Molecular Marker of Wheat Grain Weight-related Gene TaRBL14a and Its Application

Abstract

The present invention belongs to the field of biotechnology, and particularly relates to a molecular marker TaRBL14a related to wheat grain weight and its application. The SNP locus is located at -779 bp from the start codon in the promoter region of the gene TaRBL14a (TraesCS3A02G182700) on wheat chromosome 3A at positions 212087787-212090176 bp, and the polymorphism is C or G. The 1000-grain weight, grain length, and grain width of wheat with the genotype GG at -779 bp from the start codon in the promoter region of the gene TaRBL14a are higher than those of wheat varieties with the genotype CC. The molecular marker provided by the present invention can be used to identify whether excellent alleles of TaRBL14a exist in wheat varieties / lines, and can be applied in assisted selection breeding and pyramiding breeding with other known genes related to grain weight.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a molecular marker TaRBL14a related to wheat grain weight and its application. Background Art

[0002] Wheat (Triticum aestivum L.) provides nearly 20% of the protein and calories in the human diet. Therefore, increasing wheat yield is the top priority for global food security. Wheat yield is affected by multiple agronomic traits, including thousand-grain weight (TGW), spikelet number per spike (SNPS), productive tiller number (PTN), plant height, harvest index, total biomass, spike length, and grain weight per spike. Among them, TGW, grain number (GN), and spike number per unit area / productive tiller number are three key determinants.

[0003] Marker-assisted selection (MAS) is considered a key technology to break through the bottleneck of conventional breeding and further improve the wheat yield potential. At the same time, MAS can overcome the difficulties in identifying and applying recessive genes, thus greatly improving the accuracy and efficiency of crop breeding. The application potential of MAS depends on the number of available genes and closely linked molecular markers. Multiple molecular marker detection technologies can be used for wheat genome analysis. Single nucleotide polymorphism (SNP) markers have received particular attention due to their large abundance and the availability of high-throughput analysis through SNP arrays. For crops, the availability of various SNP genotyping platforms contributes to the genetic dissection of economically important traits and the process of MAS.

[0004] As one of the key determinants of wheat yield, developing molecular markers related to grain weight and screening excellent haplotypes have important scientific research value and broad application prospects for improving TGW and grain yield in future wheat breeding in China.

[0005] So far, although many molecular markers linked to QTLs related to wheat grain traits have been developed, the target genes that truly determine grain traits in the QTL regions corresponding to the QTL-linked molecular markers are unknown. Summary of the Invention

[0006] To solve the problem that the target genes that truly determine grain traits in the QTL regions corresponding to the QTL-linked molecular markers in the prior art are unknown, and to achieve the above object, the present invention adopts the following technical solutions:

[0007] One object of the present invention is to provide an SNP locus related to wheat grain weight. The SNP locus is located at -779 bp from the start codon in the promoter region of the wheat gene TaRBL14a, and the polymorphism is C or G.

[0008] Preferably, the 1000-grain weight, grain length, and grain width of wheat varieties with the GG genotype at -779 bp from the start codon in the promoter region of the gene TaRBL14a are higher than those of wheat varieties with the CC genotype.

[0009] The second object of the present invention is to provide a molecular marker related to wheat grain weight for the gene TaRBL14a. The molecular marker contains the SNP locus described in claim 1, and the nucleotide sequence of the molecular marker is as shown in SEQ ID NO.1.

[0010] The third object of the present invention is to provide a method for obtaining the molecular marker related to wheat grain weight for the gene TaRBL14a. The method includes the following steps:

[0011] Extract wheat DNA: Extract the genomic DNA of the wheat to be tested, and perform PCR amplification using specific amplification primers to obtain a PCR amplification product.

[0012] Detect the PCR amplification product by agarose gel electrophoresis. If there are SNP locus differences at -779 bp of the promoter, it can be used for molecular marker development. If the locus and its nearby sequences can be used for the design of KASP marker primers, the molecular marker related to wheat grain weight for the gene TaRBL14a is obtained.

[0013] The present invention also provides a method for developing the molecular marker TaRBL14a-KASP related to wheat grain weight for the gene TaRBL14a. The method includes the following steps:

[0014] Extract wheat DNA: Extract the genomic DNA of the wheat to be tested, and perform PCR amplification using specific amplification primers to obtain a PCR amplification product.

[0015] SNP locus detection: Determine the genotype by detecting the fluorescence signal of the PCR amplification product. If the PCR amplification product only shows the color of the fluorescent label linked to the 5′ end of the DNA molecule shown in SEQ ID NO.2 in the sequence listing, the genotype of the SNP marker of the wheat to be tested is CC; if the PCR amplification product only shows the color of the fluorescent label linked to the 5′ end of the DNA molecule shown in SEQ ID NO.3 in the sequence listing, the genotype of the SNP marker of the wheat to be tested is GG.

[0016] Data analysis: Use the TASSEL 5.1 software to perform association analysis on the phenotypic data, and use the SPSS 22.0 software to perform one-way analysis of variance to analyze the significance of the difference in phenotypic values between the two genotypes.

[0017] Preferably, the specific amplification primers include primer KASP-TaRBL14a-F1, primer KASP-TaRBL14a-F2 and common primer KASP-TaRBL14a-R; the nucleotide sequence of primer KASP-TaRBL14a-F1 is shown in SEQ ID NO.2; the nucleotide sequence of primer KASP-TaRBL14a-F2 is shown in SEQ ID NO.3, and the nucleotide sequence of the common primer KASP-TaRBL14a-R is shown in SEQ ID NO.4.

[0018] The fourth object of the present invention is to provide the application of the molecular marker or the amplification primer according to claim 4 in assisted breeding.

[0019] Preferably, the molecular marker according to claim 3 or the amplification primer according to claim 4 is used for screening and / or identifying wheat varieties with excellent traits.

[0020] Preferably, the method for identifying wheat traits using the SNP locus according to claim 1 includes the following steps:

[0021] Detect the genotype at the position -779bp from the start codon in the promoter region of the gene TaRBL14a in the genome of the wheat to be tested. If the genotype is GG, it is wheat with high thousand-grain weight, grain length, and grain width; if the genotype is CC, it is wheat with low thousand-grain weight, grain length, and grain width.

[0022] Preferably, the method for detecting the genotype at the position -779bp from the start codon in the promoter region of the gene TaRBL14a in the genome of the wheat to be tested includes the following 1) or 2):

[0023] 1) Direct sequencing;

[0024] 2) Design primers for amplifying the molecular marker containing the SNP locus, use the primers to amplify the genomic DNA of the wheat to be tested, and perform genotyping detection on the amplification product.

[0025] Compared with the prior art, the present invention has the following beneficial effects:

[0026] The present invention provides a molecular marker TaRBL14a related to wheat grain weight and quality. This molecular marker is a KASP molecular marker developed for the SNP locus in the promoter region of the weight measurement gene TaRBL14a, which can efficiently detect and trace the TaRBL14a gene in wheat varieties / lines. This molecular marker can be used for screening and / or identifying wheat varieties with excellent traits and for wheat assistant breeding. The present invention conducts genotyping and phenotypic association analysis on 260 wheat germplasm resources from different provinces in China and 3 wheat germplasm resources from the United States. The results show that the TaRBL14a-KASP molecular marker can divide different wheat varieties into two haplotypes: haplotype TaRBL14a-Hap1 and haplotype TaRBL14a-Hap2. The genotype of haplotype TaRBL14a-Hap1 is C / C, and the genotype of haplotype TaRBL14a-Hap2 is G / G. Combining the phenotypic data, association analysis is carried out on materials with different genotypes, and it is found that the thousand-grain weight, grain length, and grain width of wheat materials with the G / G genotype are significantly greater than those of materials with the C / C genotype. It shows that the G / G genotype is an excellent allelic variation and has a positive effect on wheat grain weight and grain width. In the breeding process, the aggregation of favorable mutant alleles is consistent with the result of increased yield in the crop breeding process. Therefore, the TaRBL14a-KASP molecular marker provided by the present invention can efficiently detect and trace the TaRBL14a gene in wheat varieties / lines, providing technical support for improving wheat high-yield breeding. Brief Description of the Drawings

[0027] Figure 1 qRT-PCR analysis of the expression pattern of TaRBL14a in different organs in the present invention;

[0028] Figure 2 Detection results of 10 wheat materials containing two haplotypes in the present invention; A. Both promoter regions of the two haplotypes of the TaRBL14a gene contain snp sites; B. Sequence amplification based on -779bp (C / G); 1-5 represent varieties of the first haplotype, including Shi 4185, Liangxing 99, Lumai 14, Jimai 26, and Lunxuan 987; 6-10 represent varieties with the second haplotype, including Hengguan 35, Mazhamai, Xinong 6028, Zhongyou 9507, and Jinmai 47; C(B) and G(C) allelic variations of -779bp of TaRBL14a under different materials; C. A TaRBL14a-KSAP marker developed based on -779bp (C / G). The blue circles represent allele (G), the red circles represent allele (C), the green circles represent heterozygous C / G alleles, and the pink and black circles represent missing values;

[0029] Figure 3Associations of TaRBL14a-Hap1 and TaRBL14a-Hap2 with TGW, GL, GW, and GT for 111 wheat materials under three environmental conditions. *P<0.05; **P<0.01;

[0030] Figure 4 Associations of TaRBL14a-Hap1 and Hap2 with thousand grain weight (TGW), grain length (GL), and grain width (GW) for 263 wheat accessions with 5 environmental alleles in the present invention; E1 - E5 are Tongwei, Gansu (35°11‘N, 105°19’E, altitude 1750 m) in 2021, Tongwei and Zhuanglang (35°21‘N, 105°58’E, altitude 2110 m) in 2022, Tianshui (34°34‘N, 105°53’E, altitude 1550 m) and Zhuanglang in 2023. *P<0.05; **P<0.01;

[0031] Figure 5 Spatio-temporal distribution of TaRBL14a haplotypes in the present invention: Frequencies of TaRBL14a allelic variations in wheat breeding programs in different decades in China. Detailed implementation manners

[0032] The present invention will be described in detail below with reference to the accompanying drawings and specific embodiments, but it should not be construed as a limitation of the present invention. Unless otherwise specified, the technical means used in the following embodiments are conventional means well-known to those skilled in the art, and the materials, reagents, etc. used in the following embodiments can be obtained from commercial channels unless otherwise specified.

[0033] Example 1

[0034] I. qRT-PCR analysis of TaRBL gene

[0035] Wheat seedlings at the three-leaf stage, roots, stems, leaves, young spikes, and grains at 5, 10, 15, 20, 25, and 30 days after flowering (DPA) were collected to obtain samples. Using a rapid plant tissue RNA extraction kit to extract total RNA from the collected samples, and measuring the RNA concentration with an ultra-microphotometer. The first strand of cDNA was synthesized using the FastKing gDNA isolation method (Beijing). Using FastReal qPCR PreMix (SYBR Green), the relative expression levels of the TaRBL14a gene in different tissues were detected by qRT-PCR analysis. Wheat TaGADPH was used as an internal reference gene for wheat tissue development expression analysis (refer to L. Guo et al., 2022).

[0036] Among them, the PCR reaction system was 20 μL, including 10 μL FastReal qPCR PreMix (SYBR Green), 0.6 μL each of the forward primer and the reverse primer, 2 μL cDNA, and 6.8 μL ddH 2 O. The PCR conditions were 95°C for 2 min; 95°C for 5 s, 58°C for 10 s, 72°C for 15 s (collecting fluorescence), for 40 cycles.

[0037] The primers used for qRT-PCR are shown in Table 1. The 2 -ΔΔCT method was used to calculate the relative expression level of the TaRBL14a gene (referring to Schmittgen & Livak, 2008). All quantifications were performed in 3 biological replicates.

[0038] Table 1 Primer information

[0039]

[0040] The expression levels of TaRBL14a in seedlings, roots, stems, leaves, young spikes, and grains at 5, 10, 15, 20, 25, and 30 DPA after flowering at the three-leaf stage were determined by qRT-PCR, and the results are as Figure 1 shown. The qRT-PCR results showed that TaRBL14a was specifically expressed in young spikes, and its expression level in grains gradually increased at different stages after flowering, suggesting its potential role in young spike development.

[0041] II. Obtaining molecular markers of the wheat grain weight and quality-related gene TaRBL14a

[0042] The wheat grain weight and quality-related gene TaRBL14a provided by the present invention encodes a serine protease, with a rhomboid domain at its N-terminus and a zf-RanBP zinc finger domain at its C-terminus. According to the analysis of the re-sequencing data of 619 wheat varieties in the Wheat Genome Variation Consortium Database (http: / / wheat.cau.edu.cn / WheatUnion / / b_4 / ), the cis-acting elements in the 2000 bp promoter region of TaRBL14a were predicted using PlantPAN3.0 (http: / / plantpan.itps.ncku.edu.tw), and it was found that there was a SNP variation site at -779 bp from the promoter of the gene TaRBL14a (such as Figure 2 A), which could be divided into two different haplotypes, namely TaRBL14a-Hap1 and TaRBL14a-Hap2.

[0043] To further confirm the SNP variations at this locus in different materials, we extracted the DNA of 10 wheat materials containing two haplotypes using the cetyltrimethylammonium bromide (CTAB) method (Stewart & Via, 1993). Specific primers were designed to amplify the sequences of the single nucleotide polymorphism (SNP) loci located in the promoter region as shown in Table 2. The wheat materials used were cultivated by each breeding unit, and were multiplied in our laboratory.

[0044] The DNA extraction method was as follows: Cut about 10 cm of wheat leaves and grind them in a mortar with liquid nitrogen. Collect about 100 mg of the sample in a centrifuge tube, add 800 μL of preheated CTAB solution, mix well and incubate in a water bath at 65 °C for 40 min, mixing once every 10 min during this period; add 800 μL of chloroform:isoamyl alcohol (24:1) solution, mix well, let stand for 20 min, and centrifuge at 12000 rpm / min for 10 min; take the supernatant, add an equal volume of chloroform:isoamyl alcohol (24:1) solution, mix well, and centrifuge at 12000 rpm / min for 10 min; take the supernatant, add 2 volumes of absolute ethanol, let stand at -20 °C for 30 min, centrifuge at 2000 rpm / min for 5 min, invert and air dry, and then add 200 μL of ddH 2 O.

[0045] Table 2 Sequences of single nucleotide polymorphism (SNP) loci

[0046] TaRBL14a-Hap1 C TaRBL14a-Hap2 G

[0047] Among them, the total volume of PCR was 15 μL, including 7.5 μL of 2* Red Taq MasterMix, 1 μL each of the forward and reverse primers (10 μM), 1.5 μL of DNA (200 ng μL-1), and 4 μL of ddH 2 O.

[0048] The PCR conditions were 94 °C for 5 min; 35 cycles of 94 °C for 30 s, 58 °C for 30 s, and 72 °C for 1 min; and a final extension at 72 °C for 5 min. The PCR products were detected using agarose gel (1%), and the required bands were purified using the Tiangen Gel Purification Kit (Tiangen, Beijing, China), and then sent to Shanghai Sangon Biotech Co., Ltd. for sequencing.

[0049] The sequencing results were consistent with the resequencing data of the wheat variation combined database. The bases at this SNP in Shi 4185, Liangxing 99, Lumai 14, Jimai 26, and Lunxuan 987 were C, while the bases at this SNP in Hengguan 35, Mazhamai, Xinong 6028, Zhongyou 9507, and Jinmai 47 were G.

[0050] The SNP locus related to wheat grain weight and quality provided by the present invention is located at -779bp of the TaRBL14a promoter. The SNP (C / G) at the -779bp position of the TaRBL14a promoter was converted into a homologous allele-specific PCR (KASP) molecular marker, named TaRBL14a-KASP. The nucleotide sequence of TaRBL14a-KASP is shown in SEQ ID NO.1:

[0051] The degenerate base R at the 101bp of the sequence TAGATGGAGAGAACCTTATTCCATCTTCAGAGAGCCGCCTTCACCTCGACTTTCTGAGCAGGACATAAACCCTAACAAAACTCAAGAAATTATGAAAAACRGGAGACCTCCCACCAGCAAGGGTCGAAATCTATCGCGCCACCATGGCCCTAAGACCACATAAGACGAGGTAGACTGGCGGCAGCACGACGATAGGCACGA is C or G.

[0052] Amplification primers (including two forward primers and one reverse primer) were designed for the above KASP molecular marker and synthesized by Shanghai Sangon Biotech Co., Ltd. The specific primers and their sequences are as follows:

[0053] TaRBL14a-KASP-F1: 5′-GAAGGTCGGAGTCAACGGATTGCTGGTGGGAGGTCTCCG-3′ (as SEQ ID NO.2);

[0054] TaRBL14a-KASP-F2: 5′-GAAGGTGACCAAGTTCATGCTGCTGGTGGGA GGTCTCCC-3′ (as SEQ ID NO.3);

[0055] TaRBL14a-KASP-R: 5′-CCTAACAAAACTCAAGAAATTATGAAAA-3′ (as SEQ ID NO.4).

[0056] Example 2 Application of TaRBL14a-KASP in Identifying Wheat Genotypes

[0057] 1. Extraction of Wheat Genomic DNA

[0058] Wheat leaves at the three-leaf stage were collected, and wheat genomic DNA was extracted using the CTAB method. The DNA concentration and quality were detected using NanoDrop2000 and 1% agarose gel electrophoresis. A ratio of A260 / A280 around 1.8 indicates that the sample quality is qualified.

[0059] .2. KASP Marker Amplification and Detection

[0060] Use a set of PCR reaction systems including two temperature steps: DNA is denatured at a higher temperature and then annealed and extended at a lower and same temperature. The PCR reaction system is 4 μL, containing 2 μL of KASP Master mix (2×), 1 μL of SNP Primer Mix (primer mixed working solution 4×), 1 μL of DNA, and ddH 2 0 is supplemented to 4 μL.

[0061] The PCR amplification system is as follows: (1) 94 °C, 15 min; (2) 94 °C, 20 s; 61 - 55 °C decreasing by 0.6 °C per cycle; a total of 10 cycles are carried out; (3) 94 °C, 20 s; 55 °C, 45 s, and a total of 35 cycles are carried out. After the PCR amplification cycle ends, the fluorescence value is read using an OMEGA SNP genotyping instrument. In this method, SNP locus detection uses fluorophores FAM (excitation light 485 nm, emission light 520 nm) and VIC (excitation light 535 nm, emission light 556 nm) to distinguish two isogenic loci. The passive reference dye ROX (excitation light 575 nm, emission light 610 nm) is used to correct the signal difference caused by the reaction volume error between wells.

[0062] 3. Data Analysis

[0063] Use the genotype reading software Kluster Caller to analyze the data. In this software, VIC and FAM data are plotted on the x-axis and y-axis respectively. The VIC and FAM values of each reaction well are corrected by the value of the specific well reference dye (ROX), and the data fluorescence values are standardized to obtain the relative fluorescence values corresponding to VIC and FAM of each PCR reaction well. According to the relative fluorescence values, the samples are clustered, and the genotype is further determined according to the sample cluster and fluorescence type.

[0064] Example 3 Application of TaRBL14a-KASP in Identifying Wheat Traits

[0065] This example provides the application of the molecular marker TaRBL14a-KASP in identifying the thousand-grain weight, grain length, grain width, and GT of wheat. The specific research is as follows:

[0066] 1. Using 263 wheat germplasm resource materials from different ecological regions in China, the materials were planted at Tongwei Agricultural Station (35°11, 105°19, altitude 1750 m) in 2021, at Tongwei and Zhuanglang Agricultural Stations (35°21, 105°58, altitude 2110 m) in 2022, and at Tianshui Agricultural Station (34°34, 105°53, altitude 1550 m) in 2023. The five planting environments were respectively denoted as: 2021TW (Tongwei, 2021), 2022TW (Tongwei, 2022), 2022ZL (Zhuanglang, 2022), 2023ZL (Zhuanglang, 2023), and 2023TS (Tianshui, 2023). All wheat materials were sown at the end of September and harvested in early July of the following year. The field experiment adopted a randomized block design with 3 replicates. Each material was planted in 3 rows with a row spacing of 20 cm and a row length of 1 m, and 30 seeds were planted in each row. After the grains matured, seed inspection was carried out, and three biological replicates were conducted for each strain.

[0067] 2. The grain length (GL), grain width (GW), and thousand-grain weight (TGW) of the seeds were analyzed using the Wanshen SC-G type automatic seed inspection and thousand-grain weight instrument, and all measurements were carried out with 3 biological replicates.

[0068] 3. Using the molecular markers provided in Example 1 and the method provided in Example 2, the significance between the phenotypes of two genotypes of wheat germplasm resources was analyzed, and the genotyping results are as Figure 2 shown in C. Using the one-way ANOVA method of SPSS 22.0 software, it was analyzed whether there were significant differences in the thousand-grain weight (TGW), grain length (GL), and grain width (GW) of wheat carrying different genotypes. The specific data are shown in Table 4 and Figure 4 .

[0069] Table 4 Grain phenotype data of two haplotypes of wheat germplasm resources with the TaRBL14a gene in different ecological regions

[0070]

[0071] It was found that the thousand-grain weight, grain length, and grain width of the wheat materials with the G / G genotype were significantly greater than those of the materials with the C / C genotype. It was shown that the G / G genotype was an excellent allelic variation and had a positive effect on the thousand-grain weight and grain yield of wheat. That is, TaRBL14a-Hap2 is an excellent haplotype for wheat TGW and grain yield.

[0072] Example 4 TaRBL14a-Hap2 was positively selected in Chinese wheat breeding

[0073] Artificial selection has led to the gradual accumulation of elite haplotypes. To investigate whether the superior haplotype TaRBL14a-Hap2 has been positively selected in wheat breeding, we evaluated the geographical distribution of two TaRBL14a haplotypes in 523 wheat varieties from 14 provinces in China. The results are shown in Table 7. Among them, if the total number of varieties containing both haplotypes in each province is greater than or equal to 5, statistics can be carried out; if it is less than 5, that province is not counted, and the ratio of the two haplotype materials in different provinces is calculated.

[0074] Table 7 Geographical distribution of wheat germplasm resources with different TaRBL14a haplotypes

[0075]

[0076] The results showed that the dominant varieties of TaRBL14a-Hap2 were distributed in Hebei (91%), Henan (66%), Shandong (83%) and Shanxi (75%), which are the main wheat-producing areas in China.

[0077] To further determine whether the haplotype TaRBL14a-Hap2 has been positively selected during wheat breeding in China, we analyzed the allelic variations of the TaRBL14a gene during the historical wheat breeding process using 321 different wheat varieties. The results are shown in Figure 5 and Table 8. The years of all materials were divided into five time points: pre-1971, 1971-1980, 1981-1990, 1991-2000, and post-2000 for statistics, and the distribution frequencies of the two haplotype materials in the five time periods were calculated.

[0078] Table 8 Allelic variation frequencies of TaRBL14a in Chinese wheat breeding programs in different years

[0079]

[0080] The results showed that TaRBL14a-Hap2 has been positively selected during the wheat domestication history. The spatio-temporal distribution results showed that selecting the superior haplotype TaRBL14a-Hap2 can actively improve wheat grain traits during the wheat domestication history in China.

[0081] Example 5 This example provides a detailed association analysis method for TaRBL14a haplotypes and grain-related traits, as follows:

[0082] 1. Experimental materials and phenotypic identification

[0083] In this study, a natural population consisting of 263 wheat varieties in the laboratory was used as experimental materials. The materials were planted in Tongwei, Gansu in 2021, in Tongwei and Zhuanglang, Gansu in 2022, and in Tianshui and Zhuanglang, Gansu in 2023, denoted as E1 - E5 respectively. After the wheat matured, each variety was randomly sampled for threshing, and the grain - related traits were measured with 3 replicates. The phenotypic data of 111 wheat varieties were from the published literature of the Zhang Xueyong team (Ma L, Li T, Hao C, et al. TaGS5 - 3A, a grainsize gene selected during wheat improvement for larger kernel and yield[J]. Plant biotechnology journal. 2016, 14(5):1269 - 1280.).

[0084] 2. Genotype identification and haplotype analysis of wheat TaRBL14a gene

[0085] The variant sites of the TaRBL14a gene in different wheat materials were obtained using the re - sequencing data of 677 hexaploid wheat in the WheatUnion database (http: / / wheat.cau.edu.cn / WheatUnion / ), and the genotypes were examined for haplotype analysis of the wheat TaRBL14a gene. The results showed that 1 SNP site was found in both the coding region and the promoter region of the TaRBL14a gene, located at 171 bp and - 779 bp respectively, forming two haplotypes, TaRBL14a - Hap1 and TaRBL14a - Hap2( Figure 2 A).

[0086] 3. SNPs verification

[0087] To confirm the SNP changes at this site in different materials, the cetyltrimethylammonium bromide (CTAB) method was used to extract the DNA of 10 wheat materials containing two haplotypes (Stewart & Via, 1993). Specific primers were designed to amplify the sequence of the single - nucleotide polymorphism (SNP) site located in the promoter region. The sequencing results were consistent with the re - sequencing data of the wheat variation combined database( Figure 2 B).

[0088] 4. Results of molecular marker development of wheat TaRBL14a gene and association analysis with grain - related traits

[0089] Developed molecular markers based on the SNP (C / G) locus at -779bp in the promoter region of the TaRBL14a gene, detected 263 wheat materials in the research group, distinguished two haplotypes of TaRBL14a-Hap1 and TaRBL14a-Hap2, and separated the varieties of the two haplotypes( Figure 2 C).

[0090] Conducted a preliminary association analysis using the phenotypic data of 111 wheat varieties related to grain traits in the published literature of the Zhang Xueyong team. The phenotypic data were measured in Luoyang, Henan in 2002 and 2005 and in Shunyi, Beijing in 2010. The results showed that the TGW, GL, GW, and GT of TaRBL14a-Hap2 were significantly higher than those of TaRBL14a-Hap1( Figure 3 ).

[0091] Conducted an association analysis of grain-related traits of two haplotypes of the TaRBL14a gene through the natural population materials in Table 4( Figure 4 ). The results found that the thousand-grain weight of haplotype TaRBL14a-Hap2 was significantly higher than that of haplotype TaRBL14a-Hap1 in three environments (P<0.05); the grain width of haplotype TaRBL14a-Hap2 was significantly higher than that of haplotype TaRBL14a-Hap1 in four environments (P<0.05); the grain length of haplotype TaRBL14a-Hap2 was significantly higher than that of haplotype TaRBL14a-Hap1 in one environment (P<0.05). The above results indicate that the TaRBL14a gene may affect the grain weight by influencing the grain length and grain width, and haplotype TaRBL14a-Hap2 is an excellent haplotype.

[0092] 5. Analysis of cis-acting elements of the TaRBL14a haplotype promoter in wheat

[0093] Used PlantPAN3.0 (http: / / plantpan.itps.ncku.edu.tw) to predict the cis-acting elements in the promoter region of TaRBL14a. The results found that TaRBL14a-Hap2 contained a binding site for the transcription factor TCP related to grain development regulation at -779bp. Therefore, further cis-acting element analysis was carried out on the promoter region of the TaRBL14a gene haplotype. The results found that there was( Figure 2 A).

[0094] 6. Selection of the TaRBL14a haplotype in Chinese wheat breeding

[0095] During the wheat breeding process, excellent alleles gradually accumulate. To determine whether the excellent haplotype TaRBL14a-Hap2 has been selected during the wheat breeding process, the geographical distributions of two haplotypes, TaRBL14a-Hap1 and TaRBL14a-Hap2, in 523 wheat natural population materials in China were evaluated. The results showed that the proportion of haplotype TaRBL14a-Hap2 was larger than that of TaRBL14a-Hap1 in the main wheat-producing areas of China, indicating that the excellent haplotype TaRBL14a-Hap2 of TaRBL14a was actively selected during the wheat breeding process in China. To further determine whether haplotype TaRBL14a-Hap2 was positively selected during the wheat breeding process in China, we analyzed the allelic variations of the TaRBL14a gene during the historical wheat breeding process using 321 different wheat varieties, and the results showed that TaRBL14a-Hap2 was actively selected during the wheat breeding process in China( Figure 5 ).

[0096] Therefore, the molecular marker TaRBL14a-KASP developed for the TaRBL14a gene in the present invention can be used to screen the excellent haplotype TaRBL14a-Hap2 of the TaRBL14a gene in different wheat germplasms, and this molecular marker and the screened excellent haplotype can be applied to future molecular breeding work.

[0097] It should be noted that when the claims of the present invention involve numerical ranges, it should be understood that both endpoints of each numerical range and any value between the two endpoints can be selected. To avoid redundancy, preferred embodiments of the present invention are described.

[0098] Although the preferred embodiments of the present invention have been described, those skilled in the art can make additional changes and modifications to these embodiments once they know the basic creative concept. Therefore, the appended claims are intended to be construed as including the preferred embodiments and all changes and modifications falling within the scope of the present invention.

[0099] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalent technologies, the present invention also intends to include these changes and modifications.

Claims

1. Application of a molecular marker of wheat grain weight-related gene TaRBL14a in assisted breeding, characterized in that: The molecular marker contains a SNP associated with wheat grain weight, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein the base at the 101 bp position is C or G; The breeding refers to the breeding of traits related to thousand-grain weight, grain length, and grain width; The thousand-grain weight, grain length and grain width of wheat varieties with genotype GG were higher than those of wheat varieties with genotype CC.

2. The use according to claim 1, characterized in that: Methods for detecting genotypes include the following 1) or 2): 1) Direct sequencing; 2) Designing primers for amplifying molecular markers containing the SNP, using the primers to amplify the wheat genomic DNA to be tested, and performing genotyping detection on the amplified products.

3. The use according to claim 2, characterized in that: The primers are primer KASP-TaRBL14a-F1, primer KASP-TaRBL14a-F2 and common primer KASP-TaRBL14a-R; The nucleotide sequence of the primer KASP-TaRBL14a-F1 is shown in SEQ ID NO.2; the nucleotide sequence of the primer KASP-TaRBL14a-F2 is shown in SEQ ID NO.3, and the nucleotide sequence of the common primer KASP-TaRBL14a-R is shown in SEQ ID NO.4.

Images