Application of aquatic Rahnella in preparing preparations against plant take-all pathogens

Abstract

The invention discloses the application of aquatic Rahnella for preparing an anti-plant take-all pathogen preparation, and belongs to the technical field of plant protection. The invention uses a concentration gradient dilution separation method and a plate confrontation method, takes tobacco brown spot pathogen as a target bacterium, screens a biocontrol strain F3-3 from plant root tissue, and identifies it as aquatic Rahnella (Rahnella aquatilis) by morphology, 16S rDNA and other methods. After testing, the strain has antibacterial activity against plant take-all pathogen.

Description

Technical Field

[0001] The invention belongs to the technical field of plant protection, and in particular relates to the application of aquatic Rahnella in preparing an anti-wheat take-all pathogen preparation. Background Art

[0002] Take-all disease of plants or crops caused by Ascomycota graminearum var. tritici is a devastating fungal disease. It is a typical soil-borne root disease that occurs frequently in wheat-producing areas in my country, and is more severe in some areas, greatly affecting the yield and quality of wheat.

[0003] Take-all disease is caused by Ascomycota fungi. The pathogens identified so far mainly include G. graminis var. tritici, G. graminis var. graminis, and G. graminis var. avena. Among them, the plant that infects and causes take-all disease is G. graminis var. tritici (Ggt). Taking wheat as an example, the take-all pathogen can infect wheat throughout its growth period, and the symptoms are most obvious in the adult stage. In the seedling stage, the affected plants have more yellow leaves, fewer tillers, weak growth, and sometimes dwarfing. After wheat heading, the diseased plants in the field occur in clusters or spots, the leaves of the plants turn yellow, and the "white ear" symptoms appear. When the disease is serious, the diseased roots turn black and the plants are easy to pull up. When the weather is humid, the surface of the stem base and the leaf sheath are covered with tightly interwoven dark brown mycelium layers, like a layer of "black plaster" pasted on the stem base, commonly known as "black feet". The hyphae are sometimes densely covered with dark brown granular ascocarps, which seriously affect the yield of wheat.

[0004] At present, the prevention and control of diseases in production mainly rely on agricultural prevention and control and chemical prevention and control. Chemical prevention and control is widely used and practical, but it is easy to cause pesticide residues, pathogens to develop drug resistance, and pollute the environment. Agricultural prevention and control is time-consuming, labor-intensive, and cumbersome. Summary of the invention

[0005] The present invention adopts a concentration gradient dilution separation method and a plate confrontation method, takes tobacco brown spot pathogen as a target bacterium, and screens a biocontrol strain F3-3 from plant root tissue for the first time. The strain is identified as Rahnella aquatilis through morphology, 16SrDNA and other methods. The aquatic Rahnella (R.aquatilis) strain is numbered as F3-3. After testing, the strain has antibacterial activity against wheat take-all pathogen.

[0006] Based on the inventor's research findings, the present invention provides the use of aquatic Rahnella for preparing an anti-plant take-all pathogen preparation; the aquatic Rahnella is deposited with CGMCC No.28094.

[0007] Optionally, the plant is wheat.

[0008] Optionally, the concentration of aquatic Rahnella in the preparation is 1×10 1 cfu / mL~1×10 2 cfu / mL. BRIEF DESCRIPTION OF THE DRAWINGS

[0009] Figure 1 The colony morphology of R.aquatilis F3-3 in Example 1 of the present invention on different culture media, wherein A and B are respectively the streak culture and colony morphology of F3-3 strain on TSB plate, and C and D are respectively: the streak culture and colony morphology of F3-3 strain on PDA plate;

[0010] Figure 2 The figure is a diagram of the antagonistic effect of the plate confrontation test between R aquatilis F3-3 and tobacco brown spot pathogen in Example 1 of the present invention; wherein figure A is a control figure inoculated with tobacco brown spot pathogen only, and figures B, C, and D are three groups of repetitions inoculated with aquatic Rahnella;

[0011] Figure 3 The figure is a diagram of the antagonistic effect of the plate confrontation test between R aquatilis F3-3 and wheat take-all pathogen in Example 1 of the present invention; wherein Figure A is a control figure inoculated with only wheat take-all pathogen, and Figures B, C, and D are three groups of repetitions inoculated with Rahnella aquatica;

[0012] Figure 4 The phylogenetic tree was constructed by multi-gene joint construction using MEGA for the gyrB, rpoB, atpD, and infB genes of R. aquatilis F3-3 and related species in Example 1 of the present invention;

[0013] Figure 5 The bioassay activity of the R. aquatilis F3-3 strain in Example 2 of the present invention was plotted using GraphPad with the logarithm of the concentration as the abscissa and the inhibition rate as the ordinate. DETAILED DESCRIPTION

[0014] Unless otherwise specified, the scientific and technical terms used herein are understood according to the knowledge of ordinary technicians in the relevant fields.

[0015] The aquatic Rahnella aquatilis of the present invention is numbered F3-3 and was deposited on August 4, 2023 at the General Microbiology Center of the China Culture Collection Administration, address: No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, China, with a deposit number of CGMCC No. 28094.

[0016] Raenella belongs to the Proteobacteria, γ-Proteobacteria, Enterobacteriales, Yersiniaceae, and Raenella. Raenella is an aerobic or facultative anaerobic fermentation type Gram-negative bacterium with flagella all over the body, no spores, no or with capsule, small rod-shaped cells, non-motile at 36℃; motile when growing at 25℃. It is mainly used for classification, research and teaching. Its specific use is as an organic pollutant degrading bacterium and polycyclic aromatic hydrocarbons (PAHs) degrading bacterium. Most strains are methyl red positive; all strains are VP positive. Its type species is aquatic Raenella.

[0017] The aquatic Rahn's bacterium of the present invention has a significant effect on preventing and treating plant fungal diseases. The following examples are used to explain the present invention in detail by taking the tobacco brown spot pathogen (Alternaria alternate) as a representative of the plant pathogenic fungi.

[0018] Example 1: Isolation, purification and identification of aquatic Rahnella of the present invention:

[0019] 1 Materials and Methods

[0020] 1.1 Test strains and culture medium

[0021] Test strain: Tobacco brown spot pathogen (Alternaria alternate), which was provided by the College of Plant Protection, Northwest Agriculture and Forestry University. Culture medium:

[0022] Potato dextrose agar medium (PDA medium): 200 g peeled potatoes, 20 g glucose, 20 g agar powder, 1000 mL distilled water, pH is natural value. The peeled potatoes are cut into small pieces and boiled for 20 minutes, and the filtrate is filtered through 3 layers of gauze to obtain the filtrate as the culture medium component.

[0023] Tryptone Soy Broth (TSB): 1 / 2 TSB solid medium: Dissolve 15g TSB and 20g agar powder in 1000mL distilled water, pH is natural. 1 / 2 liquid TSB medium does not contain agar powder.

[0024] 1.2 Isolation and purification of bacteria

[0025] Tobacco rhizosphere soil samples were collected from diseased tobacco fields in Shangluo City (Luonan County and Zhen'an County), Ankang City (Xunyang City and Hanbin District) and Nanzheng District of Hanzhong City, Shaanxi Province. The obtained candidate bacteria with differences were diluted 5 times with a gradient of 20 times through screening with different concentration gradients and high-throughput separation and culture (the culture medium used was TSB culture medium). 100 μl of the dilution was spread on a 1 / 2 solid TSB culture medium plate, and each dilution was repeatedly spread on 3 plates and cultured at 28°C for 2 days. The dilution was preferably 30-100 colonies on each plate, and single colonies with different colony morphologies were picked for purification on a 1 / 2 TSB solid culture medium plate, and stored at -80°C after purification three times.

[0026] 1.3 Biocontrol bacteria screening

[0027] The bacterial monoclonal obtained by the above purification was picked up and shaken with 1 / 2 liquid TSB medium, and cultured at 28°C and 180 rpm for 12 h until turbidity to obtain bacterial culture solution; Tobacco brown spot pathogen was used as the target bacteria for biocontrol bacteria screening, and the activated tobacco brown spot pathogen was inoculated into the center of a new PDA medium plate, and 5 μl of bacterial culture solution (OD 600 =1.0) was dropped around the pathogen at a distance of 2 cm from the center for three times, with sterile water as a control; the mixture was incubated upside down at 28°C for about 5 days, the antibacterial effect was observed, and the three strains with antagonistic effects were further purified and preserved.

[0028] 1.4 Determination of antagonistic activity of biocontrol bacteria against pathogenic fungi

[0029] The pathogenic fungus was cultured on a plate until it was in a state of good vitality. A fresh bacterial cake was taken with a hole puncher and inoculated into the center of a new PDA plate. The plate was cultured at 28°C for 2 days. At the same time, the antagonistic strain obtained above was shaken to obtain bacterial culture liquid. 10 μl (1×10 8 cfu / mL) were streaked on a 1 / 2 solid TSB medium plate. After 2 days, a 5 mm bacterial cake was punched out on the streak culture bacterial plate with a hole puncher and inoculated around 2 cm from the center of the pathogenic fungus. This process was repeated three times, with sterile water as a control. The plate was inverted and cultured in a 28°C incubator for about 5 days. The test results were observed and recorded, and the single colony of aquatic Rahnella F3-3 with the largest inhibition zone was selected as the target biocontrol bacteria.

[0030] 2 Identification of biocontrol bacteria strains

[0031] 2.1 Colony morphology observation

[0032] Colony morphology: Take 5 μl of the aquatic Rahnella F3-3 bacterial solution and spot it in the center of TSB and PDA culture media, culture at 28℃ for 2 days, and observe the morphology. Figure 1As shown, on PDA medium, the colonies are off-white with smooth edges and a bulge in the middle; on TSB, the colony morphology is similar to that on PDA agar plates, but the colonies are more rounded and moist.

[0033] 2.2 Determination of antagonistic activity of biocontrol bacteria against pathogenic fungi

[0034] like Figure 2 As shown, the F3-3 strain has an antagonistic effect on the tested red star pathogenic fungi. After three repetitions, its antibacterial effect is good, and the diameter of the inhibition zone is above 1.5 cm. It has a significant inhibitory effect on tobacco red star pathogenic fungi.

[0035] 2.3 Identification of bacterial species using 16S rDNA and housekeeping genes gyrB, rpoB, atpD, and infB

[0036] The 16S rDNA of strain F3-3 was amplified using bacterial universal primers 27F (5'-AGAGTTTGATCCTGGCTCAG-3') and 1492R (5'-TACGGCTACCTTGTTACGACTT-3') (Qingke Biotechnology), and the target band was about 1500 bp.

[0037] PCR reaction system (20 μl): 2× Rapid Taq Master Mix 10 μl; forward primer (10 μm) 1 μl; reverse primer (10 μm) 1 μl; gDNA (10 ng / L) 3 μl; ddH2O 5 μl.

[0038] PCR reaction conditions: pre-denaturation at 95°C for 10 min, denaturation at 95°C for 20 s, annealing at 56°C for 30 s, extension at 72°C for 1 min, 35 cycles, and post-extension at 72°C for 5 min.

[0039] The PCR reaction product was detected by 1% agarose gel electrophoresis, and compared with the DL2000 bp marker, the fragment was about 1500 bp. The PCR product containing the target fragment was sent to Qingke Biotechnology Company for sequencing, and the obtained sequence length was 1404 bp.

[0040] The obtained sequences were compared with the NCBI nucleic acid database for homology analysis. Figure 3 As shown, the results showed that strains with similar 16S rDNA sequences to this strain were mostly known Rahnella strains, and the 16S rDNA sequence similarity between the F3-3 strain and the Rahnella sp. strain was as high as 100%, further confirming the species of the strain F3-3.

[0041] The universal primers for housekeeping genes gyrB, rpoB, atpD, and infB were used to further sequence the gyrB, rpoB, atpD, and infB sequences. Some strains with high similarity were selected for phylogenetic analysis with the gene sequences of the F3-3 strain, and the phylogenetic tree was constructed using the neighbor-joining method in the MEGA software, as shown in Figure 2. Figure 3 As shown, the results showed that F3-3 was closest to Rahnella aquatica in genetic distance. Based on the results of homology comparison and phylogenetic analysis, the F3-3 strain was an aquatic Rahnella.

[0042] The 16S rDNA sequence of R. aquatilis F3-3 is 1404 bp in length and is as follows:

[0043]

[0044] The gyrB, rpoB, atpD, and infB sequences of R. aquatilis F3-3, with lengths of 701 bp, 599 bp, 644 bp, and 645 bp respectively, are as follows:

[0045] The gyrB sequence of R. aquatilis F3-3:

[0046] GGGCTTTTCGCGACTTTCGCGCGCATAGCTTTATCACAACATCATCTGAGCGGAACGGACAGATTCTTAAGTGAATGGGTGCTCAGATTGTGATAACGATAATTATGCAGCAGCCAGTTCTTTGATGGCGGCATCGATTGCTGCTTTCGCATCAGTCTGAGCTTTGGTCGCCACTTCAGGACCGTACGCAATACCTTCCGCGTAAACGAATTCTACGTCGCTCATCCCCAGGAAGCCCAGGAACAGAGACAGGTATGGGGCAACCAGGTCGCTTGGGGTGTCTTTATGAATACCACCACGGCTGGTCAGAACGATAACGCGTTTGCCTTTCACCAGACCTTCAGGGCCTTTCTCGGTGTATTTGAAGGTCACGCCAGCACGGGCAACCAGGTCGAAATATGTTTTCAGCTGAGTCGGGATGTTGAAGTTGTACATGGGTGCAGCGATAACGATCACGTCATGCGCCTGCAGTTCGTCAATCAGGGTGTTAGACAGCGCCAGTGCTTCTTCCTGACGTGGCGTCAGCGGAGCATCGGAAGGACGCAGTGCGCCAACCAGTTCGCCATCTAATACAGGGACTGGGTTAGCCGCCAGGTCACGAACTGTCACGGCAGAACCGCTGTTTGCAGACTGATACTGTGCAATCAGGTAATCGGCCAGTTGATTTGACTGAAAAATTTTTCCCCCCAAAAAAAGTTTGG;

[0047] The rpoB sequence of R. aquatilis F3-3:

[0048] TGGGCCAATGCTTTTCGGCGGCTTCATCATGTAATCATGTAACGTGCTGTAGGCGTGGGTGCTGGCAACGGTATGCATATGTAAATCAACCGGGTAAGGCATGTACTCTCCTTGAAAGTATTCCGCTGCGGCAACATAACCGCAGCATTTATAATGTTAGCAGATGAATATCAGTAACCCCGGCCGGGATCGACACGTCCCGTCGGCTCGCGCCCTGCCTCTATCGCCAGAATGTTACTCACGATGCTGTCCATCGCCTGCTCCGGCAACGTATCCGCACCGACGTGTGGCGTGATGCTGACCCGCGGATGCGACCAGAACGGGTGCATGCCCGGCAACGGTTCTTCAACGAAAACGTCGAGCGTGGCAGCGGCAATCTGCCCGCTGTCGAGCGCACGCAGCAAATCGCCTTCCACCAGATGTCCGCCACGACCAAGGTTAATCAGGTACGCATTATGCGAAAGATTTGTGAACAGTTTATGATTGAGAACACCGGCGGTGTGCGGCGTGTTGGGCAACAGATTGATCAGCACTTTGCAGCCGCTGGCAAACGCTGCCAACCGATCGTCACCTAGAAAACCTCTCAACGTGGTCTGTTG;

[0049] The atpD sequence of R. aquatilis F3-3:

[0050] GGCTTTTAGTAGATGCTTGCGTCGGTGCTGATCCTGCTGGGGTATTCGATCATCGCCGTGCCGACCGGGATTTTAACGGCTTATATGTCGCAGGAATTGGAAAAAGGGCGTGCTGCCCGTTCTTGTCAGACTTGTCTGCATTCTGGCCATGAAATAGATGCAAAATTTTGCGCACATTGCGGAGCGGTCTTAGCGGCCGATAAACCACAACCTGTTGAAAAATAGCCTGATAACTGTACATCTATTGAACTGTTCGGTACAAAATTAGACTAATTTCGCGCTTTACCGCAGCATTGCATTAAAAAGAGTTGCTATTAAAGGGCAGTCATGAGTAAATACATACCGGCCTGTGGTACAGACCTATTTATGCACGACATCCTGAGTAAAGTTGTTCCAATTTAAAGCGTTATCCATGATAACCCTGCTCTGACGAATTTCCTTCTTAGTGCCTCCATAAGTAACGACTGAAATCCGGCTATAACATGCCCATGGTGGCGAAATTTATTTTTAAAAGGTAATTCTTATGTCAATGATGAAAGGTCAGGTTAAGTGGTTTAACGAGTCTAAAGGCTTTGGCTTCATCACTCCTGCTGACGGCAGCAAAGATGTGTTCGACTCCCCCCGGTCAAAAAAAAAAAAGAAGT;

[0051] The infB sequence of R. aquatilis F3-3:

[0052] .

[0053] 2.4 Determination of antagonistic activity of biocontrol bacteria against take-all pathogenic fungi

[0054] like Figure 3 As shown, the F3-3 strain has an antagonistic effect on the plant take-all pathogenic fungus (Graminae graminearum wheat variant strain, which was provided by the College of Plant Protection, Northwest Agriculture and Forestry University). After three repetitions, its antibacterial effect was good, and the diameter of the inhibition zone was above 1.5 cm, which had a significant inhibitory effect on wheat take-all pathogen.

[0055] Example 2: Indoor bioassay of R. aquatilis F3-3 strain

[0056] The aquatic Rahnella F3-3 strain has a significant inhibitory effect on the plant (wheat) take-all pathogen, Gramina graminearum var. tritici (the strain was provided by the College of Plant Protection, Northwest Agriculture and Forestry University).

[0057] The effective median concentration (EC) of strain F3-3 for inhibiting the growth of wheat take-all pathogen was calculated by the mycelium growth rate method. 50 ). The antibacterial rate of each dilution concentration of bacterial solution was calculated by comparing the colony diameters of pathogens on the control plate and each dilution plate (Table 1). The graph was drawn with the logarithm of the concentration as the horizontal axis and the antibacterial rate as the vertical axis ( Figure 4 ).Depend on Figure 4 From Table 1, we can conclude that 1×10 8 The effective median concentration (EC) of aquatic Rahn's bacteria solution against wheat take-all pathogen in an indoor bioassay experiment 50 ) is 1×10 0.6 cfu / mL.

[0058] Table 1

[0059]

[0060]

[0061] The above description is only a preferred embodiment of the present invention. All equivalent changes and modifications made according to the scope of the patent application of the present invention are within the scope of the present invention.

Claims

1. Application of aquatic Rahnella for preparing an anti-plant take-all pathogen preparation; the aquatic Rahnella (Rahnella aquatilis) has a preservation number of CGMCC No.28094.

2. The use according to claim 1, characterized in that: The plant is wheat.

3. The use according to claim 1, characterized in that: The concentration of aquatic Rahnella in the preparation is 1×10 1 cfu / mL~1×10 2 cfu / mL.

Images