Application of Eagle's bacterium in the preparation of preparations for preventing and treating inflammatory bowel disease

Abstract

The present invention discloses the use of Eggerthella sp. in preparing a preparation for preventing and treating inflammatory bowel disease. The present invention constructs a mouse inflammatory bowel disease model and finds that supplementing with Eggerthella sp. can significantly improve acute and chronic intestinal inflammation in mice, has good tolerance and no toxic side effects. Therefore, live Eggerthella sp. or its culture solution can be used to prepare a preparation for preventing and treating inflammatory bowel disease, such as a medicine, health product or food additive, for improving acute or chronic intestinal inflammation and treating inflammatory bowel disease. The present invention not only provides a new use of Eggerthella sp., but also enriches the drug source for inflammatory bowel disease, and provides a new treatment strategy for the prevention and treatment of inflammatory bowel disease.

Description

Technical Field

[0001] The present invention belongs to the field of microbial technology, and more specifically, relates to the application of Eagle's bacterium in the preparation of a preparation for preventing and treating inflammatory bowel disease. Background Art

[0002] Inflammatory bowel disease (IBD) is a type of typical, idiopathic intestinal inflammatory disease with unknown causes, including ulcerative colitis (UC) and Crohn's disease (CD). Among them, ulcerative colitis occurs in the rectum and colon, and the lesions are mainly limited to the mucosa and submucosa of the large intestine, while Crohn's disease is a chronic granulomatous inflammation, and the lesions can involve various parts of the gastrointestinal tract, mainly the terminal ileum and adjacent colon, and are mostly segmental and asymmetric. Since there is currently no ideal treatment for IBD, patients require long-term, repeated hospitalization. In addition, commonly used drugs aminosalicylic acid and corticosteroids are used for mild to moderate inflammation. Those who are ineffective with the above drugs need to use biological agents such as TNF inhibitors and immunosuppressant drugs, and long-term use may cause allergic reactions or liver damage. Side effects. Therefore, seeking new drugs with few side effects and anti-enteritis has become an urgent technical problem and technical demand in this field.

[0003] Most of the intestinal flora are non-pathogenic commensal bacteria that participate in host nutritional metabolism, physiological processes and intestinal immune regulation, and have the function of maintaining the development of the intestinal mucosal immune system, maintaining the mucosal barrier and intestinal structural integrity. The pathogenesis of IBD is related to factors such as intestinal immune abnormalities and flora disturbance. Many studies have shown that the diversity of intestinal flora in IBD patients decreases, such as the number of Bacteroides, Faecalibacterium and Eubacterium. Therefore, regulating the intestinal flora has become one of the important means of treating inflammatory bowel disease. By supplementing probiotics to regulate host mucosal homeostasis, balance intestinal flora, regulate host metabolism and immunity, so as to reduce the occurrence and development of intestinal inflammation and improve prognosis. For example, there are reports on fecal transplantation for the treatment of IBD, but due to the different effects and the inevitable mixture of miscellaneous bacteria or pathogens in the feces from donors, its therapeutic effect is limited. Therefore, seeking and screening specific probiotics or symbiotic bacteria that can prevent and treat IBD is a research and development hotspot for many companies or research institutions. In addition, with the continuous improvement of research on the intestinal mucosal immune system and genetic susceptibility to IBD, microecological preparations will become increasingly important in the treatment of IBD.

[0004] In addition, although the active probiotic preparations currently on the market, mainly lactobacillus and bifidobacteria, can repair the intestinal mucosal barrier and have a certain preventive effect on intestinal inflammation, the current active probiotic preparations alone are still difficult to meet the increasing number of cases and growing clinical needs, and there are few drugs for treating enteritis prepared from probiotics in my country. It is urgent to explore new probiotics / symbiotics and inflammatory bowel disease treatment drugs and strategies based on probiotics / symbiotics to further improve the existing inflammatory bowel disease treatment technologies and solutions. Summary of the invention

[0005] The technical problem to be solved by the present invention is to overcome the deficiency of the existing lack of clear probiotics or symbiotic bacteria that can prevent and treat IBD, and to provide an Eggerthella sp. strain and the use of Eggerthella sp. in preparing a preparation for preventing and treating inflammatory bowel disease.

[0006] The first object of the present invention is to provide the use of Eagle's bacterium in preparing a preparation for preventing and treating inflammatory bowel disease.

[0007] The second object of the present invention is to provide the use of Eagle's Disease in preparing a preparation for alleviating intestinal mucosal damage and / or intestinal inflammation.

[0008] The third object of the present invention is to provide the use of Eagle's Disease in the preparation of a preparation for reducing the disease activity index of inflammatory bowel disease.

[0009] The fourth object of the present invention is to provide the use of Eagle's Disease in the preparation of a preparation for promoting the extension of colon length and the improvement of prognosis of inflammatory bowel disease.

[0010] The fifth object of the present invention is to provide an Eagle's yeast strain YW-1B.

[0011] The sixth object of the present invention is to provide a preparation containing one or more of live Eagle's bacteria, Eagle's culture solution, and Eagle's culture supernatant.

[0012] The seventh object of the present invention is to provide the use of the preparation in the preparation of drugs for preventing and treating inflammatory bowel disease, reducing intestinal mucosal damage and / or intestinal inflammation, reducing the disease activity index of inflammatory bowel disease or promoting the extension of colon length and improved prognosis of inflammatory bowel disease.

[0013] The above-mentioned purpose of the present invention is achieved through the following technical solutions:

[0014] The present invention has isolated a strain of Eggerthella sp. from normal human colon tissue by separation, screening and identification. At the same time, the present invention has found that supplementing live bacteria of Eggerthella sp. or its culture solution can significantly improve acute and chronic intestinal inflammation in mice by constructing a mouse inflammatory bowel disease model, with good tolerance and no toxic side effects, or live bacteria of Eggerthella sp., culture solution of Eggerthella sp. or its culture supernatant can be used to prepare preparations for preventing and treating inflammatory bowel disease, such as medicines, health products or food additives. However, there are currently no reports on the application of Eggerthella sp. in preventing and treating inflammatory bowel disease. Therefore, the present invention requests protection for the following applications of Eggerthella sp.

[0015] The present invention claims to protect the use of Eagle's bacterium in preparing a preparation for preventing and treating inflammatory bowel disease.

[0016] Specifically, the inflammatory bowel disease includes ulcerative colitis or Crohn's disease.

[0017] The present invention also claims to protect the use of Eagle's bacterium in preparing a preparation for alleviating intestinal mucosal damage and / or intestinal inflammation.

[0018] Specifically, the intestinal mucosal damage and / or intestinal inflammation is caused by acute or chronic enteritis.

[0019] The present invention also claims the use of Eagle's bacterium in preparing a preparation for reducing the disease activity index of inflammatory bowel disease.

[0020] The present invention also claims to protect the use of Eagle's bacterium in preparing a preparation for promoting the extension of colon length and the improvement of prognosis of inflammatory bowel disease.

[0021] In the above application of the present invention, the Eagle's bacteria is Eggerthellasp.

[0022] Specifically, the Eagle's bacterium is the Eagle's bacterium YW-1B strain or an Eagle's bacterium whose 16S rDNA sequence is at least 95% identical to the 16S rDNA sequence of the Eagle's bacterium YW-1B strain; the 16S rDNA sequence of the Eagle's bacterium YW-1B strain is shown in SEQ ID NO.1.

[0023] Specifically, the above-mentioned applications of Eagle's bacterium whose 16S rDNA sequence is at least 95%, 96%, 97%, 98%, 99% or more identical to the 16S rDNA sequence of Eagle's bacterium YW-1B strain should be within the scope of protection of the present invention.

[0024] Specifically, the Eagle's Disease of the present invention includes but is not limited to live Eagle's Disease bacteria or cultured bacterial liquid thereof.

[0025] In the present invention, the Eagle's bacteria is one or more of Eagle's bacteria, Eagle's bacteria culture solution, and Eagle's bacteria culture supernatant. The Eagle's bacteria, Eagle's bacteria culture solution, and Eagle's bacteria culture supernatant all have the effect of improving acute and chronic intestinal inflammation in mice.

[0026] The present invention also provides a strain of Eagle's yeast YW-1B, which was deposited in the Guangdong Provincial Microbiological Culture Collection Center (5th Floor, Building 59, No. 100 Xianlie South Road, Guangzhou) on April 4, 2023, with the deposit number GDMCC No: 63327.

[0027] The present invention also provides a preparation containing one or more of live Eagle's bacterium, Eagle's bacterium culture solution and Eagle's bacterium culture supernatant.

[0028] Specifically, the Eagle's bacterium is an Eagle's bacterium YW-1B strain or an Eagle's bacterium whose 16S rDNA sequence has at least 95% identity with the 16S rDNA sequence of the Eagle's bacterium YW-1B strain.

[0029] Specifically, if the preparation contains live Eagle's bacteria, the content of Eagle's bacteria in the preparation is 10 6 ~10 10 CFU / mL.

[0030] Optionally, the preparation contains, in addition to a pharmaceutically effective dose of Eagle's bacteria, a pharmaceutically acceptable carrier thereof.

[0031] The present invention also claims to protect the use of the preparation in the preparation of drugs for preventing and treating inflammatory bowel disease, reducing intestinal mucosal damage and / or intestinal inflammation, reducing the disease activity index of inflammatory bowel disease or promoting the extension of colon length and improved prognosis of inflammatory bowel disease.

[0032] The present invention has the following beneficial effects:

[0033] The present invention constructs a mouse inflammatory bowel disease model and finds that supplementing with live bacteria of Eggerthellasp., culture solution of Eggerthellasp. or its culture supernatant can significantly improve acute and chronic intestinal inflammation in mice, has good tolerance and no toxic side effects. Therefore, live bacteria of Eggerthellasp. or its culture solution can be used to prepare preparations for preventing and treating inflammatory bowel disease, such as medicines, health products or food additives, for improving acute or chronic intestinal inflammation and treating inflammatory bowel disease.

[0034] The present invention also provides an Eggerthella sp. YW-1B strain, which was deposited in the Guangdong Provincial Microbiological Culture Collection Center on April 4, 2023, with a collection number of GDMCC No: 63327, and a collection address of 5th Floor, Building 59, No. 100 Xianlie South Road, Guangzhou.

[0035] The present invention finds that Eggerthella sp. can significantly inhibit and reduce intestinal inflammation in inflammatory bowel disease model mice, which not only provides a new use of Eggerthella sp., but also enriches the drug sources for inflammatory bowel disease, provides a new treatment strategy for the prevention and treatment of inflammatory bowel disease, and has important scientific research value and potential clinical application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0036] Figure 1 Figure 1 is the result of strain isolation, screening and identification; Figure A is the colony morphology of the isolated strain; Figure B is the electrophoresis band result of the amplified product of the 16S rRNA sequence of the isolated strain; Figure C is the 16S rRNA sequence of the isolated strain; Figure D is the comparison result of the 16S rRNA sequence of the isolated strain in the NCBI database.

[0037] Figure 2 Figure 1 is the culture, microscopic morphology and biochemical reaction test results of Eagle's bacterium strain; Figure A is the Gram staining microscopic examination result of Eagle's bacterium strain; Figure B is the transmission electron microscope microscopic morphology of Eagle's bacterium strain; Figure C is the biochemical reaction test result of Eagle's bacterium strain.

[0038] Figure 3 Figure 2 shows the effect of oral supplementation of Eagle's bacillus on acute enteritis in mice; Figure A shows the disease activity index (DAI) of enteritis in mice treated with water, DSS and DSS+Eagle's bacillus, respectively; Figure B shows the colon anatomy of mice in each group; Figure C shows the statistical results of colon length in each group; Figure D shows the hematoxylin and eosin (H&E) staining results of "Swiss roll" colon sections of mice in each group (scale bar = 100 μm); Figure E shows histological scores to evaluate inflammation, crypt damage, goblet cell reduction and inflammatory cells; Figure F shows the number of goblet cells in the colon of mice in each group by AB / PAS staining (scale bar = 100 μm); ** in the figure indicates P < 0.01.

[0039] Figure 4Figure 1 is the effect of oral supplementation of Eagle's bacillus on chronic enteritis in mice; Figure A shows perianal images of rectal bleeding and bloody stools in each group of mice treated with water, DSS, and DSS+Eagle's bacillus, respectively. Red circles indicate bloody stools and severe diarrhea, and blue circles indicate no visible bloody stools and mild diarrhea; Figure B shows the statistical graph of spleen weight in each group of mice; Figure C shows the anatomical graph of the colon in each group of mice; Figure D shows the statistical results of colon length in each group of mice; Figure E shows the hematoxylin and eosin (H&E) staining results of "Swiss roll" colon sections of each group of mice (scale bar = 100 μm); Figure F shows histological scores to evaluate inflammation, crypt damage, goblet cell reduction, and inflammatory cells; Figure G shows the number of goblet cells in the colon of each group of mice by AB / PAS staining (scale bar = 100 μm); * in the figure indicates P < 0.05; ** indicates P < 0.01; *** indicates P < 0.001; **** indicates P < 0.0001.

[0040] Figure 5 Figure 2 shows the effects of oral supplementation of Eagle's bacterium on other organs in the treatment of chronic enteritis in mice; Figure A shows the effects of oral supplementation of Eagle's bacterium on superoxide dismutase (SOD); Figure B shows the effects of oral supplementation of Eagle's bacterium on aspartate aminotransferase (AST), alanine aminotransferase (ALT) and lactate dehydrogenase (LDH); Figure C shows the effects of oral supplementation of Eagle's bacterium on blood glucose (GLU), total cholesterol (TC), triglycerides (TG) and total bile acid (TBA); Figure D shows the effects of oral supplementation of Eagle's bacterium on uric acid (UA) and urea nitrogen (BUN); Figure E shows the hematoxylin and eosin (H&E) results of pathological sections of the heart, liver, lung and kidney; NS in the figure means that the difference is not significant. DETAILED DESCRIPTION

[0041] The present invention is further described below in conjunction with the accompanying drawings and specific examples, but the examples do not limit the present invention in any form. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in the art.

[0042] Unless otherwise specified, the reagents and materials used in the following examples are commercially available.

[0043] The Eggerthella sp. described in the embodiment of the present invention is the Eggerthella sp. YW-1B strain, which was deposited in the Guangdong Provincial Microbiological Culture Collection Center on April 4, 2023, with a deposit number of GDMCC No: 63327, and the deposit address is 3rd Floor, Building 59, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou City, Guangdong Province.

[0044] Example 1 Isolation, screening and identification of strains

[0045] 1. Isolation of strains

[0046] (1) Columbia blood agar medium was prepared, sterilized by autoclaving at 121°C for 15 min, and then cooled to 50°C. 5 μg / mL vancomycin and 5 μg / mL kanamycin were first added and gently shaken, and then 5% defibrinated sheep blood was added, mixed, and then poured into a bacterial culture dish;

[0047] (2) Mechanically separate the mucosa from the collected normal human colon tissue, wash it 2-3 times with pre-cooled sterile phosphate buffer solution (PBS), and then grind the clean mucosal tissue into a suspension using a grinding rod; spread the gradient diluted normal human colon mucosal suspension on a blood plate, and culture it at 37°C under anaerobic conditions for 48 hours;

[0048] (3) Pick a moist, raised, round single colony (see Figure 1 A) in the figure was recultured, identified and preserved.

[0049] 2. Preservation of strains

[0050] Under laboratory conditions, the strains were stored at -80℃ in culture medium containing 20% ​​glycerol and in porcelain bead storage tubes.

[0051] 3. PCR amplification and sequencing of 16S rRNA sequences

[0052] (1) Primers: The present invention uses bacterial universal primers for PCR amplification of 16S rRNA sequences. The primer sequences are shown below. The primers were synthesized by Guangzhou Ruibo Company.

[0053] Forward primer (27F): AGAGTTTGATCCTGGCTCAG

[0054] Reverse primer (1492R): GGTTACCTTGTTACGACTT

[0055] (2) The reaction system and amplification procedure used for PCR amplification are as follows:

[0056]

[0057]

[0058] After PCR amplification, the amplified product was detected by 1.5% agarose electrophoresis. Figure 1 As shown in B in the figure, it can be seen that the amplified fragment is specific and about 1500bp in size. The amplified fragment was recovered and sent to the company for sequencing. The 16SrRNA sequence (27F-1492R sequence) obtained by sequencing is as follows Figure 1C or SEQ ID NO.1.

[0059] The comparison results of the 16S rRNA sequences of the isolated strains in the NCBI database are as follows: Figure 1 As shown in D in the figure, it can be seen that the strain isolated in the present invention is a bacterium of the genus Eggerthella sp., which is named Eggerthella sp. YW-1B strain and sent to Guangdong Provincial Microbiological Culture Collection Center for preservation.

[0060] The Eggerthella sp. YW-1B strain described in the present invention was deposited in the Guangdong Provincial Microbiological Culture Collection Center on April 4, 2023, with the deposit number GDMCC No: 63327, and the deposit address is 3rd Floor, Building 59, No. 100 Xianlie Middle Road, Yuexiu District, Guangzhou City, Guangdong Province.

[0061] Example 2 Cultivation, microscopic morphological observation and biochemical reaction detection of Eagle's bacillus

[0062] 1. Bacterial strain recovery and suspension preparation

[0063] (1) Resuscitation of bacterial strains: Under sterile conditions, use a sterilized pipette tip to pick out a small porcelain bead containing Eagle's disease, activate the small porcelain bead by streaking on a Columbia blood agar plate, and culture it anaerobically at 37°C for 2 to 4 days to obtain a single colony.

[0064] (2) Colony characteristics: Eagle's disease was observed after being cultured on Columbia blood agar plates for 48 hours. It was found that it grew well and showed translucent, white, round, slightly convex, and smooth colonies.

[0065] (3) Preparation of bacterial suspension: A single colony of Eagle's disease bacteria was selected and inoculated into brain heart infusion (BHI) medium and cultured anaerobically at 37°C for 2 to 4 days. The resulting bacterial suspension was centrifuged at 3000 g / min and 4°C for 10 min. Most of the supernatant was removed, and the bacterial cells were collected and resuspended with the remaining culture supernatant to a concentration of 1 × 10 9 CFU / mL.

[0066] 2. Microscopic morphology of bacteria and microscopic observation

[0067] Morphology under the microscope: The collected Eagle's bacteria were examined by Gram staining. Figure 2 As shown in A in the figure, it indicates that the strain is a Gram-positive bacterium. To further observe the microscopic morphology of the bacteria: the collected Eagle's bacteria were fixed with glutaraldehyde, embedded with resin, and then sliced ​​and observed and identified using an electron microscope. The microscopic morphology is shown in Figure 2 As shown in B in the figure, it can be seen that its size is about 0.4~0.5μm×0.9~1.0μm, it is thin rod-shaped, and has no flagella.

[0068] 3. Biochemical identification of strains

[0069] The Eagle's bacterium colonies or suspension culture liquid obtained by pure culture were tested with a strain biochemical kit. The results were as follows: Figure 2 As shown in C, it can be seen that the bacteria can decompose glycerol and mucin, does not produce acid or gas, is oxidase negative and has a positive kinetic reaction.

[0070] Example 3 Effect of oral supplementation of Eagle's yeast on acute enteritis in mice

[0071] 1. Experimental methods

[0072] Experimental animals: The animal experiment in this embodiment selected 15 6-8 week SPF healthy C57BL / 6 mice with an average body weight of 18-22 g; after 1 week of adaptive feeding, the mice were randomly divided into three groups: a blank group (water), an acute enteritis model group (DSS) and a bacteria treatment group (DSS+Eggerthella sp.).

[0073] Experimental treatment: Except for the blank group, the other two groups of mice drank 2.5% dextran sulfate sodium (DSS) solution freely for 7 days to establish the acute colitis model; the bacteria-treated group was gavaged with 2×10 8 CFU / mouse (live bacteria or their culture solution after centrifugation and resuspension) until the endpoint, and the model group was given blank culture medium; during the modeling and gavage, the weight changes, eating and drinking habits, hair gloss, mental state and activity of the mice were observed, and the degree of enteritis was scored according to the DAI activity index; on the 8th day, the mice were dissected, and their cecum and colon were taken for photographs and the length was calculated. The colorectal tissue was made into Swiss rolls and fixed with 4% paraformaldehyde, then routinely embedded in paraffin and sectioned, and stained with hematoxylin-eosin (H&E) and Alcian blue-periodic acid-Schiff (AB-PAS), and the pathological conditions were analyzed and scored.

[0074] 2. Evaluation indicators

[0075] Eagle's yeast treatment affected the disease activity index, colon length and colon pathological sections of DSS-induced mice, and the pathological sections, intestinal epithelial cells, goblet cells and inflammatory infiltration were scored.

[0076] The severity score of enteritis in mice was scored with reference to the disease activity index (DAI), including the percentage of weight loss, the degree of fecal diarrhea and blood in the stool, which is the sum of the scores of the percentage of weight loss, the degree of fecal diarrhea and blood in the stool; among them, the percentage of weight loss score: 0 = no weight loss; 1 = 1-5%; 2 = 5-10%; 3 = 10-20%; 4 = more than 20%; feces score: 0 = solid fecal pellets; 1 = solid fecal pellets, easily deformed; 2 = unformed stool; 3 = loose stool; 4 = liquid stool; blood in the stool score: 0 = occult blood; negative test; 1 = occult blood test 1+, no visible blood in the stool; 2 = occult blood test 2+; 3 = occult blood test 3+, visible blood in the stool; 4 = severe blood in the stool.

[0077] 3. Experimental results

[0078] Effects of oral supplementation of Eagle's yeast on acute enteritis in mice Figure 3 As shown, Figure 3 A in the figure is the disease activity index (DAI) of enteritis in each group of mice treated with water, DSS and DSS+Eagle's disease respectively; Figure 3 B in the figure is the colon anatomy of mice in each group; Figure 3 C in the figure is the statistical result of colon length of mice in each group; Figure 3 D in the figure shows the hematoxylin and eosin (H&E) staining results of the “Swiss roll” colon sections of mice in each group (scale bar = 100 μm); Figure 3 E in the figure is the histological score evaluating inflammation, crypt damage, goblet cell reduction, and inflammatory cells; Figure 3 F in the figure shows the number of goblet cells in the colon of each group of mice by AB / PAS staining (scale bar = 100 μm).

[0079] Depend on Figure 3 A in the figure shows that, compared with the blank group (water), mice with DSS acute colitis experienced different degrees of weight loss, and oral supplementation of Eagle's bacteria can reduce the disease activity index (DAI) of enteritis in mice. In addition, the present invention also found that Eagle's bacteria can significantly reduce the symptoms of diarrhea and bloody stools in mice, reduce the disease activity index, and reduce the degree of colon shortening, such as Figure 3 As shown in B and C. H&E staining and AB-PAS staining showed that compared with the DSS model group, supplementation of Eagle's yeast could alleviate pathological features such as structural damage, goblet cell loss and inflammatory cell infiltration of the colonic mucosa, as shown in Figure 3 As shown in D to F.

[0080] These results suggest that oral supplementation with Eagle's yeast can reduce intestinal mucosal damage and inflammation in mice with acute colitis and can be used to treat inflammatory bowel disease.

[0081] Example 4 Effect of oral supplementation of Eagle's bacterium on chronic enteritis in mice and its safety

[0082] 1. Experimental methods

[0083] Experimental animals: In the animal experiment in this embodiment, 10 6-8 week old SPF healthy C57BL / 6 mice with an average body weight of 18-22 g were selected; after one week of adaptive feeding, the mice were randomly divided into two groups: a chronic enteritis model group (DSS) and a bacteria treatment group (DSS+Eggerthella sp.).

[0084] Experimental treatment: Mice were free to drink 2.0% DSS solution for 7 days and normal drinking water for 14 days. The above cycle was repeated three times to establish a mouse chronic enteritis model. The bacteria treatment group was gavaged with 2×10 8 CFU / mouse (live bacteria or their culture solution after centrifugation and resuspension) until the end point, and the model group was given blank culture medium; during the modeling and gavage, the weight changes, food and water intake, hair gloss, mental state and activity of the mice were observed. At the end point, the mice were dissected, serum was collected, and the cecum and spleen were taken for photographs and the length was calculated. The colorectal tissue was made into Swiss rolls and fixed with 4% paraformaldehyde, then routinely embedded in paraffin and sliced, and stained with hematoxylin-eosin (H&E) and Alcian blue-periodic acid-Schiff (AB-PAS), and the pathological conditions were analyzed and scored.

[0085] In order to further analyze the safety of oral administration of Eggerthella sp. in the treatment of enteritis, the present invention also conducted a comprehensive safety index analysis on mice in the chronic enteritis model group (DSS) and the bacteria treatment group (DSS+Eggerthella sp.), and performed pathological analysis on major organs.

[0086] 2. Experimental results

[0087] Effects of oral supplementation of Eagle's yeast on chronic enteritis in mice Figure 4 As shown, Figure 4 A in the figure shows perianal images of rectal bleeding and bloody stools in mice treated with water, DSS, and DSS+Eaglesiae, respectively. The red circles indicate bloody stools and severe diarrhea, and the blue circles indicate no visible bloody stools and mild diarrhea. Figure 4 B in the figure is a statistical chart of spleen weight of mice in each group; Figure 4 C in the figure is the colon anatomy of mice in each group; Figure 4 D in the figure is the statistical result of colon length of mice in each group; Figure 4 E in the figure shows the hematoxylin and eosin (H&E) staining results of the “Swiss roll” colon sections of mice in each group (scale bar = 100 μm); Figure 4F in the figure is the histological score evaluating inflammation, crypt damage, goblet cell reduction, and inflammatory cells; Figure 4 G in FIG. 1 shows the number of goblet cells in the colon of each group of mice as shown by AB / PAS staining (scale bar = 100 μm).

[0088] Depend on Figure 4 As shown in A to D, the DSS chronic enteritis mice had persistent bloody stools and diarrhea, while supplementation with Eagle's bacteria significantly reduced the symptoms of diarrhea and bloody stools in the chronic enteritis mice ( Figure 4 A in the figure), reducing the effect of chronic enteritis on the spleen of mice ( Figure 4 B), which reduces the shortening of the colon ( Figure 4 C and D in Figure 1). H&E staining and AB-PAS staining showed that compared with the DSS chronic enteritis group, the Eagle's disease group had alleviated pathological features such as intestinal mucosal structural destruction, goblet cell loss, and inflammatory cell infiltration. Figure 4 As shown in E to G.

[0089] The above results show that oral supplementation of Eagle's yeast can reduce intestinal mucosal damage and inflammation in mice with chronic enteritis.

[0090] In order to explore the safety of Eagle's bacteria, the present invention tested the effects of oral supplementation of Eagle's bacteria on other organs in the treatment of enteritis. Figure 5 As shown, Figure 5 A in the figure is the effect of supplementing Eagle's disease on superoxide dismutase (SOD); Figure 5 B in the figure is the effect of supplementing Eagle's disease on aspartate aminotransferase (AST), alanine aminotransferase (ALT) and lactate dehydrogenase (LDH); Figure 5 C in the figure is the effect of supplementation of Eagle's yeast on blood glucose (GLU), total cholesterol (TC), triglyceride (TG) and total bile acid (TBA); Figure 5 D in the figure is the effect of supplementing Eagle's disease on uric acid (UA) and urea nitrogen (BUN); Figure 5 E in the figure is the hematoxylin and eosin (H&E) results of pathological sections supplementing the effects of Eagle's bacteria on the heart, liver, lungs, and kidneys.

[0091] Depend on Figure 5It can be seen that oral administration of Eagle's bacteria does not affect superoxide dismutase (SOD), alanine aminotransferase (ALT), and aspartate aminotransferase (AST) in the treatment of enteritis, that is, oral Eagle's bacteria does not affect liver function, nor does it affect lactate dehydrogenase (LDH), myocardial injury indicators, as well as serological related indicators such as blood sugar (GLU), total cholesterol (TC), triglycerides (TG), and total bile acid (TBA). It also has no effect on renal function related indicators such as uric acid (UA) and urea nitrogen (BUN). Figure 5 As shown in A to D in . In addition, Figure 5 As shown in Figure E, oral administration of Eagle's bacteria does not cause pathological damage to other important organs (heart, liver, lung, and kidney). The above results show that oral administration of Eagle's bacteria exhibits good safety and tolerability.

[0092] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. An Eggerthella sp. YW-1B strain, characterized in that: The YW-1B strain was deposited in the Guangdong Provincial Microbiological Culture Collection Center on April 4, 2023, with the collection number GDMCC No: 63327.

2. Use of Eagle's bacterium in the preparation of a preparation for preventing and treating inflammatory bowel disease, characterized in that: The Eagle's bacterium is the Eagle's bacterium YW-1B strain described in claim 1.

3. Use of Eagle's bacterium in the preparation of a preparation for alleviating intestinal mucosal damage and / or intestinal inflammation, characterized in that: The Eagle's bacterium is the Eagle's bacterium YW-1B strain described in claim 1.

4. The use according to claim 3, characterized in that: The intestinal mucosal damage and / or intestinal inflammation is caused by acute or chronic enteritis.

5. Use of Eagle's bacterium in the preparation of a preparation for reducing the disease activity index of inflammatory bowel disease, characterized in that: The Eagle's bacterium is the Eagle's bacterium YW-1B strain described in claim 1.

6. Use of Eagle's bacterium in the preparation of a preparation for promoting the extension of colon length and the improvement of prognosis in inflammatory bowel disease, characterized in that: The Eagle's bacterium is the Eagle's bacterium YW-1B strain described in claim 1.

7. The use according to any one of claims 2 to 6, characterized in that: The Eagle's bacteria is one or more of live Eagle's bacteria YW-1B strain, culture solution of Eagle's bacteria YW-1B strain, and culture supernatant of Eagle's bacteria YW-1B strain.

8. A preparation containing one or more of live Eagle's YW-1B strain, culture solution of Eagle's YW-1B strain, and culture supernatant of Eagle's YW-1B strain, characterized in that: The YW-1B strain was deposited in the Guangdong Provincial Microbiological Culture Collection Center on April 4, 2023, with the collection number GDMCC No: 63327.

Images