A SNP genetic marker downstream of the SUN5 gene associated with pig sperm freezing tolerance and its application

Abstract

The present invention provides a SNP genetic marker downstream of the SUN5 gene associated with pig sperm freeze tolerance, belonging to the technical field of pig genetic marker detection. The SNP genetic marker is named SUN5DOWN239 and is located at the 36507861bp nucleotide position on pig chromosome 17 of the International Porcine Genome Version 11.1 reference sequence. The base at this position is G or C. The SUN5DOWN239 is located 239bp downstream of the SUN5 gene, corresponding to the 76bp position in the nucleotide sequence shown in SEQ ID NO:1. This SNP genetic marker can help improve the quality of frozen semen of boars, provide a new marker resource for auxiliary selection of boars, and can be used in boar genetic breeding. The present invention also provides an application of a SNP genetic marker downstream of the SUN5 gene associated with pig sperm freeze tolerance in pig genetic breeding.

Description

Technical Field

[0001] The present invention belongs to the technical field of pig genetic marker detection, and particularly relates to a SNP genetic marker downstream of the SUN5 gene associated with pig sperm freeze resistance and an application thereof. Background Art

[0002] Semen cryopreservation technology is widely used in pig genetic resource conservation, breeding, and production. For boars selected for excellent economic traits over decades, using semen cryopreservation technology to preserve their semen can free artificial insemination from time and space constraints, improve the utilization efficiency of excellent boars, and achieve greater genetic progress. During the semen cryopreservation process, low temperatures can easily cause chemical and physical damage to sperm, potentially resulting in poor quality of frozen semen, manifested as decreased sperm motility, fertilization ability, and litter size after thawing. This seriously impacts pig genetic resource conservation and the sales of frozen semen products, hindering the industrial development of frozen semen and breeding progress on pig farms.

[0003] Frozen semen quality is related to factors such as boar genetics, feed nutrition, semen collection season, frequency of semen collection, the composition of the cryopreservative, and the semen freezing procedure. Currently, most research on improving frozen semen quality focuses on proteins associated with sperm freeze tolerance. For example, at the protein level, heat shock proteins, calcium signaling pathway-related proteins (VDAC 2, PI-PLC, and GRM1), sperm cytoskeleton regulation proteins (PFN1, BAIAP2, and EGF), and acrosomal proteins (CTSB, HEXB, and Legumain) have been discovered and identified as correlates of frozen semen quality. By adding sperm freeze tolerance-related proteins to cryopreservatives, the composition of the cryopreservatives is optimized to improve sperm tolerance to low temperatures, thereby enhancing frozen semen quality. However, these approaches are limited to maintaining frozen semen quality at a comparable level to fresh semen quality and do not fundamentally improve the quality of boar frozen semen. Therefore, from the perspective of individual genetics of boars, exploring and identifying genes and markers that affect the freezing resistance of pig sperm at the molecular level, and using SNP genetic markers to screen excellent boars with high sperm freezing resistance will essentially improve the quality of boar frozen semen.

[0004] Existing research is basically focused on SNP genetic markers associated with boar fresh semen vitality. For example: (1) SNP in the third exon of the CATSPER4 gene as a genetic marker for pig semen quality traits (Application Publication No.: CN109837347 A), the invention relates to the association between SNP in the third exon of the CATSPER4 gene and pig sperm density, sperm vitality, and sperm deformity rate; (2) Molecular genetic markers associated with boar sperm deformity rate and their application and acquisition methods (Application Publication No.: CN 110144414A), the invention relates to the association between the T>C mutation at the 8647231bp position of chromosome 3 of pig and the pig sperm deformity rate; (3) Molecular genetic markers associated with boar sperm linear motion and their application and acquisition methods (Application Publication No.: CN 110195115 A), the invention relates to molecular markers related to the T>C mutation at position 136112947bp of chromosome 15, the A>G mutation at position 18505448bp of chromosome 3, and the C>T mutation at position 63272581bp of chromosome 11, which are related to the linear motion of boar sperm; (4) SNP markers related to the effective sperm count of boars and methods for obtaining and using the same (application publication number: CN 110273007 A), the invention relates to five molecular markers related to the effective sperm count of boars, including ASGA0105629, H3GA0010032, ALGA0024878, WU_10.2_8_31060162, and WU_10.2_9_11535520; (5) A SNP genetic marker associated with semen quality traits of pigs and its application (application publication number: CN 113215277 A), the invention relates to the association of a SNP genetic marker in the 7th exon of the SPAG6 gene with pig semen volume, sperm density, sperm motility and sperm deformity rate; (6) C7H15orf39 gene SNP molecular marker associated with pig semen quality traits and its application (application publication number: CN 113930521 A), the invention relates to a TaqI-RFLP polymorphism caused by a G>T base substitution at base 281 of the C7H15orf39 gene fragment, which shows that the sperm motility trait of individuals with the TT genotype is the best; (7) A molecular marker method related to the trait of boar sperm deformity rate (application publication number: CN 115831220A), the invention uses a molecular marker of the A / G mutation at 163993991bp on chromosome 6 of pigs for marker-assisted selection, which can greatly accelerate the genetic improvement of sperm deformity rate in Duroc breeding pigs; (8) SNP molecular markers, primer pairs and applications related to boar semen quality traits in the ATP11A gene (application publication number: CN 116790764A), the invention discloses a SNP molecular marker, primer pairs and applications related to boar semen volume, sperm density and sperm motility traits in the ATP11A gene.

[0005] Currently, most inventions focus on research into SNP genetic markers associated with boar semen vitality, including sperm density, motility, linear motility, and deformity rates. However, there are no related inventions or technologies for identifying SNPs associated with boar sperm freeze tolerance or improving the quality of frozen boar semen. Summary of the Invention

[0006] In order to solve the problem of poor quality of frozen boar semen, the present invention provides a SNP genetic marker downstream of the SUN5 gene that is associated with the freezing resistance of pig sperm. The SNP genetic marker is associated with the freezing resistance of pig sperm and is located 239bp downstream of the SUN5 gene. The SNP genetic marker can help improve the quality of frozen boar semen, provide a new marker resource for auxiliary selection of boars, and can be used for genetic breeding of boars.

[0007] The present invention also provides an application of a SNP genetic marker downstream of the SUN5 gene associated with the freezing resistance of pig sperm in pig genetic breeding.

[0008] The present invention is achieved through the following technical solutions:

[0009] The present invention provides a SNP genetic marker downstream of the SUN5 gene associated with the freezing resistance of pig sperm. The SNP genetic marker is named SUN5DOWN239 and is located at the 36507861bp nucleotide position of pig chromosome 17 in the international pig genome version 11.1 reference sequence. The base of this position is G or C. The SUN5DOWN239 is located 239bp downstream of the SUN5 gene, corresponding to the 76bp in the nucleotide sequence shown in SEQ ID NO:1.

[0010] Furthermore, the pig breed includes at least one of Duroc pig, Landrace pig and Large White pig.

[0011] Furthermore, the dominant genotype of SUN5DOWN239 is GG.

[0012] Based on the same inventive concept, the present invention provides an application of a SNP genetic marker downstream of the SUN5 gene associated with pig sperm freezing resistance in pig genetic breeding.

[0013] Based on the same inventive concept, the present invention provides an early selection method for the freezing resistance trait of pig sperm, which comprises performing early selection on the freezing resistance trait of pig sperm based on the genotype of the SNP genetic marker SUN5DOWN239.

[0014] Furthermore, the early selection method specifically includes:

[0015] Detect the genotype of the pig SNP genetic marker SUN5DOWN239 to be tested;

[0016] Performing early selection for the sperm freeze-tolerance trait of the tested pigs based on the genotype of SUN5DOWN239;

[0017] Among them, the freezing resistance of sperm of the GG genotype individual of SUN5DOWN239 is higher than that of the GC genotype individual; the freezing resistance of sperm of the GC genotype individual of SUN5DOWN239 is higher than that of the CC genotype individual.

[0018] Furthermore, the genotype of the pig SNP genetic marker SUN5DOWN239 to be tested is specifically detected, including:

[0019] The genomic DNA of the pig to be tested was amplified by PCR using forward primer F1 and reverse primer R1;

[0020] The PCR amplification product was sequenced to obtain the genotype of the 36507861bp nucleotide site on the pig chromosome 17 to be tested;

[0021] The nucleotide sequence of the forward primer F1 is shown in SEQ ID NO.2; the nucleotide sequence of the reverse primer R1 is shown in SEQ ID NO.3.

[0022] Based on the same inventive concept, the present invention provides primers for detecting the SNP genetic marker SUN5DOWN239, the primers comprising a forward primer F1 and a reverse primer R1, the nucleotide sequence of the forward primer F1 being shown in SEQ ID NO.2; the nucleotide sequence of the reverse primer R1 being shown in SEQ ID NO.3.

[0023] Based on the same inventive concept, the present invention provides the use of primers for detecting the SNP genetic marker SUN5DOWN239 in pig genetic breeding.

[0024] Based on the same inventive concept, the present invention also provides a kit comprising primers for detecting the SNP genetic marker SUN5DOWN239.

[0025] Based on the same inventive concept, the present invention also provides the use of the above-mentioned kit in pig genetic breeding.

[0026] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0027] The present invention discloses a SNP genetic marker downstream of the SUN5 gene that is associated with the freezing resistance of pig sperm. The SNP genetic marker is associated with the freezing resistance of pig sperm and is located at the 239bp position downstream of the SUN5 gene. Its dominant genotype is GG, and it provides a new marker resource for the auxiliary selection of boars. The SNP genetic marker is applied to the genetic breeding of boars to assist in the screening of individual boars with high sperm freezing resistance, thereby substantially improving the quality of frozen semen of boars and increasing the utilization rate of high-quality boars, thereby maximizing the economic benefits of pig farming enterprises. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following is a brief introduction to the drawings required for use in the description of the embodiments. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0029] Figure 1 This is an agarose gel electrophoresis detection diagram of the PCR amplification product in step S2 of Example 4 of the present invention.

[0030] Figure 2 This is the sequencing map of the SUN5DOWN239 site in step S3 of Example 4 of the present invention. DETAILED DESCRIPTION

[0031] The present invention will be described in detail below in conjunction with specific embodiments and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific embodiments and examples are for illustrating the present invention, rather than for limiting the present invention.

[0032] Throughout this specification, unless otherwise specified, the terms used herein should be understood as having the same meaning as commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. In the event of any conflict, the present specification shall take precedence.

[0033] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0034] The overall idea of ​​the present invention is as follows:

[0035] Most current inventions focus on research into SNP genetic markers associated with boar semen vitality, including sperm density, motility, linear motility, and deformity rates. However, there are no related inventions or technologies for identifying SNPs associated with boar sperm freeze tolerance or improving the quality of frozen boar semen.

[0036] Based on this, the present invention investigated and explored SNPs associated with boar sperm freeze tolerance. Initially, genome resequencing was performed on 25 boar individuals with high sperm freeze tolerance (frozen sperm motility ≥ 0.6) and 25 individuals with low sperm freeze tolerance (frozen sperm motility ≤ 0.4). Using bioinformatics analysis, the genetic differentiation index (Fst) was calculated, and a G / C mutation at 36,507,861 bp on chromosome 17 was discovered. This mutation showed significant genetic differentiation between the high and low sperm freeze tolerance groups, with an Fst of 0.36. SUN5 is an important nuclear membrane protein and a member of the SUN (Sad1 and UNC-84) family. SUN5 is specifically expressed in male germ cells. During spermatogenesis, SUN5 is first expressed in the nuclear membrane and then translocated to the coupling mechanism between the sperm head and tail during sperm head elongation and differentiation, functioning to connect the sperm head and tail. The mutation is located 239 bp downstream of the SUN5 gene. At present, there is no report on whether this mutation site is related to sperm freeze resistance and whether it can improve the quality of frozen semen of boars.

[0037] The SNP genetic marker downstream of the SUN5 gene associated with the freezing resistance of pig sperm provided by the present invention is obtained based on the analysis of genome resequencing data of 50 individual boars with high and low sperm freezing resistance to mine SNP genetic markers, and is further verified in a group of nearly 400 boars. This increases the accuracy and reliability of the SNP genetic marker downstream of the SUN5 gene associated with the freezing resistance of pig sperm and its application in the present invention, and can realize biological detection of the frozen semen quality of boars at the molecular level, provide new genetic markers for assisted selection breeding of boars, screen boars with high sperm freezing resistance, essentially improve the quality of frozen semen of boars, and increase the utilization rate of high-quality boars, thereby maximizing the economic benefits of pig farming enterprises.

[0038] The following will describe in detail a SNP genetic marker downstream of the SUN5 gene associated with pig sperm freeze resistance and its application in combination with examples and experimental data.

[0039] Example 1

[0040] The acquisition of the SNP genetic marker SUN5DOWN239 associated with pig sperm freezing resistance includes the following steps:

[0041] 1. Collect boar semen and extract genomic DNA

[0042] Boars were aged 1–3 years, were physically strong, and had good reproductive performance. Before semen collection, semen collection tools, including the cup, gloves, and bag, were disinfected. The area around the penis was disinfected and cleaned with a low-concentration potassium permanganate solution. The hair around the penis was trimmed, and semen was collected manually using the manual grip method. During semen collection, the colloidal semen from the early stages of ejaculation was discarded. Once the semen turned milky white, it was filtered through sterile filter paper and collected into a cup containing a semen collection bag. Genomic DNA was extracted from boars using the PureLink™ Pro96 Genomic DNA Purification Kit (K182104A), an animal tissue genomic DNA extraction kit manufactured by Invitrogen. The extracted DNA was tested for concentration and quality and stored at -20°C until further use. Semen samples were collected from 400 pigs, and genomic DNA was extracted.

[0043] 2. Collect sperm freeze tolerance phenotypic data

[0044] (1) Fresh semen vitality detection and semen cryopreservation

[0045] The beakers and glass rods used for semen dilution were disinfected in advance, and the slides and coverslips were placed on the heating stage of the CASA sperm assisted analyzer (Fuzhou Hongshiyi) in advance for preheating at 37°C. The diluent was prepared in advance and placed in a water bath for preheating at 37°C. After collecting fresh semen, the temperature of the semen and the frozen diluent was measured using an electronic thermometer. When the temperature was consistent, 0.1mL of fresh semen was drawn and added to 0.9ml of preheated diluent for a 1:9 dilution. After gently inverting to mix, 5μL was drawn and dropped onto the slide, covered with a coverslip, and the sperm density and motility were detected using the above-mentioned CASA sperm analyzer. This is the sperm motility data of fresh pig semen, and it was recorded. If all 400 samples passed the microscopic examination, the remaining semen was added to the 37°C preheated frozen diluent in a 1:1 ratio, gently mixed, and allowed to stand at room temperature at 25°C for about 1h.

[0046] After the standing period, the semen was gently shaken to prevent sperm from being dead. The semen was then placed in a programmed cooling apparatus (Beijing Tianyuan Aorui), and the cooling program was set to slowly cool the temperature to 17°C within 1-2 hours. After the cooling was completed, the supernatant was removed by centrifugation at 800g / min for 10-15 minutes at 17°C, and the sperm was resuspended with frozen basic solution I (Beijing Tianyuan Aorui) pre-cooled at 17°C to make the sperm density reach 2 billion / mL. The semen was then placed in a programmed cooling apparatus (Beijing Tianyuan Aorui) for cooling and balancing. The semen was slowly cooled to 4°C in 2.5-3.0 hours and balanced at 4°C for 0.5-1.0 hours. After balancing, frozen basic solution II (Beijing Tianyuan Aorui) was added, mixed, and immediately That is, the straw canning operation is performed using a semen canning machine (Germany Minitube) in a low-temperature operating cabinet (Germany Minitube); then, according to the technical requirements of the program freezer (Beijing Tianyuan Aorui), the freezer is started to reduce the chamber to 4-5°C, and the canned semen straws are placed in, and the semen straw freezing reference program is called for cooling. The specific program is: 4°C, constant temperature pre-cooling; 1°C, cooling for 1.5 minutes, rate -2°C / min; -26°C, cooling for 2.4 minutes, rate -30°C / min; -140°C, cooling for 6.2 minutes, rate -30°C / min; -140°C, constant temperature for 21.2 minutes; and then put into the liquid nitrogen tank.

[0047] (2) Semen thawing and frozen semen vitality testing

[0048] Thaw the frozen straws in a 50°C water bath for 16 seconds. Cut off the ends of the straws and transfer the semen to a 15mL centrifuge tube. Dilute with 37°C preheated thawing buffer at a ratio of 1:8. After thawing at 37°C for 15-20 minutes, assay the thawed sperm motility under a CASA microscope. Thaw at least three straws per individual, and perform at least three motility assays on each straw.

[0049] (3) Screening for individuals with extreme sperm freeze resistance

[0050] Following the above steps, the motility of fresh and frozen semen of 400 boars was tested. The sperm recovery rate was used to reflect the sperm freeze-resistance phenotype. The formula is as follows:

[0051]

[0052] Among them, x i is the sperm recovery rate of the i-th individual, Y i is the frozen sperm vitality of the i-th individual, X i is the freshness and vitality of the i-th individual.

[0053] In order to eliminate the influence of different test batches on the sperm motility test results, the Z-score method was used to standardize sperm motility. The formula is as follows:

[0054]

[0055] Among them, Z i represents the standardized score of sperm recovery rate of individual i, x i represents the sperm recovery rate of the i-th individual, μ represents the mean of the sperm recovery rate of all individuals in each batch, and σ represents the standard deviation of the sperm recovery rate of all individuals in each batch. The σ formula is as follows:

[0056]

[0057] Where σ represents the standard deviation of sperm recovery rate of all individuals, N is the number of individuals, x i is the sperm recovery rate of the ith individual, and μ represents the mean of the sperm recovery rates of all individuals in each batch.

[0058] The 400 individuals were sorted according to the Z value, and the first 25 individuals with high Z values ​​were selected, indicating a high sperm recovery rate, as the sperm freeze-resistant group. The last 25 individuals with low Z values ​​were selected, indicating a low sperm recovery rate, as the sperm freeze-intolerant group.

[0059] 3. Mining molecular markers related to sperm freezing tolerance based on genome resequencing

[0060] (1) Genome resequencing

[0061] According to the standard library construction process of Illumina's TruSeq DNA PCR-free prep kit reagent, genome resequencing libraries were constructed from genomic DNA of 50 pigs in the sperm freeze-resistant group and the sperm freeze-intolerant group. 10× deep resequencing was performed on the Novasek-PE150 platform to obtain raw sequencing data.

[0062] (2) Raw data processing

[0063] The raw data were filtered using the fastp (v0.20.0) program using the following criteria: 3'-end adapter contamination was removed; quality filtering was performed using a sliding window method with a window size of 5 bp and a step size of 1 bp. Each time the window moved forward one base, the average Q value of the window was calculated for 5 bases. If the Q value of the last base was ≤2, only the bases before that position were retained. If the average Q value of the window was ≤20, only the bases before and after the penultimate base in the window were retained. If the length of any paired-end read was ≤50 bp, the paired-end read was removed. The results showed that a total of 3.2 billion high-quality reads were obtained from the 20 individuals. These reads were aligned to the Sus Scrofa 11.1 reference genome using BWA software, with an average alignment rate of 99.31% and an average sequencing coverage depth of 7.13 (range, 6.45-7.90).

[0064] (3) Analysis of genomic variation and calculation of genetic differentiation index between sperm cryoresistant and cryoresistant groups

[0065] SNP mining was performed using samtools software on the genome resequencing data from 50 pigs, yielding a total of 26,323,490 high-quality SNPs. To identify molecular markers associated with sperm freeze tolerance, population genetic differentiation (Fst) analysis was performed based on SNP genotype information. Fst represents the degree of genetic differentiation between subpopulations within a population, with Fst values ​​generally ranging from 0 to 1. A smaller Fst value indicates less genetic differentiation between subpopulations. A value of 0 indicates that all individuals within the two subpopulations can freely mate with each other, resulting in minimal genetic differentiation. A larger Fst value indicates greater genetic differentiation between subpopulations. A value of 1 indicates no shared genetic diversity between the two subpopulations.

[0066] The distribution of θπ (θπ, freeze-tolerant group / freeze-intolerant group) and Fst values ​​was used to detect regions in the genome that were significantly selectively eliminated. Regions with extremely low or high θπ ratios (1% left tail and 1% right tail) and significantly high Fst values ​​(i.e., those with Fst in the top 1%) were selected as regions with strong selective elimination.

[0067] (4) Screening for the SUN5DOWN239 genetic marker for sperm freeze tolerance

[0068] Based on the above analysis, a total of 150,217 SNPs were discovered and annotated to 5,632 genes. To further screen for molecular markers related to sperm freeze tolerance, the above genes were subjected to the following functional analysis and filtering: comparison with the International Mouse Phenotype Consortium (IMPC) database screened out 709 genes potentially related to sperm function, of which 209 genes were shared by two or three breeds. GO analysis results showed that these genes were mainly enriched in pathways such as spermatogenesis and sperm development. Through literature indexing and gene haplotype analysis, it was finally determined that the SUN5DOWN239 genetic marker was associated with sperm freeze tolerance.

[0069] Example 2

[0070] Detection of polymorphic distribution of SUN5DOWN239 genetic marker in pigs.

[0071] In this example, the polymorphism distribution pattern of the SUN5DOWN239 genetic marker was detected in 390 boars. The detection results are shown in Table 1.

[0072] Table 1 Genotype frequency and gene frequency of SUN5DOWN239 locus

[0073]

[0074] The results in Table 1 show that the SUN5DOWN239 locus in boars showed three genotypes: GG, GC and CC. Among them, the GG genotype was more common, and the frequency of the G allele was 61%.

[0075] Example 3

[0076] Association analysis of the SUN5DOWN239 genetic marker with boar sperm freezing tolerance.

[0077] This study aimed to determine the association between the SUN5DOWN239 locus and boar sperm freeze tolerance. Polymorphisms were detected in a population of 390 boars, and the correlation between different genotypes of this polymorphic locus and sperm recovery rate was analyzed. SPSS statistical analysis software (IBM SPSS Statistics 26) was used to perform variance analysis for different SNP genotype combinations and perform significance tests. The model used was:

[0078] y ijkl =μ+G i +B j +T k +e ijkl

[0079] Among them, y ijkl is the recovery rate, μ represents the population mean, G i represents the genotype effect, Bj represents the variety effect, T k represents the batch effect, e ijkl represents random effects.

[0080] The correlation analysis between different genotypes and boar sperm recovery rate was conducted in boars. The statistical analysis results are shown in Table 2:

[0081] Table 2 Association analysis between SUN5DOWN239 locus and boar sperm recovery rate

[0082]

[0083] In Table 2, the mean values ​​of traits are all mean ± standard error, and different letters in the shoulder indicate significant differences (P < 0.05).

[0084] The results in Table 2 show that the sperm recovery rate of boars with GG genotype at SUN5DOWN239 locus was significantly higher than that of boars with CC genotype (P<0.05).

[0085] Example 4

[0086] The application of the SUN5DOWN239 genetic marker in the selection of boars with sperm freeze-resistance includes the following steps:

[0087] Step S1: Collect ear margin tissue samples from individual boars to be tested, perform DNA extraction and quality testing;

[0088] Step S2: PCR amplification was performed using forward primer F1 and reverse primer R1 to obtain the PCR product and purify it. The PCR reaction system was 40 μL, and the components of the system were: 1 μL of genomic DNA, 20 μL of PCR mix, 2 μL of upstream primer and downstream primer, and ddH2O was added to bring the total volume to 40 μL. The PCR program was as follows: 98°C denaturation for 2 minutes; 35 cycles of denaturation at 98°C for 10 seconds, annealing at 60°C for 10 seconds, and extension at 72°C for 15 seconds; extension at 72°C for 2 minutes; and storage at 4°C. Agarose gel electrophoresis of the PCR product is shown in the figure below. Figure 1 As shown, DL2000 is a marker, lanes 1-3 are the amplified fragments from pigs, and the fragment size is 324 bp.

[0089] Step S3: Sequence part of the PCR purified product and analyze the genotype at the 76th bp of the sequence. The sequencing map of the SUN5DOWN239 site is as follows: Figure 2 As shown, individuals with GG genotype are preferentially retained, individuals with CC genotype are preferentially eliminated, and individuals with GC genotype are selected to be retained.

[0090] The SUN5DOWN239 genetic marker locus is significantly associated with boar reproductive traits, particularly sperm recovery rate, with the GG genotype being the dominant genotype. Therefore, this SNP genetic marker can be used to assist in the selection of GG individuals with superior reproductive performance, thereby improving herd production performance, increasing the utilization rate of high-quality breeding boars, and maximizing the economic benefits of pig farming operations.

[0091] In the present invention, the specific sequences of SEQ ID NOs: 1 to 3 are as follows:

[0092] The nucleotide sequence shown in SEQ ID NO: 1:

[0093]

[0094] Forward primer F1 shown in SEQ ID NO: 2: CTCCACGTGTCTGAGTCTGC;

[0095] Reverse primer R1 shown in SEQ ID NO: 3: AGAGGGTGTACGTGTCCTGT.

[0096] In SEQ ID NO: 1, the bold and underlined site is the SUN5DOWN239 site of the present invention.

[0097] Finally, it should be noted that the terms "comprises," "includes," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that includes a list of elements includes not only those elements, but also other elements not expressly listed, or elements inherent to such process, method, article, or apparatus.

[0098] Although the preferred embodiments of the present invention have been described, those skilled in the art may make additional changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0099] Obviously, those skilled in the art may make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if such changes and modifications fall within the scope of the claims and their equivalents, the present invention is intended to include such changes and modifications.

Claims

1. Application of a SNP genetic marker downstream of the SUN5 gene associated with pig sperm freezing resistance in pig genetic breeding, characterized in that: The SNP genetic marker is named SUN5DOWN239 and is located at the 36507861bp nucleotide position of pig chromosome 17 in the International Porcine Genome Version 11.1 reference sequence. The base of this position is G or C. The SUN5DOWN239 is located 239bp downstream of the SUN5 gene, corresponding to the 76bp position in the nucleotide sequence shown in SEQ ID NO:

1. The pig breed includes at least one of Duroc, Landrace and Large White; The pig genetic breeding is the genetic breeding of pigs regarding the trait of sperm freeze resistance; The freezing resistance of sperm of the GG genotype individual of SUN5DOWN239 is higher than that of the GC genotype individual; the freezing resistance of sperm of the GC genotype individual of SUN5DOWN239 is higher than that of the CC genotype individual.

2. A method for early selection of the freezing resistance trait of pig sperm, characterized in that: The early selection method comprises performing early selection on the freezing resistance trait of pig sperm based on the genotype of the SNP genetic marker SUN5DOWN239; The SUN5DOWN239 is located at the 36507861bp nucleotide position of pig chromosome 17 in the International Porcine Genome Version 11.1 reference sequence. The base of this position is G or C. The SUN5DOWN239 is located 239bp downstream of the SUN5 gene, corresponding to the 76bp position in the nucleotide sequence shown in SEQ ID NO:

1. The pig breed includes at least one of Duroc, Landrace and Large White; The freezing resistance of sperm of the GG genotype individual of SUN5DOWN239 is higher than that of the GC genotype individual; the freezing resistance of sperm of the GC genotype individual of SUN5DOWN239 is higher than that of the CC genotype individual.

3. The early selection method for the freezing resistance trait of pig sperm according to claim 2, characterized in that, The early selection method specifically includes: Detect the genotype of the pig SNP genetic marker SUN5DOWN239 to be tested; Early selection of the sperm freeze-tolerance trait of the tested pigs is performed based on the genotype of SUN5DOWN239.

4. The method for early selection of the freezing resistance trait of pig sperm according to claim 3, characterized in that: The detecting of the genotype of the pig SNP genetic marker SUN5DOWN239 specifically includes: The genomic DNA of the pig to be tested was amplified by PCR using forward primer F1 and reverse primer R1; The PCR amplification product was sequenced to obtain the genotype of the 36507861bp nucleotide site on the pig chromosome 17 to be tested; The nucleotide sequence of the forward primer F1 is shown in SEQ ID NO.2; the nucleotide sequence of the reverse primer R1 is shown in SEQ ID NO.

3.

5. Application of primers for detecting SNP genetic marker SUN5DOWN239 in pig genetic breeding, characterized in that: The primers include a forward primer F1 and a reverse primer R1. The nucleotide sequence of the forward primer F1 is shown in SEQ ID NO.2; the nucleotide sequence of the reverse primer R1 is shown in SEQ ID NO.

3. The SUN5DOWN239 is located at the 36507861bp nucleotide position of pig chromosome 17 in the International Porcine Genome Version 11.1 reference sequence. The base of this position is G or C. The SUN5DOWN239 is located 239bp downstream of the SUN5 gene, corresponding to the 76bp position in the nucleotide sequence shown in SEQ ID NO:

1. The pig breed includes at least one of Duroc, Landrace and Large White; The pig genetic breeding is the genetic breeding of pigs regarding the trait of sperm freeze resistance; The freezing resistance of sperm of the GG genotype individual of SUN5DOWN239 is higher than that of the GC genotype individual; the freezing resistance of sperm of the GC genotype individual of SUN5DOWN239 is higher than that of the CC genotype individual.

Images