GraphPad Prism 9 software.

[0082] See results Figures 4-7 . Figure 4 To detect apoptosis in gastric cancer cells after oxaliplatin treatment using flow cytometry. Figure 5 The IC50 results for gastric cancer cells treated with oxaliplatin. Figure 6 To detect apoptosis in gastric cancer cells after cisplatin treatment using flow cytometry, Figure 7 IC50 results for gastric cancer cells treated with cisplatin. Figures 4-7 It is known that M2-EX-NC without Lnc-MALAT1 knockout can improve the drug resistance of gastric cancer cells, while M2-EX-SI-1 and M2-EX-SI-2 with Lnc-MALAT1 knockout can improve the chemosensitivity of gastric cancer cells compared with the M2-EX-NC group.

[0083] Example 3

[0084] By directly injecting M2-EX mice with Lnc-MALAT1 knockdown, changes in mouse tumors were observed to clarify the in vivo role of Lnc-MALAT1 in gastric cancer development and chemotherapy resistance.

[0085] After co-culturing HGC-27 cells with TAM-EX-NC cells for 24 hours, cells were digested with trypsin and counted. The cells were then resuspended in PBS to adjust the cell concentration to 5 × 10⁻⁶ cells / mL. 6 Cells / mL: Age-appropriate nude mice were selected and labeled according to different groups, with 5 mice in each group. 100 μL of cell suspension was drawn using a 0.5 mL syringe and inoculated into the right axilla of each mouse. After a visible xenograft appeared, the long and short diameters of the tumor were measured using electronic calipers to determine its growth rate. The tumor volume was calculated using the following formula: Volume = Long diameter × Short diameter² / 2. The tumors were allowed to grow to 200–300 mm. 3At the time of administration, PBS / M2-EX-SI-NC / M2-EX-SI-1 was injected into the tumor (once daily for three consecutive days; the amount of exosomes to be injected was calculated based on the exosome concentration and mouse weight, and the total volume was calculated in mL; the concentration of M2-EX-SI-NC / M2-EX-SI-1 injected per mouse was 5 mg / kg). Then, intraperitoneal injection of OXA (20 mg / kg) was initiated. Tumor size was observed and measured every two days. After 14 days, nude mice were euthanized by cervical dislocation, and subcutaneous xenografts were collected, weighed, and photographed. Corresponding indicators (Ki67 is a proliferation indicator; δ-catenin is a β-catenin pathway indicator; HIF-1α is a HIF-1α pathway indicator; TUNEL is an apoptosis indicator) were detected by Western blotting, qRT-PCR, and histochemical staining.

[0086] Immunohistochemical steps:

[0087] (1) Take some tumor tissue from nude mice and send it to the pathology department for sectioning and embedding in paraffin. Before the experiment, place the paraffin sections in a 60℃ oven for more than 6 hours.

[0088] (2) Dewaxing and hydration: Immerse the slices in a glass jar containing xylene solution for 15 minutes, take them out and place them in another xylene solution jar and repeat the operation once to dewax them. Then, put the slices into glass jars containing anhydrous ethanol, anhydrous ethanol, 95% ethanol, 95% ethanol, 80% ethanol and 70% ethanol in sequence, and immerse them in each solution for 3 minutes.

[0089] (3) Take out the slices and rinse them three times in a glass jar containing histochemical PBS, 3 minutes each time;

[0090] (4) Place the slices in a pre-prepared 3% hydrogen peroxide solution and incubate them on a shaker at room temperature for 30 minutes to block endogenous peroxidase.

[0091] (5) Rinse three times with histochemical PBS, 3 min each time;

[0092] (6) Antigen retrieval: Place the slide in freshly prepared citrate buffer and steam in an electric oven for 30 minutes or heat in a microwave oven for 20 minutes;

[0093] (7) After the sections have cooled to room temperature, rinse them with histochemical PBS 1-2 times, 3 minutes each time;

[0094] (8) Use an immunohistochemical pen to draw a circle around the specimen and add 5% BSA solution drop by drop, and block at room temperature for 1 hour;

[0095] (9) Dilute the primary antibody with 5% BSA solution and add it dropwise to the specimen. Place the specimen in a humidified chamber and incubate overnight at 4°C.

[0096] (10) The primary antibody was recovered the next day, and the slides were rinsed three times with histochemical PBS for 5 minutes each time.

[0097] (11) Place the slide back into the humidified box, add SABC working solution to the center of the specimen, incubate in a 37°C incubator for 30 min, and immerse in histochemical PBS to wait for color development;

[0098] (12) Color development: Add an appropriate amount of freshly prepared DAB working solution to the specimen and observe it under a microscope. When the tissue specimen turns a distinct brown color, quickly place it in double-distilled water and shake to wash it to stop the color development.

[0099] (13) Counterstaining: Add hematoxylin solution for about 10 seconds, rinse with running water for 20 minutes until all residual dye is removed;

[0100] (14) Dehydration: the reverse process of dewaxing. Tissue sections are placed in glass jars containing 70% ethanol, 80% ethanol, 95% ethanol, 95% ethanol, anhydrous ethanol and anhydrous ethanol in sequence for 3 minutes each time. Then they are placed in glass jars containing xylene twice for 15 minutes each time.

[0101] (15) Mounting: Add neutral resin to the center of the specimen and slowly cover it with a cover slide along one side of the slide to avoid air bubbles in the tissue. After air drying at room temperature, place it on a slide scanner for scanning.

[0102] See results Figures 8-11 . Figure 8 The changes in tumor size in mice in each group were compared as follows: the changes in tumor size of gastric cancer cells in mice after tumor injection with PBS / M2-EX-SI-NC / M2-EX-SI-1 and simultaneous intraperitoneal injection with oxaliplatin. Figure 9 Tumor weight was measured in mice in each group after injection of PBS / M2-EX-SI-NC / M2-EX-SI-1 and simultaneous intraperitoneal injection of oxaliplatin. Changes in the expression of corresponding proteins in the tumor were also measured after simultaneous intraperitoneal injection of PBS / M2-EX-SI-NC / M2-EX-SI-1 and oxaliplatin. Figure 10 Immunohistochemical detection of relevant indicators in gastric cancer cells before OXA injection following injection of PBS / M2-EX-SI-NC / M2-EX-SI-1, respectively. Figure 11 Immunohistochemical detection of relevant indicators in gastric cancer cells after simultaneous intraperitoneal injection of PBS / M2-EX-SI-NC / M2-EX-SI-1 and oxaliplatin.

[0103] Figure 8The results showed that the tumor size in the M2-EX-NC group was significantly larger than that in the PBS group alone, and the Lnc-MALAT1 knockdown group of the M2-EX-SI-1 group was significantly downregulated. A similar trend was observed in the chemotherapy-resistant group (+OXA), where the chemotherapy resistance of tumors in the M2-EX-NC group was significantly enhanced compared to the PBS group alone, while the chemotherapy sensitivity of the Lnc-MALAT1 knockdown group of the M2-EX-SI-1 group increased.

[0104] Figure 9 The results showed that the expression of glycolysis-related genes (PKM2, LDHA, HK2, GLUTA) and pathway-related genes (β-catenin; HIF-1α) in the tumors of mice in the M2-EX-NC group was significantly enhanced compared with that in the PBS group alone, and the expression of Lnc-MALAT1 knocked down in the M2-EX-SI-1 group was significantly reduced.

[0105] Figure 10 The results showed that the tumors in the M2-EX-NC group were more compact than those in the PBS and M2-EX-SI-1 groups, and the Ki67 results showed that the tumors in the M2-EX-NC group had enhanced proliferation ability compared to those in the PBS and M2-EX-SI-1 groups.

[0106] Figure 11 In the results, under the influence of chemotherapy drug (oxaliplatin), TUNEL results showed that after the addition of oxaliplatin, the tumors in the M2-EX-NC group of mice had increased drug resistance and reduced apoptosis compared with the PBS group and the M2-EX-SI-1 group. Ki67 results showed that after the addition of oxaliplatin, the tumors in the M2-EX-NC group of mice had weakened proliferation compared with the M2-EX-NC group without oxaliplatin, but the proliferation was enhanced compared with the PBS group and the M2-EX-SI-1 group that also added oxaliplatin.

[0107] Example 4

[0108] Both DSPE-PEG2000-cRGD and DSPE-PEG2K-M2pep were purchased from Shaanxi Zhongxiang Yunke Biotechnology Co., Ltd.

[0109] First, 293T cells were transfected with small interfering RNA (SI-MALAT1, as described in Example 2) / empty vector (NC) synthesized by Gemma. 293T-EX-si-MALAT1 / 293T-EX-si-NC were extracted by ultracentrifugation. 293T-EX-si-MALAT1 / 293T-EX-si-NC were co-cultured with DSPE-PEG2000-cRGD and DSPE-PEG2K-M2pep in a 37°C water bath for 30 min to obtain RGD; M2pep-293T-EX-si-MALAT1 / RGD; and M2pep-293T-EX-si-NC.

[0110] RGD was injected via tail vein; changes in mouse tumors were observed using M2pep-293T-EX-si-MALAT1, further revealing the role of ln-cMALAT1 in engineered M2-EX in gastric cancer progression and chemotherapy resistance:

[0111] After co-culturing HGC-27 cells with TAM-EX-NC cells for 24 hours, cells were digested with trypsin and counted. The cells were then resuspended in PBS to adjust the cell concentration to 5 × 10⁻⁶ cells / mL. 6 Cells / ml: Age-appropriate nude mice were selected and labeled according to different groups, with 5 mice in each group. 100 μL of cell suspension was drawn using a 0.5 mL syringe and inoculated into the right axilla of each mouse. After a visible xenograft appeared, the long and short diameters of the tumor were measured using electronic calipers to determine its growth rate. The tumor volume was calculated using the following formula: Volume = Long diameter × Short diameter² / 2. The tumors were allowed to grow to 200–300 mm. 3 At that time, mice were injected with PBS / RGD, M2pep-293T-EX-si-NC / RGD, and M2pep-293T-EX-si-MALAT via tail vein (once every 7 days for 4 consecutive times. The amount of exosomes to be injected was calculated based on the exosome concentration and mouse weight, and then the total volume (mL) was calculated. The concentration injected per mouse was 5 mg / kg. Then, OXA was injected intraperitoneally. The tumor size was observed and measured every 2 days. Nude mice were euthanized by cervical dislocation after 14 days. Subcutaneous xenografts were collected, weighed, and photographed. The corresponding indicators were detected by Western blotting, qRT-PCR, and histochemical analysis.

[0112] See results Figures 12-14 . Figure 12 The changes in tumor size in mice in each group were determined by tumor injection with PBS / RGD; M2pep-293T-EX-si-NC / RGD; M2pep-293T-EX-si-MALAT; and simultaneous intraperitoneal injection of oxaliplatin. Figure 13Tumor weight was measured in mice after each group was injected with PBS / RGD, M2pep-293T-EX-si-NC / RGD, M2pep-293T-EX-si-MALAT, and simultaneously injected with oxaliplatin. Changes in the expression of corresponding proteins in the tumors were also measured after intraperitoneal injection of PBS / RGD, M2pep-293T-EX-si-NC / RGD, M2pep-293T-EX-si-MALAT, and oxaliplatin. Figure 14 Immunohistochemical staining of gastric cancer cells was performed after injecting PBS / RGD, M2pep-293T-EX-si-NC / RGD, M2pep-293T-EX-si-MALAT into the tumor and simultaneously injecting OXA.

[0113] Figure 12 The results showed that the tumor size in mice treated with RGD;M2pep-293T-EX-si-MALAT was significantly smaller than that in the PBS group alone, while it was significantly larger in the RGD;M2pep-293T-EX-si-NC group. A similar trend was observed in the chemotherapy-resistant group (+OXA), where the chemotherapy resistance of tumors in mice treated with RGD;M2pep-293T-EX-si-MALAT was significantly lower than that in the PBS group alone, while chemotherapy sensitivity was increased in the RGD;M2pep-293T-EX-si-NC group.

[0114] Figure 13 The results showed that the expression of glycolysis-related genes (PKM2, LDHA, HK2, GLUTA) and pathway-related genes (β-catenin; HIF-1α) in the tumors of mice added to RGD; M2pep-293T-EX-si-MALAT group was significantly lower than that in PBS group alone, while it was significantly enhanced in RGD; M2pep-293T-EX-si-NC group.

[0115] Figure 14 The results showed that after treatment with RGD;M2pep-293T-EX-si-MALAT, the proliferation of tumors in mice was reduced and apoptosis was increased. When oxaliplatin was added at the same time, the chemotherapy sensitivity of mice treated with RGD;M2pep-293T-EX-si-MALAT increased.

[0116] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of an inhibitor of Lnc-MALAT1 expression in the exosomes of gastric cancer tumor-associated macrophages in the preparation of drugs for treating gastric cancer, characterized in that, The nucleotide sequence of Lnc-MALAT1 is shown in SEQ ID NO:1; the expression inhibitor of Lnc-MALAT1 is siRNA of the Lnc-MALAT1 gene; the nucleotide sequence of the sense strand of the siRNA is shown in SEQ ID NO:2, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:

3.

2. The application of an inhibitor of Lnc-MALAT1 expression in the exosomes of gastric cancer tumor-associated macrophages in combination with chemotherapeutic drugs in the preparation of drugs for treating gastric cancer, characterized in that... The nucleotide sequence of Lnc-MALAT1 is shown in SEQ ID NO:1; the expression inhibitor of Lnc-MALAT1 is siRNA of the Lnc-MALAT1 gene; the nucleotide sequence of the sense strand of the siRNA is shown in SEQ ID NO:2, and the nucleotide sequence of the antisense strand is shown in SEQ ID NO:

3. The chemotherapy drugs are cisplatin and oxaliplatin.

3. The application according to claim 1 or 2, characterized in that, The drug also includes a pharmaceutically acceptable carrier.

Citation Information

Patent Citations

  • Biomarker for predicting neoadjuvant chemotherapy curative effect of breast cancer and application of biomarker

    CN103602746A