A universal cell expressing GSN and preparation method thereof

By using CRISPR/Cas9 gene editing technology to reduce the MHC-I and MHC-II functions of pluripotent stem cells and increase GSN protein expression, the problem of immune rejection of pluripotent stem cells was solved and their application potential in allogeneic transplantation was enhanced.

CN118147077BActive Publication Date: 2025-09-26XELLSMART BIOMEDICAL (SUZHOU) CO LTD +1
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202211562158.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-07
Publication Date
2025-09-26
Estimated Expiration
2042-12-07

AI Technical Summary

Technical Problem

In the existing technology, the immune incompatibility of pluripotent stem cells and the immune rejection of transplanted cells have hindered their clinical application in the treatment of cancer, neurological and cardiovascular diseases, mainly due to the immune response of the human major histocompatibility complex (MHC).

Method used

CRISPR/Cas9 gene editing technology is used to reduce the function of MHC-I and MHC-II in pluripotent stem cells and increase the expression of GSN protein to reduce the sensitivity of NK cell killing and prepare low immunogenic pluripotent stem cells.

Benefits of technology

The results show that pluripotent stem cells can reduce immune rejection reactions in allogeneic transplantation, enhance their immune escape ability, and improve the safety and effectiveness of cell therapy.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN118147077B_ABST
    Figure CN118147077B_ABST
Patent Text Reader

Abstract

The present invention provides a universal cell expressing GSN and a method for preparing the same. The universal pluripotent cell can significantly reduce or escape recognition and attack by the immune system, particularly T cells, natural killer cells, and macrophages, while maintaining the renewal and differentiation properties of stem cells.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering and stem cell technology, and particularly relates to a universal cell expressing GSN and a preparation method thereof. Background Art

[0002] Stem cells are cells with the ability to self-renew and differentiate into specialized somatic cells. Based on the degree of differentiation in these characteristics, stem cells are primarily categorized as totipotent, pluripotent, and adult stem cells. Induced pluripotent stem cells (iPSCs) possess the potential for unlimited proliferation, self-renewal, and differentiation into various cell types, holding significant promise for the treatment of cancer, neurological, and cardiovascular diseases. However, key challenges such as immune incompatibility and immune rejection of transplanted cells hinder the clinical application of allogeneic functional cell transplantation for therapeutic purposes.

[0003] The human major histocompatibility complex (MHC), also known as human leukocyte antigens (HLA), is the primary cause of immune incompatibility. MHC is composed of a series of genes, divided into classes I, II, and III. MHC-I genes are expressed in nearly all tissue cell types. Transplanted cells expressing "non-self" MHC-I molecules stimulate CD8+ T cell activation and are eliminated. CD4+ helper T cells recognize the MHC-II genes of "non-self" cells, leading to immune rejection. Class III molecules, however, do not participate in immune activity.

[0004] In recent years, it has been reported that by knocking out genes such as B2M and CIITA, the expression of MHC-I and MHC-II cell surface or native genes can be lost, thereby enabling cells to have immune tolerance or escape T cell / B cell-specific immune responses, thereby producing immune-compatible universal pluripotent stem cells.

[0005] It has been reported that by disrupting the expression of MHC-I and MHC-II class genes, cells can express non-classical HLA-I class molecules such as HLA-E / G, or express immunosuppressive checkpoint proteins such as PD-L1, CTLA4-Ig, CD47, and CD24, effectively escaping NK cell killing (WO2021041316 A1). Summary of the Invention

[0006] In one aspect, the present invention provides a low immunogenic pluripotent stem cell comprising: reduced endogenous major histocompatibility class I antigen (MHC-I) function compared to a parental pluripotent stem cell; reduced endogenous major histocompatibility class II antigen (MHC-II) function compared to a parental pluripotent stem cell; and reduced sensitivity to NK cell killing compared to a parental pluripotent stem cell, wherein the reduced sensitivity to NK cell killing is caused by increased expression of GSN protein.

[0007] In some embodiments, the MHC-I function is reduced by reducing the activity of an MHC-I class protein or an MHC-I transcriptional regulator.

[0008] In one embodiment, the MHC-I function is reduced by reducing the activity of the B2M protein.

[0009] In one embodiment, the B2M protein is a human B2M protein, which comprises the amino acid sequence shown in SEQ ID NO: 1 or an amino acid sequence that is 90% identical to the amino acid sequence shown in SEQ ID NO: 1.

[0010] In some embodiments, the MHC-II function is reduced by reducing the activity of an MHC-II class protein or an MHC-II transcriptional regulator.

[0011] In one embodiment, the MHC-II function is reduced by reducing the activity of the CIITA protein.

[0012] In one embodiment, the CIITA protein is a human CIITA protein, which comprises the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence that is 90% identical to the amino acid sequence shown in SEQ ID NO: 2.

[0013] In some embodiments, the GSN protein is a human GSN protein comprising the amino acid sequence encoded by SEQ ID NO:4 or an amino acid sequence that is 90% identical to the amino acid sequence encoded by SEQ ID NO:4.

[0014] In one embodiment, the low immunogenic pluripotent stem cells comprise: one or more changes that reduce the activity of endogenous B2M protein; one or more changes that reduce the activity of endogenous CIITA protein; and one or more changes that cause increased expression of GSN protein in the low immunogenic pluripotent stem cells.

[0015] In one embodiment, the low immunogenic pluripotent stem cells comprise: one or more changes that inactivate both alleles of the endogenous B2M gene; one or more changes that inactivate both alleles of the endogenous CIITA gene; and one or more changes that cause increased expression of the GSN gene in the low immunogenic pluripotent stem cells.

[0016] On the other hand, the present invention also provides a method for producing the low immunogenic pluripotent stem cells of the present invention, the method comprising: reducing the endogenous major histocompatibility class I antigen (MHC-I) function in the pluripotent stem cells; reducing the endogenous major histocompatibility class II antigen (MHC-II) function in the pluripotent stem cells; and increasing the expression of a protein that reduces the sensitivity of the pluripotent stem cells to NK cell killing, wherein the protein is GSN protein.

[0017] In one embodiment, the method comprises: reducing the activity of B2M protein in the pluripotent stem cells; reducing the activity of CIITA protein in the pluripotent stem cells; and increasing the expression of GSN protein in the pluripotent stem cells.

[0018] In one embodiment, the method comprises: eliminating the activity of both alleles of the B2M gene in the pluripotent stem cells; eliminating the activity of both alleles of the CIITA gene in the pluripotent stem cells; and increasing the expression of the GSN gene in the pluripotent stem cells.

[0019] In one embodiment, the activity of B2M protein in the pluripotent stem cells is reduced by clustered regularly interspaced short palindromic repeats (CRISPR) / Cas9 gene editing technology.

[0020] In one embodiment, the activity of CIITA protein in the pluripotent stem cells is reduced by clustered regularly interspaced short palindromic repeats (CRISPR) / Cas9 gene editing technology.

[0021] In one embodiment, expression of the GSN protein is increased by expression of a transgene.

[0022] In a preferred embodiment, a nucleic acid sequence encoding the GSN protein is synthesized and constructed into a lentiviral vector, and then at least one copy of the GSN gene under the control of a promoter is introduced into the pluripotent stem cells via the lentiviral vector to increase the expression of the GSN protein.

[0023] In one embodiment, the nucleic acid sequence encoding the GSN protein comprises the nucleic acid sequence shown in SEQ ID NO: 4 or a nucleic acid sequence having at least 80% identity to the nucleic acid sequence shown in SEQ ID NO: 4.

[0024] In another aspect, the present invention also provides use of cells differentiated from the low immunogenic pluripotent stem cells of the present invention or cells differentiated from the low immunogenic pluripotent stem cells prepared by the method of the present invention in preparing drugs for preventing or treating diseases requiring cell transplantation. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1The diagram shows the knockout strategy for the B2M gene in the B2M and CIITA double knockout cell lines (DKO) and the results of B2M gene knockout verification by PCR.

[0026] Figure 2 The diagram shows the knockout strategy for the CIITA gene in B2M and CIITA double knockout cell lines (DKO) and the results of CIITA gene knockout verification by PCR.

[0027] Figure 3 The graph shows the results of qPCR detection of B2M and CIITA expression at the RNA level in B2M / CIITA biallelic knockout (DKO) clones.

[0028] Figure 4 The figure shows the results of Western blot detection of B2M protein levels in B2M / CIITA biallelic knockout (DKO) clones.

[0029] Figure 5 The graph shows the results of FACS analysis of HLA class I / II molecules on the surface of H1 cells using IFN-γ to stimulate WT and DKO cells.

[0030] Figure 6 The karyotype results of B2M / CIITA biallelic knockout clones (DKO) are shown.

[0031] Figure 7A 、 Figure 7B and Figure 7C The results of detecting the expression of stemness genes in DKO cells are shown. Figure 7A The results show that the protein levels of stemness genes POU5F1 and NANOG were detected by immunofluorescence in WT and DKO cells; Figure 7B The results show that the expression of stemness genes POU5F1, NANOG, and SOX2 at the RNA level in WT and DKO cells was detected by RT-qPCR; Figure 7C The results are shown in Figure 1, which show the expression of stemness genes SSEA-4 and Tra1-81 on the cell surface of WT and DKO cells detected by flow cytometry.

[0032] Figure 8 The results show the results of hematoxylin and eosin staining to examine the ability of B2M / CIITA biallelic knockout (DKO) cells to form teratomas in vivo and differentiate into cells of the endoderm, mesoderm, and ectoderm.

[0033] Figure 9The results of RTCA testing of the immune escape function of WT and DKO cells are shown. The top three figures show the results of RTCA testing of the killing rate of NK cells against WT and DKO cells, that is, the results of the detection of the immune escape function of WT and DKO cells against NK cells; the bottom three figures show the results of RTCA testing of the killing rate of T cells against WT and DKO cells, that is, the results of the detection of the immune escape function of WT and DKO cells against T cells.

[0034] Figure 10 A schematic diagram showing the structure of the lentiviral vector pGC-EF1a is shown.

[0035] Figure 11A and Figure 11B Shown are the results confirming CD47 overexpression in DKO+CD47 cells. Figure 11A The results show that the expression level of CD47 in DKO+CD47 cell line was detected by FACS; Figure 11B The results of qPCR detection of CD47 expression levels in DKO+CD47 cell lines.

[0036] Figure 12 The results of RTCA detection of the immune escape function of WT and DKO+CD47 cells are shown.

[0037] Figure 13 The results of RT-PCR detection of the overexpression level of mRNA in the constructed DKO+GSN cell line are shown.

[0038] Figure 14 The graph shows the results of immunofluorescence detection of the protein levels of stemness genes OCT4, NANOG, SOX2, TRA-1-60, and TRA-1-81 in the constructed DKO+GSN cell line.

[0039] Figure 15 The graph shows the results of flow cytometry analysis of the expression levels of cell surface stemness genes SSEA-4, TRA-1-60, Tra1-81, and OCT4 in the constructed DKO+GSN cell line.

[0040] Figure 16 The results of immunofluorescence detection of the three-germ layer differentiation ability of the constructed DKO+GSN cell line are shown.

[0041] Figure 17 The results of the test of the teratoma-forming ability of the DKO+GSN cell line are shown.

[0042] Figures 18A-18D The figure shows the results of RTCA detection of the escape function of the constructed DKO+GSN cell line against different immune cells. Figure 18A and Figure 18BThe results of the NK cell killing experiment on DKO+GSN cells detected by RTCA, where Figure 18B This is a statistical chart of multiple kills; Figure 18C and Figure 18D The results of the cytotoxicity experiment of T cells + NK cells against DKO + GSN cells detected by RTCA are shown in Figure 2. Figure 18D This is a statistics chart of multiple kills.

[0043] Figure 19 The figure shows the cell status of the constructed DKO+GSN cell line after co-culture with NK cells for 24 hours.

[0044] Figure 20A and Figure 20B The results of Elispot detection of IFN-γ spot secretion of the constructed DKO+GSN cell line after co-culture with NK cells for 24 hours are shown, wherein Figure 20B Statistical histogram of IFN-γ spot frequency.

[0045] Figure 21 The figures show the results of FACS detection of the expression of CD107a, an indicator of NK cell activity, in the constructed DKO+GSN cell line.

[0046] Figure 22A and Figure 22B The results of RTCA detection of the NK cell escape function of differentiated cells of the constructed DKO+GSN cell line are shown, wherein Figure 22B This is a statistics chart of multiple kills. Specific implementation plan

[0047] General Definitions and Terminology

[0048] All patents, patent applications, scientific publications, manufacturer's instructions and guidelines, etc., cited herein, whether supra or infra, are hereby incorporated by reference in their entirety. Nothing herein should be construed as an admission that the present disclosure is not entitled to antedate such publication.

[0049] Unless otherwise specified, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. In addition, the terms related to protein and nucleic acid chemistry, molecular biology, cell and tissue culture, and microbiology used herein are terms widely used in the corresponding fields (see, for example, Molecular Cloning: A Laboratory Manual, 2 ndEdition, J. Sambrook et al. eds., Cold Spring Harbor Laboratory Press, Cold Spring Harbor 1989). Meanwhile, for a better understanding of the present invention, definitions and explanations of relevant terms are provided below.

[0050] As used herein, the expressions "comprise," "include," "contain," and "have" are open ended and mean the inclusion of the listed elements, steps, or components but not the exclusion of other unlisted elements, steps, or components. The expression "consisting of excludes any element, step, or component not specified. The expression "consisting essentially of means that the scope is limited to the specified elements, steps, or components, plus optional elements, steps, or components that do not significantly affect the basic and novel properties of the claimed subject matter. It should be understood that the expressions "consisting essentially of" and "consisting of are encompassed within the meaning of the expression "comprising."

[0051] As used herein, the singular forms "a," "an," or "the" include plural referents unless the context indicates otherwise. The terms "one or more" or "at least one" encompass 1, 2, 3, 4, 5, 6, 7, 8, 9 or more.

[0052] Recitation of ranges of values ​​herein is intended merely to serve as a shorthand method of referring individually to each separate value falling within the range. Unless otherwise indicated herein, each separate value is incorporated into the specification as if it were individually recited herein. Unless expressly indicated to the contrary, values ​​or ranges recited herein are modified by "about" to mean ±20%, ±10%, ±5%, or ±3% of the recited or claimed value or range.

[0053] Unless otherwise specified, the labels such as 1), 2), ..., i), ii), a), b), ... in the method steps described herein are merely examples of distinction and do not imply that the method steps described herein are performed in such order.

[0054] The term "pluripotent cell" refers to a cell that is capable of self-renewal and proliferation while remaining in an undifferentiated state and that can be induced to differentiate into specialized cell types under appropriate conditions.

[0055] As used herein, the term "pluripotent stem cell" has the potential to differentiate into any one of the following three germ layers: endoderm (e.g., gastric junction, gastrointestinal tract, lung, etc.), mesoderm (e.g., muscle, bone, blood, urogenital tissue, etc.), or ectoderm (e.g., epidermal tissue and nervous system tissue). The term "pluripotent stem cell" as used herein also includes "induced pluripotent stem cells" or "iPSCs," a pluripotent stem cell derived from a non-pluripotent cell. Exemplary human pluripotent stem cell lines include H1 human pluripotent stem cell lines and H9 human pluripotent stem cell lines. Additional exemplary pluripotent stem cell lines include those available through the National Institutes of Health Human Embryonic Stem Cell Registry and Howard Hughes Medical Institute HUES collections (e.g., Cowan CA, et al. Derivation of embryonic stem-cell lines from human blastocysts. N Engl J Med. 2004 Mar 25; 350 (13): 1353-6. described).

[0056] As used herein, the term "totipotent" refers to the ability of a cell to form a complete organism. For example, in mammals, only the zygote and the first cleavage stage blastomere are totipotent. In one embodiment, the pluripotent stem cells described herein do not have totipotency and will not form a complete organism.

[0057] As used herein, the term "universal cells" refers to cells that are modified using gene editing technology to eliminate immune rejection and achieve universalization.

[0058] The cells can be from, for example, humans or non-human mammals. Exemplary non-human mammals include, but are not limited to, mice, rats, cats, dogs, rabbits, guinea pigs, hamsters, sheep, pigs, horses, cattle, and non-human primates. In some embodiments, the cells are from adults or non-human mammals. In some embodiments, the cells are from newborn humans, adults, or non-human mammals.

[0059] As used herein, the term "immune rejection" or "immune incompatibility" refers to the inability of allogeneic cells, tissues, or organs to function properly after transplantation to a recipient due to attack by the recipient's own immune cells. The human major histocompatibility complex (MHC), also known as human leukocyte antigens (HLA), is the primary cause of "immune rejection" or "immune incompatibility."

[0060] As used herein, the term "subject" or "patient" refers to any animal, such as a domesticated animal, a zoo animal, or a human. A "subject" or "patient" can be a mammal, such as a dog, a cat, a bird, livestock, or a human. Specific examples of "subjects" and "patients" include, but are not limited to, individuals (particularly humans) with diseases or conditions related to the liver, heart, lungs, kidneys, pancreas, brain, nervous tissue, blood, bones, bone marrow, and the like.

[0061] " Hypoimmunogenic pluripotent stem cells " herein refer to pluripotent stem cells, which retain the characteristics of their pluripotent stem cells and produce a reduced immune rejection reaction when transferred to an allogeneic host. In a preferred embodiment, the hypoimmunogenic pluripotent stem cells do not produce an immune response. Therefore, " hypoimmunogenicity " refers to an immune response that is significantly reduced or eliminated compared to the immune response of the parent (" WT ") stem cell before immune modification. For example, relative to wild-type cells that have not been immune modified, this hypoimmunogenic cell may be about 2.5%, 5%, 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95%, 97.5%, 99% or more than 99% less likely to produce immune rejection.

[0062] The term "major histocompatibility complex (MHC)" refers to a gene complex found in all vertebrates. MHC proteins or molecules function in signaling between lymphocytes and antigen-presenting cells during normal immune responses. The human MHC, also known as HLA (human leukocyte antigen), is located on chromosome 6 and includes MHC-I and MHC-II.

[0063] The terms "MHC-I" or "MHC class I" refer to major histocompatibility complex class I proteins or genes. Within the human MHC-I region are the HLA-A, HLA-B, HLA-C, HLA-E, HLA-F, CD1a, CD1b, and CD1c subregions. MHC class I proteins are found on the surface of virtually all cells, including most tumor cells. MHC-I proteins are loaded with antigens, which are usually derived from endogenous proteins or pathogens present within the cell, and then presented to cytotoxic T lymphocytes (CTLs, also known as CD8+ T cells). T cell receptors are able to recognize and bind peptides complexed with MHC-I molecules. Each cytotoxic T lymphocyte expresses a unique T cell receptor that is capable of binding to a specific MHC / peptide complex. MHC class I molecules primarily mediate the presentation of endogenous antigens.

[0064] The term "MHC-II" or "MHC class II" refers to major histocompatibility complex class II proteins or genes. MHC II includes five proteins: HLA-DP, HLA-DM, HLA-DOB, HLA-DQ, and HLA-DR. MHC class II proteins are primarily expressed on antigen-presenting cells such as B cells, monocytes, macrophages, and dendritic cells. MHC class II molecules primarily mediate the presentation of exogenous antigens. They present exogenous antigen peptide molecules to Th cells (helper T cells), which stimulate CD4+ T cells.

[0065] The term "MHC / peptide complex" relates to a non-covalent complex of a binding domain of an MHC class I or MHC class II molecule and an MHC class I or MHC class II binding peptide.

[0066] "Knockout" herein refers to the process of making a specific gene inactive in the host cell in which it is located, which results in the non-production of the target protein or an inactive form. As will be appreciated by those skilled in the art and described further below, this can be achieved in a variety of different ways, including removing the nucleic acid sequence from the gene, or interrupting the sequence with other sequences, changing the reading frame, or changing the regulatory elements of the nucleic acid. For example, all or part of the coding region of the target gene can be removed or replaced with a "nonsense" sequence, all or part of the regulatory sequence (e.g., promoter) can be removed or replaced, the translation initiation sequence, etc. can be removed or replaced.

[0067] In this article, the terms "reduce" and "reduce" are generally used to represent a statistically significant amount of reduction. However, for the avoidance of doubt, "reduce", "reduce" include reducing by at least 10% compared to a reference level, such as reducing by at least about 20% or at least about 30% compared to a reference level, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including 100% reduction (i.e., a level that is not present compared to a reference sample), or any reduction between 10-100%.

[0068] As used herein, "knock-in" or "overexpression" refers to the process of adding a genetic function to a host cell. This results in an increase in the level of the encoded protein. As will be appreciated by those skilled in the art, this can be achieved in several ways, including adding one or more additional copies of a gene to the host cell or altering the regulatory components of an endogenous gene to increase protein expression. This can be achieved by modifying the promoter, adding a different promoter, adding an enhancer, or modifying other gene expression sequences.

[0069] As used herein, the term "increase" is generally used to refer to an increase by a statistically significant amount; for the avoidance of any doubt, the term "increase" refers to an increase of at least 10% compared to a reference level, such as an increase of at least about 20%, or at least about 30%, or at least about 40%, or at least about 50%, or at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or up to and including a 100% increase or any increase between 10-100%, or at least about 2-fold, or at least about 3-fold, or at least about 4-fold, or at least about 5-fold or at least about 10-fold compared to a reference level, or any increase between 2-fold and 10-fold or greater than 10-fold.

[0070] The beta-2 microglobulin, or β2M or B2M protein, is a component of MHC class I. B2M is expressed by all nucleated cells (except red blood cells) and can non-covalently bind to the α chain of MHC class I molecules, attaching to cell membranes and being released into various tissue fluids.

[0071] "CD47 protein" or "Integrin-associated protein (IAP)" is an important self-signal that can inhibit the phagocytic function of macrophages and cause immune escape by binding to the N-terminus of the ligand signal regulatory protein α (SIRPα) on immune cells.

[0072] "MHC-II transactivator protein (CIITA) protein" is a key molecule that regulates MHC-II expression. The body mainly regulates the expression level of MHC II genes by controlling the expression of CIITA.

[0073] "GSN protein" refers to gelsolin, an extracellular protein that has been reported to reduce DNGR-1 binding to F-actin and cross-presentation of dead cell-associated antigens by type 1 conventional dendritic cells (cDC1).

[0074] As used herein, the term "syngeneic" refers to the genetic similarity or identity of the host organism and the cell transplant, wherein there is immunological compatibility; eg, no immune response is generated.

[0075] As used herein, the term "allogeneic" refers to the genetic differences of the host organism and cells transplanted in which an immune response is generated.

[0076] As used herein, the term "B2M- / -" refers to a diploid cell having an inactivated B2M gene in both chromosomes.

[0077] As used herein, the term "CIITA- / -" refers to a diploid cell having an inactivated CIITA gene in both chromosomes.

[0078] As used herein, the term "polypeptide" refers to a polymer comprising two or more amino acids covalently linked by peptide bonds. A "protein" may comprise one or more polypeptides, wherein the polypeptides interact with each other through covalent or non-covalent means. Unless otherwise indicated, "polypeptide" and "protein" are used interchangeably.

[0079] In the context of cells, "wild type" refers to cells found in nature. However, in the context of pluripotent stem cells, as used herein, it also refers to pluripotent stem cells that have not undergone gene editing procedures to achieve low immunogenicity, for example, the parental pluripotent stem cells (WT) described herein.

[0080] As used herein, the term "% identity" with respect to sequences refers to the percentage of identical nucleotides or amino acids in an optimal alignment between the sequences to be compared. The differences between the two sequences can be distributed over local regions (segments) or over the entire length of the sequences to be compared. The identity between the two sequences is usually determined after optimal alignment of a segment or "comparison window." Optimal alignment can be performed manually, or by means of algorithms known in the art, including but not limited to the local homology algorithm described by Smith and Waterman, 1981, Ads App. Math. 2, 482 and Neddleman and Wunsch, 1970, J. Mol. Biol. 48, 443, the search for similarity method described by Pearson and Lipman, 1988, Proc. Natl Acad. Sci. USA 88, 2444, or using computer programs such as GAP, BESTFIT, FASTA, BLAST P, BLAST N, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Drive, Madison, Wis. For example, the percent identity of two sequences can be determined using the publicly available BLASTN or BLASTP algorithms available on the National Center for Biotechnology Information (NCBI) website.

[0081] In some embodiments, the % homogeneity is given in the region of at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or about 100%. In some embodiments, the homogeneity is given to the whole length of the reference sequence. The comparison of sequence homogeneity can be determined with instruments known in the art, preferably using optimal sequence alignment, for example, using Align, using standard settings, preferably EMBOSS::needle, Matrix:Blosum62, Gap Open 10.0, Gap Extend 0.5.

[0082] As used herein, "nucleotides" include deoxyribonucleotides and ribonucleotides and their derivatives. As used herein, "ribonucleotides" are constituents of ribonucleic acid (RNA), consisting of one base molecule, one pentose molecule, and one phosphate molecule. They refer to nucleotides with a hydroxyl group at the 2' position of the β-D-ribofuranosyl group. "Deoxyribonucleotides" are constituents of deoxyribonucleic acid (DNA), also consisting of one base molecule, one pentose molecule, and one phosphate molecule. They refer to nucleotides in which the hydroxyl group at the 2' position of the β-D-ribofuranosyl group is replaced by hydrogen, and are the main chemical components of chromosomes. "Nucleotides" are usually referred to by a single letter representing the base: "A (a)" refers to deoxyadenosine or adenylate containing adenine, "C (c)" refers to deoxycytidine or cytidine containing cytosine, "G (g)" refers to deoxyguanosine or guanylate containing guanine, "U (u)" refers to uridine containing uracil, and "T (t)" refers to deoxythymidylate containing thymine.

[0083] As used herein, the terms "polynucleotide" and "nucleic acid" are used interchangeably to refer to a polymer of deoxyribonucleotides (deoxyribonucleic acid, DNA) or a polymer of ribonucleotides (ribonucleic acid, RNA). "Polynucleotide sequence," "nucleic acid sequence," and "nucleotide sequence" are used interchangeably to refer to the order of nucleotides in a polynucleotide. It will be understood by those skilled in the art that a DNA coding strand (sense strand) and the RNA it encodes can be considered to have the same nucleotide sequence, with deoxythymidylic acid in the DNA coding strand sequence corresponding to uridine in the RNA sequence it encodes.

[0084] As used herein, the term "expression" includes transcription and / or translation of a nucleotide sequence. Thus, expression can involve the production of transcripts and / or polypeptides. The term "transcription" refers to the process by which the genetic code in a DNA sequence is transcribed into RNA (transcript). The term "in vitro transcription" refers to the synthesis of RNA, particularly mRNA, in a cell-free system (e.g., in an appropriate cell extract) in vitro (see, e.g., Pardi N., Muramatsu H., Weissman D., Karikó K. (2013). In: Rabinovich P. (eds) Synthetic Messenger RNA and Cell Metabolism Modulation. Methods in Molecular Biology (Methods and Protocols), vol 969. Humana Press, Totowa, NJ.). A vector that can be used to produce a transcript is also referred to as a "transcription vector," which contains regulatory sequences required for transcription. The term "transcription" encompasses "in vitro transcription."

[0085] As used herein, "encoding" refers to the inherent property of a specific nucleotide sequence within a polynucleotide, such as a gene, cDNA, or mRNA, which can serve as a template for the synthesis of polymers and macromolecules involved in other biological processes, given a well-defined nucleotide sequence or amino acid sequence. Thus, a gene encoding a protein means that the gene's mRNA, through transcription and translation, produces the protein in a cell or other biological system.

[0086] Unless otherwise stated, all methods described herein can be performed in any suitable order.

[0087] pluripotent stem cells

[0088] In one aspect, the present invention provides a low immunogenicity pluripotent stem cell, comprising:

[0089] reduced endogenous major histocompatibility class I antigen (MHC-I) function compared to parental pluripotent stem cells;

[0090] Reduced endogenous major histocompatibility class II antigen (MHC-II) function compared to the parental pluripotent stem cell; and

[0091] Reduced sensitivity to NK cell killing compared to parental pluripotent stem cells.

[0092] Herein, parental pluripotent stem cells refer to parental pluripotent stem cells (also referred to herein as “WT”) before immune modification, which have not undergone a gene editing procedure to achieve low immunogenicity.

[0093] In a particularly preferred embodiment, the reduced sensitivity to NK cell killing is caused by increased expression of the GSN protein.

[0094] As will be appreciated by those skilled in the art, reduction of function can be achieved in a variety of ways, including removing nucleic acid sequences from a gene, interrupting sequences with other sequences, or altering regulatory components of the nucleic acid. For example, all or part of the coding region of the target gene can be removed or replaced with a "nonsense" sequence, frameshift mutations can be performed, all or part of regulatory sequences, such as promoters, can be removed or replaced, translation initiation sequences can be deleted or replaced, etc.

[0095] As will be appreciated by those skilled in the art, the reduction in MHC I (HLA I when the cells are derived from human cells) function in pluripotent stem cells can be measured using techniques known in the art and described below; for example, FACS techniques using labeled antibodies that bind to the HLA complex; for example, commercially available HLA-A, HLA-B, HLA-C antibodies that bind to human major histocompatibility HLA class I. The reduction in MHC II (HLA II when the cells are derived from human cells) function in pluripotent stem cells can be measured using techniques known in the art and described below; for example, FACS techniques using labeled antibodies that bind to the HLA complex; for example, commercially available HLA-DQ, HLA-DR, HLA-DP antibodies that bind to human major histocompatibility HLA class II.

[0096] In some embodiments, the MHC-I function is reduced by reducing the activity of MHC class I proteins.

[0097] In one embodiment, the MHC class I protein comprises a human leukocyte antigen-A (HLA-A) protein, a human leukocyte antigen-B (HLA-B) protein, or a human leukocyte antigen-C (HLA-C) protein.

[0098] In some embodiments, the MHC-I function is reduced by reducing the activity of an MHC-I transcriptional regulator. In some preferred embodiments, the MHC-I transcriptional regulator can be selected from one or more of: beta 2 microglobulin (B2M), transporter associated with antigen processing 1 (TAP1), transporter associated with antigen processing 2 (TAP2), transporter associated with antigen processing (TAP)-associated glycoprotein (Tapasin), or NOD-like receptor family caspase recruitment domain 5 (NLRC5).

[0099] In one embodiment, the MHC-I function is reduced by reducing the activity of the HLA-A protein.

[0100] In one embodiment, the MHC-I function is reduced by knocking out the gene encoding the HLA-A protein.

[0101] In one embodiment, the MHC-I function is reduced by reducing the activity of an HLA-B protein.

[0102] In one embodiment, the MHC-I function is reduced by knocking out the gene encoding the HLA-B protein.

[0103] In one embodiment, the MHC-I function is reduced by reducing the activity of the HLA-C protein.

[0104] In one embodiment, the MHC-I function is reduced by knocking out the gene encoding the HLA-C protein.

[0105] In one embodiment, the MHC-I function is reduced by reducing the activity of TAP1 protein.

[0106] In one embodiment, the MHC-I function is reduced by knocking out the gene encoding the TAP1 protein.

[0107] In one embodiment, the MHC-I function is reduced by reducing the activity of the TAP2 protein.

[0108] In one embodiment, the MHC-I function is reduced by knocking out the gene encoding the TAP2 protein.

[0109] In one embodiment, the MHC-I function is reduced by reducing the activity of the Tapasin protein.

[0110] In one embodiment, the MHC-I function is reduced by knocking out the gene encoding the Tapasin protein.

[0111] In one embodiment, the MHC-I function is reduced by reducing the activity of the NLRC5 protein.

[0112] In one embodiment, the MHC-I function is reduced by knocking out the gene encoding the NLRC5 protein.

[0113] In a preferred embodiment, the MHC-I function is reduced by reducing the activity of the B2M protein.

[0114] In one embodiment, the B2M protein is a human B2M protein, which comprises the amino acid sequence shown in SEQ ID NO:1 or an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence shown in SEQ ID NO:1.

[0115] In one embodiment, the MHC-I function is reduced by knocking out the gene encoding the B2M protein.

[0116] In some embodiments, the MHC-II function is reduced by reducing the activity of an MHC class II protein.

[0117] In one embodiment, the MHC class II protein comprises a human leukocyte antigen-DR (HLA-DR) protein, a human leukocyte antigen-DQ (HLA-DQ) protein, or a human leukocyte antigen-DP (HLA-DP) protein.

[0118] In some embodiments, the MHC-II function is reduced by reducing the activity of an MHC-II transcriptional regulator. In some preferred embodiments, the MHC-II transcriptional regulator can be selected from one or more of: MHC-II transactivator protein (CIITA), regulatory factor X-associated anchor protein (RFXANK), regulatory factor X5 (RFX5), and regulatory factor X-associated protein (RFXAP).

[0119] In one embodiment, the MHC-II function is reduced by reducing the activity of the HLA-DR protein.

[0120] In one embodiment, the MHC-II function is reduced by knocking out the gene encoding the HLA-DR protein.

[0121] In one embodiment, the MHC-II function is reduced by reducing the activity of the HLA-DQ protein.

[0122] In one embodiment, the MHC-II function is reduced by knocking out the gene encoding the HLA-DQ protein.

[0123] In one embodiment, the MHC-II function is reduced by reducing the activity of the HLA-DP protein.

[0124] In one embodiment, the MHC-II function is reduced by knocking out the gene encoding the HLA-DP protein.

[0125] In one embodiment, the MHC-II function is reduced by reducing the activity of the RFXANK protein.

[0126] In one embodiment, the MHC-II function is reduced by knocking out the gene encoding the RFXANK protein.

[0127] In one embodiment, the MHC-II function is reduced by reducing the activity of the RFX5 protein.

[0128] In one embodiment, the MHC-II function is reduced by knocking out the gene encoding the RFX5 protein.

[0129] In one embodiment, the MHC-II function is reduced by reducing the activity of the RFXAP protein.

[0130] In one embodiment, the MHC-II function is reduced by knocking out the gene encoding the RFXAP protein.

[0131] In a preferred embodiment, the MHC-II function is reduced by reducing the activity of the CIITA protein.

[0132] In one embodiment, the CIITA protein is a human CIITA protein comprising the amino acid sequence of SEQ ID NO: 2 or an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID NO: 2.

[0133] In one embodiment, the MHC-II function is reduced by knocking out the gene encoding the CIITA protein.

[0134] In a preferred embodiment, CRISPR technology is used to knock out a gene. In some cases, CRISPR technology is used to introduce small deletions / insertions into the coding region of a gene so that no functional protein is produced, usually as a result of a frameshift mutation, which results in the generation of a stop codon, resulting in a truncated, non-functional protein.

[0135] The successful reduction of MHC-I (HLA-I when the cells are derived from human cells) function and MHC-II (HLA-II when the cells are derived from human cells) function in pluripotent stem cells can be measured using techniques known in the art, such as Western blotting using protein antibodies, FACS technology, RT-PCR, qPCR technology, etc.

[0136] In some embodiments, the reduced sensitivity to NK cell killing is caused by increased expression of GSN protein in pluripotent stem cells. This can be accomplished in several ways, as will be appreciated by those skilled in the art, using "knock-in" or transgenic techniques. In some cases, increased GSN expression is caused by one or more GSN transgenes.

[0137] Thus, in some embodiments, one or more copies of the GSN gene are added to pluripotent stem cells under the control of an inducible or constitutive promoter. In some embodiments, a lentiviral construct is used as described herein or known in the art. As is known in the art, the GSN gene can be integrated into the genome of the host cell under the control of an appropriate promoter.

[0138] In one embodiment, the increased GSN protein expression is caused by a GSN transgene.

[0139] In one embodiment, the GSN protein is a human GSN protein comprising the amino acid sequence encoded by SEQ ID NO:4, or an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence encoded by SEQ ID NO:4.

[0140] The presence of sufficient GSN protein expression can be determined using known techniques, such as those described in the Examples, for example, using Western blot, ELISA assay, or FACS assay. Generally, "sufficient" in this context means an increase in GSN protein expression on the surface of pluripotent stem cells that silences NK cell killing.

[0141] In another aspect, the present invention further provides a low immunogenic pluripotent stem cell comprising:

[0142] One or more changes that reduce the activity of endogenous B2M protein;

[0143] One or more changes that reduce the activity of endogenous CIITA protein; and

[0144] One or more alterations result in increased expression of GSN protein in the low immunogenic pluripotent stem cells.

[0145] In one embodiment, the low immunogenic pluripotent stem cells comprise:

[0146] one or more alterations that inactivate both alleles of the endogenous B2M gene;

[0147] One or more alterations that inactivate both alleles of the endogenous CIITA gene; and

[0148] One or more alterations result in increased GSN gene expression in the low immunogenic pluripotent stem cells.

[0149] As used herein, the term "change" or "hereditary alteration" refers to causing a cell, such as a change in pluripotent stem cells as described herein, which can be achieved, for example, by modifying a genome or introducing a new gene fragment. In this article, modifying a genome refers to modifying the nucleic acid sequence in a cell or under a cell-free condition to produce transformed pluripotent cells and pluripotent stem cells. The technology of exemplary "change" or "hereditary alteration" includes but is not limited to homologous recombination, knocking in, ZFN (zinc finger nuclease), TALEN (transcription activator-like effector nuclease), CRISPR (clustered regularly interspaced short palindromic repeats) / Cas9 and other site-specific nuclease technologies. These technologies enable double-stranded DNA breaks to be carried out at the desired gene locus. These controlled double-strand breaks promote the homologous recombination of specific gene locus points. The process focuses on the specific sequence of nucleic acid molecules targeted with endonucleases, such as chromosomes, and the endonucleases recognize and bind to sequences and induce double-strand breaks in nucleic acid molecules. Double-strand breaks are repaired by fallible non-homologous end joining (NHEJ) or by homologous recombination (HR). Exemplary "alteration" or "genetic alteration" techniques also include the introduction of gene expression modifying molecules, including but not limited to siRNA, shRNA, microRNA, antisense RNA, antisense oligonucleotides ASO (antisense oligonucleotides) or anti-miRNA oligonucleotides AMO (anti-miRNA oligonucleotides).

[0150] Those skilled in the art will appreciate that many different techniques can be used to engineer the pluripotent cells and pluripotent stem cells of the present invention to render them less immunogenic.

[0151] Typically, these techniques can be used alone or in combination. For example, CRISPR technology can be used to reduce the expression of active B2M and / or CIITA proteins in modified cells, and viral technology (e.g., lentivirus) can be used to knock in the GSN gene. In addition, those skilled in the art will appreciate that these genes can be manipulated in different orders using different techniques.

[0152] In some embodiments, the hypoimmunogenic pluripotent stem cells of the present invention comprise one or more changes that reduce endogenous major histocompatibility class I antigen (MHC-I) function. In some embodiments, the hypoimmunogenic pluripotent stem cells of the present invention comprise one or more changes that reduce endogenous major histocompatibility class II antigen (MHC-II) function. In some embodiments, the hypoimmunogenic pluripotent stem cells of the present invention comprise one or more changes that reduce sensitivity to NK cell killing.

[0153] In some embodiments, the hypoimmunogenic pluripotent stem cells of the present invention comprise one or more alterations that reduce the activity of endogenous B2M protein. In some embodiments, the hypoimmunogenic pluripotent stem cells of the present invention comprise one or more alterations that reduce the activity of endogenous CIITA protein. In some embodiments, the hypoimmunogenic pluripotent stem cells of the present invention comprise one or more alterations that increase the expression of GSN protein.

[0154] In some embodiments, the hypoimmunogenic pluripotent stem cells of the present invention comprise one or more alterations that inactivate both alleles of the endogenous B2M gene. In some embodiments, the hypoimmunogenic pluripotent stem cells of the present invention comprise one or more alterations that inactivate both alleles of the endogenous CIITA gene. In some embodiments, the hypoimmunogenic pluripotent stem cells of the present invention comprise one or more alterations that increase expression of the GSN gene.

[0155] In some embodiments, the low immunogenicity pluripotent stem cells of the present invention comprise one or more changes that inhibit the expression of endogenous B2M protein. In some embodiments, the low immunogenicity pluripotent stem cells of the present invention comprise one or more changes that inhibit the expression of endogenous CIITA protein.

[0156] In some embodiments, the low immunogenic pluripotent stem cells of the present invention comprise one or more changes that interfere with the expression of endogenous B2M protein. In some embodiments, the low immunogenic pluripotent stem cells of the present invention comprise one or more changes that interfere with the expression of endogenous CIITA protein.

[0157] In some embodiments, the low immunogenicity pluripotent stem cells of the present invention comprise one or more changes that can reduce the expression of endogenous B2M protein. In some embodiments, the low immunogenicity pluripotent stem cells of the present invention comprise one or more changes that can reduce the expression of endogenous CIITA protein.

[0158] In some embodiments, the low immunogenic pluripotent stem cells of the present invention comprise one or more alterations that knock out endogenous B2M protein. In some embodiments, the low immunogenic pluripotent stem cells of the present invention comprise one or more alterations that knock out endogenous CIITA protein.

[0159] In one embodiment, the pluripotent stem cells are altered using Clustered Regularly Interspaced Short Palindromic Repeats / Cas ("CRISPR") technology known in the art to reduce the activity of endogenous B2M protein.

[0160] In one embodiment, the pluripotent stem cells are altered using Clustered Regularly Interspaced Short Palindromic Repeats / Cas ("CRISPR") technology known in the art to reduce the activity of endogenous CIITA protein.

[0161] In one embodiment, the pluripotent stem cells are altered using Clustered Regularly Interspaced Short Palindromic Repeats / Cas ("CRISPR") technology known in the art to inactivate both alleles of the endogenous B2M gene.

[0162] In one embodiment, the pluripotent stem cells are altered using Clustered Regularly Interspaced Short Palindromic Repeats / Cas ("CRISPR") technology known in the art to inactivate both alleles of the endogenous CIITA gene.

[0163] Determination of whether the test gene has been inactivated is known and described herein. In one embodiment, the determination is a Western blot of cell lysates probed with antibodies against B2M protein or CIITA protein. In another embodiment, reverse transcriptase polymerase chain reaction (RT-PCR) confirms the presence of inactivation changes.

[0164] In one embodiment, viral techniques known in the art can be used to induce increased expression of the GSN gene in the hypoimmunogenic pluripotent stem cells. Such viral techniques include, but are not limited to, the use of retroviral vectors, lentiviral vectors, adenoviral vectors, and Sendai viral vectors. In some embodiments, a nucleic acid sequence encoding the GSN protein is introduced into a selected site in the cells; the selected site in the cells is a safe harbor gene locus, such as AAVS1 or CCR5. As used herein, a "safe harbor gene locus" refers to a site that can be used for safe gene knock-in and ensures normal and stable expression of the introduced gene.

[0165] In a preferred embodiment, a lentiviral vector is used to induce increased expression of the GSN gene in the low immunogenic pluripotent stem cells.

[0166] In one embodiment, the low immunogenic pluripotent stem cells are human pluripotent stem cells.

[0167] In one embodiment, the B2M protein is a human B2M protein, which comprises the amino acid sequence shown in SEQ ID NO:1 or an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence shown in SEQ ID NO:1.

[0168] In one embodiment, the CIITA protein is a human CIITA protein comprising the amino acid sequence of SEQ ID NO: 2 or an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence of SEQ ID NO: 2.

[0169] In one embodiment, the GSN protein is a human GSN protein comprising the amino acid sequence encoded by SEQ ID NO:4, or an amino acid sequence that is at least 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% identical to the amino acid sequence encoded by SEQ ID NO:4.

[0170] In one embodiment, the hypoimmunogenic stem cells comprise:

[0171] reduced endogenous major histocompatibility class I antigen (MHC-I) function compared to parental pluripotent stem cells;

[0172] Reduced endogenous major histocompatibility class II antigen (MHC-II) function compared to the parental pluripotent stem cell; and

[0173] Reduced sensitivity to NK cell killing compared to parental pluripotent stem cells.

[0174] In one embodiment, the T cell response elicited by the low immunogenicity pluripotent stem cells is lower than the T cell response elicited by the parental pluripotent stem cells, and the parental pluripotent stem cells do not contain the changes that reduce the activity of B2M and CIITA proteins and the changes that increase GSN protein expression. In one embodiment, the T cell response is measured by measuring the killing activity of T cells against the low immunogenicity pluripotent stem cells or the parental pluripotent stem cells using real-time label-free kinetic cell analysis (RTCA).

[0175] In one embodiment, the natural killer (NK) cell response elicited by the low immunogenic pluripotent stem cells is lower than the NK cell response elicited by cloned DKO cells with B2M / CIITA biallelic knockout, and the DKO cells include the changes that reduce the activity of B2M and CIITA proteins but do not include the changes that cause increased GSN protein expression. In one embodiment, the NK cell response is measured by measuring the IFN-γ level of NK cells incubated in vitro with the low immunogenic pluripotent stem cells or DKO cells. In one embodiment, the NK cell response is measured by real-time label-free dynamic cell analysis (RTCA) to measure the lethality of NK cells to the low immunogenic pluripotent stem cells or DKO cells.

[0176] Method for producing low immunogenic pluripotent stem cells of the present invention

[0177] The present invention also provides a method for producing the low immunogenic pluripotent stem cells of the present invention, the method comprising: reducing the endogenous major histocompatibility class I antigen (MHC-I) function in the pluripotent stem cells; reducing the endogenous major histocompatibility class II antigen (MHC-II) function in the pluripotent stem cells; and increasing the expression of a protein that reduces the sensitivity of the pluripotent stem cells to NK cell killing, wherein the protein is GSN protein.

[0178] In some embodiments, the method comprises: reducing the activity of a B2M protein in the pluripotent stem cells; reducing the activity of a CIITA protein in the pluripotent stem cells; and increasing the expression of a GSN protein in the pluripotent stem cells.

[0179] In one embodiment, the method comprises: eliminating the activity of both alleles of the B2M gene in the pluripotent stem cells; eliminating the activity of both alleles of the CIITA gene in the pluripotent stem cells; and increasing the expression of the GSN gene in the pluripotent stem cells.

[0180] In some embodiments, the activity of the B2M protein in the pluripotent stem cells can be reduced by the technology of "changing" or "genetic change" as described above. In some embodiments, the activity of the CIITA protein in the pluripotent stem cells can be reduced by the technology of "changing" or "genetic change" as described above. The technology, for example, introduces gene expression modification molecules, clustered regularly interspaced short palindromic repeats (CRISPR) technology, transcription activator-like effector nuclease (TALEN) technology, zinc finger nuclease (ZFN) technology or homologous recombination technology. In a preferred embodiment, the gene expression modification molecule comprises siRNA, shRNA, microRNA, antisense RNA, antisense oligonucleotides ASO (antisense oligonucleotides) or anti-miRNA oligonucleotides AMO (Anti-miRNAoligonucleotides).

[0181] In some embodiments, the CRISPR / Cas system includes a Cas protein or a nucleic acid sequence encoding a Cas protein and at least one to two ribonucleic acids (e.g., gRNA), which can guide the Cas protein to a target motif of a target polynucleotide sequence and hybridize to the target motif. In some embodiments, the CRISPR / Cas system includes a Cas protein or a nucleic acid sequence encoding a Cas protein and a single ribonucleic acid or at least one ribonucleic acid (e.g., gRNA) pair, which can guide the Cas protein to a target motif of a target polynucleotide sequence and hybridize to the target motif.

[0182] In some embodiments, the Cas protein comprises one or more amino acid substitutions or modifications. In some embodiments, one or more amino acid substitutions comprise conservative amino acid substitutions. In some cases, substitutions and / or modifications can prevent or reduce proteolytic degradation and / or prolong the half-life of the polypeptide in the cell. In some embodiments, the Cas protein may comprise peptide bond replacements (e.g., urea, thiourea, carbamate, sulfonylurea, etc.). In some embodiments, the Cas protein may comprise naturally occurring amino acids. In some embodiments, the Cas protein may comprise optional amino acids (e.g., D-amino acids, β-amino acids, homocysteine, phosphoserine, etc.). In some embodiments, the Cas protein may comprise modifications to include portions (e.g., pegylation, glycosylation, lipidation, acetylation, end-capping, etc.).

[0183] In some embodiments, the Cas protein comprises a core Cas protein. Exemplary Cas core proteins include but are not limited to Cas1, Cas2, Cas3, Cas4, Cas5, Cas6, Cas7, Cas8, and Cas9. In some embodiments, the Cas protein comprises a Cas protein of the Escherichia coli (E. coli) subtype (also referred to as CASS2). Exemplary Cas proteins of the E. coli subtype include but are not limited to Cse1, Cse2, Cse3, Cse4, and Cas5e. In some embodiments, the Cas protein comprises a Cas protein of the Ypest subtype (also referred to as CASS3). Exemplary Cas proteins of the Ypest subtype include but are not limited to Csy1, Csy2, Csy3, and Csy4. In some embodiments, the Cas protein comprises a Cas protein of the Nmeni subtype (also referred to as CASS4). Exemplary Cas proteins of the Nmeni subtype include but are not limited to Csn1 and Csn2. In some embodiments, the Cas protein comprises a Cas protein of the Dvulg subtype (also referred to as CASS1). Exemplary Cas proteins of the Dvulg subtype include but are not limited to Csd1, Csd2, and Cas5d. In some embodiments, the Cas protein comprises a Cas protein of the Tneap subtype (also known as CASS7). Exemplary Cas proteins of the Tneap subtype include but are not limited to Cst1, Cst2, and Cas5t. In some embodiments, the Cas protein comprises a Cas protein of the Hmari subtype. Exemplary Cas proteins of the Hmari subtype include but are not limited to Csh1, Csh2, and Cas5h. In some embodiments, the Cas protein comprises a Cas protein of the Apern subtype (also known as CASS5). Exemplary Cas proteins of the Apern subtype include but are not limited to Csa1, Csa2, Csa3, Csa4, Csa5, and Cas5a. In some embodiments, the Cas protein comprises a Cas protein of the Mtube subtype (also known as CASS6). Exemplary Cas proteins of the Mtube subtype include but are not limited to Csm1, Csm2, Csm3, Csm4, and Csm5. In some embodiments, the Cas protein comprises a RAMP-type Cas protein. Exemplary RAMP-type Cas proteins include but are not limited to Cmr1, Cmr2, Cmr3, Cmr4, Cmr5, and Cmr6.

[0184] In some embodiments, the Cas protein is Streptococcus pyogenes Cas9 protein or a functional portion thereof. In some embodiments, the Cas protein is Staphylococcus aureus Cas9 protein or a functional portion thereof. In some embodiments, the Cas protein is Streptococcus thermophilus Cas9 protein or a functional portion thereof. In some embodiments, the Cas protein is Neisseria meningitides Cas9 protein or a functional portion thereof. In some embodiments, the Cas protein is Treponema denticola Cas9 protein or a functional portion thereof. In some embodiments, the Cas protein is Cas9 protein from any bacterial species or a functional portion thereof. Cas9 protein is a member of the Type II CRISPR system, which typically includes a trans-encoded small RNA (tracrRNA), an endogenous ribonuclease 3 (rnc), and a Cas protein. The Cas9 protein (also known as CRISPR-associated nuclease Cas9 / Csn1) is a polypeptide containing 1368 amino acids.

[0185] In one embodiment, the activity of B2M protein in the pluripotent stem cells is reduced by clustered regularly interspaced short palindromic repeats (CRISPR) / Cas9 gene editing technology.

[0186] In one embodiment, the activities of both alleles of the B2M gene in the pluripotent stem cells are eliminated by clustered regularly interspaced short palindromic repeats (CRISPR) / Cas9 gene editing technology.

[0187] In one embodiment, the activity of CIITA protein in the pluripotent stem cells is reduced by clustered regularly interspaced short palindromic repeats (CRISPR) / Cas9 gene editing technology.

[0188] In one embodiment, the activity of both alleles of the CIITA gene in the pluripotent stem cells is eliminated by clustered regularly interspaced short palindromic repeats (CRISPR) / Cas9 gene editing technology.

[0189] In one embodiment, the expression of the GSN protein is increased by modifying the endogenous locus. In some embodiments, the endogenous locus is modified by a technique of "alteration" or "genetic alteration" as described above. Such techniques include, for example, gene knock-in, clustered regularly interspaced short palindromic repeats (CRISPR) technology, transcription activator-like effector nuclease (TALEN) technology, zinc finger nuclease (ZFN) technology, or homologous recombination technology.

[0190] In one embodiment, the expression of GSN protein is increased by expression of a transgene. GSN protein expression can be increased using transgenic expression techniques known in the art, including but not limited to viral technology, Piggybac transposon technology, and Sleeping Beauty transposon technology.

[0191] In this article, known recombinant techniques can be used to produce expression constructs as described herein. In certain embodiments, the nucleic acid sequence encoding the target protein can be operably connected to one or more regulatory nucleotide sequences in the expression construct. The regulatory nucleotide sequence is generally suitable for host cells and subjects to be treated. Various types of suitable expression vectors and suitable regulatory sequences are known in the art for use in a variety of host cells. Generally, one or more regulatory nucleotide sequences may include, but are not limited to, promoter sequences, leader sequences or signal sequences, ribosome binding sites, transcription start and stop sequences, translation start and stop sequences, and enhancer or activator sequences. The expression constructs used herein can use constitutive or inducible promoters known in the art. The promoter can be a naturally occurring promoter, or a hybrid promoter combining elements of more than one promoter. The expression construct can be present in the cell on an episome (e.g., a plasmid), or the expression construct can be inserted into a chromosome. In a specific embodiment, the expression vector includes a selectable marker gene to allow selection of transformed host cells. Some embodiments include an expression vector comprising a nucleotide sequence encoding the target protein operably connected to at least one regulatory sequence. Regulatory sequences used herein include promoters, enhancers, and other expression control elements. In certain embodiments, the expression vector is designed to select the host cell to be transformed, the desired protein to be expressed, the copy number of the vector, the ability to control the copy number, or the expression of any other protein encoded by the vector, such as an antibiotic marker. In some embodiments, the promoter is the EF1a promoter.

[0192] Viral techniques can be used to induce increased expression of the GSN gene in the low immunogenic pluripotent stem cells. The viral techniques include, but are not limited to, the use of retroviral vectors, lentiviral vectors, adenoviral vectors, and Sendai virus vectors.

[0193] In a preferred embodiment, a nucleic acid sequence encoding the GSN protein is synthesized and constructed into a lentiviral vector, and then at least one copy of the GSN gene under the control of a promoter is introduced into the pluripotent stem cells via the lentiviral vector to increase the expression of the GSN protein.

[0194] In one embodiment, a nucleic acid sequence encoding a GSN protein is introduced into a selected site in the genome of the pluripotent stem cell. In a preferred embodiment, the selected site is a safe harbor gene locus, such as AAVS1 or CCR5. As used herein, a "safe harbor gene locus" refers to a site that can be used for safe gene knock-in and ensures normal and stable expression of the transferred gene.

[0195] In one embodiment, the GSN protein is human GSN protein.

[0196] In one embodiment, the nucleic acid sequence encoding the GSN protein comprises the nucleic acid sequence of SEQ ID NO: 4, or a nucleic acid sequence that is at least 70%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% identical to the nucleic acid sequence of SEQ ID NO: 4.

[0197] Prevention or treatment

[0198] The present invention further provides use of cells differentiated from the low immunogenic pluripotent stem cells of the present invention or cells differentiated from the low immunogenic pluripotent stem cells prepared by the method of the present invention in preparing a drug for preventing or treating a disease requiring cell transplantation.

[0199] The low immunogenicity pluripotent stem cells of the present invention or the low immunogenicity pluripotent stem cells prepared by the method of the present invention can be induced to differentiate into different cells, which can be used for different prevention or treatment purposes, to prevent or treat different diseases. As will be understood by those skilled in the art, differentiation methods depend on the required cell types using known technology. For example, cells can be suspended for differentiation and then made into a gel matrix form, such as matrigel, gelatin or fibrin / thrombin form, to promote cell survival. Usually differentiation can be determined as known in the art by assessing the presence of cell-specific markers. For example, cells can be differentiated into cardiomyocytes, neurons, glial cells, endothelial cells, T cells, NK cells, NKT cells, macrophages, hematopoietic progenitor cells, mesenchymal cells, islet cells, chondrocytes, retinal pigment epithelial cells, kidney cells, hepatocytes, thyroid cells, skin cells, blood cells or epithelial cells under certain differentiation conditions.

[0200] In some embodiments, the disease is cancer, and the cancer comprises solid tumors and hematological tumors. In some embodiments, the solid tumor comprises small cell lung cancer, breast cancer, testicular cancer, neuroblastoma, ovarian cancer, or melanoma. In some embodiments, the hematological tumor comprises acute leukemia, chronic leukemia, lymphoma, myelodysplastic syndrome, or multiple myeloma.

[0201] In one embodiment, the disease comprises aplastic anemia.

[0202] In one embodiment, the disease comprises an innate immune deficiency disease.

[0203] In some embodiments, the disease is an autoimmune disease comprising systemic lupus erythematosus, rheumatoid arthritis, ankylosing spondylitis, or type I diabetes.

[0204] In some embodiments, the disease is a neurodegenerative disease comprising Parkinson's disease, Alzheimer's disease, spinal cord injury, retinal degeneration, stroke, Huntington's disease, or amyotrophic lateral sclerosis.

[0205] In some embodiments, the disease is a cardiovascular disease comprising atherosclerosis, hypertension, rheumatic heart disease, cardiomyopathy, arrhythmia, congenital heart disease, valvular heart disease, carditis, myocardial infarction, heart failure, aortic aneurysm, or peripheral arterial disease.

[0206] In some embodiments, the disease is a metabolic-related disease comprising type II diabetes, scurvy, hypoglycemia, hyperlipidemia, or osteoporosis.

[0207] Beneficial effects

[0208] The pluripotent stem cells of the present invention and the low-immunogenic pluripotent stem cells prepared by the method of the present invention can exhibit excellent effects, such as but not limited to: (1) having good self-renewal and differentiation capabilities; (2) being able to escape T cell killing; (3) being able to escape NK cell killing; and / or (4) the differentiated cells can also escape NK cell killing; thereby showing excellent application potential.

[0209] Example

[0210] The present invention is further described with reference to the following examples. It should be understood that these examples are intended to be illustrative only and are not intended to limit the present invention. The following materials and instruments are commercially available or prepared according to methods known in the art. The following experiments were performed according to the manufacturer's instructions or according to methods and procedures known in the art.

[0211] Example 1. Construction of B2M and CIITA double knockout cell line (DKO)

[0212] 1.1 Construction of B2M and CIITA double knockout cell line (DKO)

[0213] In the following examples, human pluripotent stem cell lines H1 (Wicell, WA01) or H9 (Wicell, WA09) were used to construct target cell lines. The cell culture and gene knockout reagents used are shown in Table 1.

[0214] Table 1. Cell culture and gene knockout reagents

[0215]

[0216]

[0217] CRISPR / CAS9 was used to knock out β-2-microglobulin (B2M) in the endoplasmic reticulum, preventing the formation of functional MHC-I molecules on the cell surface, thereby escaping allogeneic CD8 + Killing by T cells; killing by escaped CD4+ T cells is achieved by knocking out CIITA, a positive regulator of MHC-II gene transcription, thereby reducing the expression of MHC-II class molecules.

[0218] The CRISPR / CAS9 gene knockout strategy of B2M and the gRNA sequences and identification primers used are as follows Figure 1 As shown in Table 2, B2M-gRNA1 and B2M-gRNA2 (EasyEdit sgRNA, GenScript) were used to directly knock out the B2M exon segment at both ends, and then the knockout was verified by genomic sequence using two pairs of PCR primers, B2M-F1 / R1 and B2M-F2 / R2, respectively.

[0219] In addition, CIITA's CRISPR / CAS9 gene knockout strategy and the gRNA sequences and identification primers used are as follows Figure 2 As shown in Table 2, CIITA-gRNA1 and CIITA-gRNA2 (EasyEdit sgRNA, GenScript) were used to directly knock out the CIITA exon segment at both ends, and then the genome sequence knockout was verified using two pairs of PCR primers, CIITA-F1 / R1 and CIITA-F2 / R2, respectively.

[0220] Table 2. gRNA sequences and identification primers

[0221]

[0222] The specific operations are as follows:

[0223] 1) Culture human pluripotent stem cells in mTeSR1 medium supplemented with Y-27632 on a Matrigel-coated 6-well plate to 80% density. Digest with TrypLE, neutralize with DMEM / F12, and count. 6 Place cells in EP tubes and discard the supernatant after centrifugation.

[0224] 2) According to the Neon transfection system (ThermoFisher), 100 μL electroporation system was added with 15 μg TrueCut TMCas9 Protein + 3 μg gRNA (B2M-gRNA1 + B2M-gRNA2 + CIITA-gRNA1 + CIITA-gRNA2) constituted a ribonucleoprotein complex (RNP) system, which was mixed and placed at room temperature for 20 minutes.

[0225] 3) Resuspend the cells in 100 μL of RNP electroporation system and electroporate using the Neon transfection system at 1200 V, 30 ms, and 1 pause. Quickly add preheated culture medium to the electroporated cells and plate evenly in one well of a Matrigel-coated 6-well plate.

[0226] 4) Replace the mTeSR1 medium with fresh one every day. After the single cells grow up, pick a single clone in a 48-well plate. After the clone is expanded, collect the genome sample for PCR detection of gene editing. The PCR results are as follows: Figure 1 and 2 PCR-positive clones were sent to the company for Sanger sequencing for further verification.

[0227] 5) Expand, culture, and freeze the positive B2M / CIITA biallelic knockout (DKO) clones.

[0228] 1.2 Detection of RNA expression levels of B2M and CIITA in DKO

[0229] Total cellular RNA was extracted using the FastPure Cell / Tissue Total RNA Isolation Kit V2 (Novagen, RC112-01), and then converted to cDNA using HiScript III RT SuperMix for qPCR (Novagen, R323-01) according to the manufacturer's instructions.

[0230] qPCR was used to detect the expression of B2M and CIITA at the RNA level in B2M / CIITA biallelic knockout clones (DKO). The primers used are shown below.

[0231] B2M-F:AAGATGAGTATGCCTGCCGT

[0232] B2M-R:ATGCGGCATCTTCAAACCTC

[0233] CIITA-F:CCTGGAGCTTCTTAACAGCGA

[0234] CIITA-R:TGTGTCGGGTTCTGAGTAGAG

[0235] Using the Roche 480II instrument, the reaction system is as follows:

[0236] Pre-incubation, 95℃, 30s.

[0237] Amplification, 95°C for 10 s, 60°C for 30 s, 40 cycles.

[0238] Melting curve and Cooling are the default programs.

[0239] qPCR results are as follows Figure 3 As shown, compared with untreated wild-type human pluripotent stem cells, the expression of B2M and CIITA at the RNA level in B2M / CIITA biallelic knockout clones (DKO) was almost absent, confirming the successful knockout of B2M and CIITA.

[0240] 1.3 Detection of B2M protein expression in DKO

[0241] Western blotting was used to detect the expression of B2M protein levels in the B2M / CIITA biallelic knockout clone DKO (B2M antibody catalog number is ab75853; internal control antibody GAPDH catalog number is ab181602, both purchased from Abcam).

[0242] Western blot results Figure 4 As shown, compared with wild-type human pluripotent stem cells, the B2M protein in DKO was significantly decreased, confirming the successful knockout of B2M protein.

[0243] 1.4 Detection of HLA-I / II molecules in DKO

[0244] IFN-γ (PeproTech, Cat#300-02) was used to stimulate WT and DKO cells to detect HLA class I / II molecules on the surface of H1 cells. The specific detection method is as follows:

[0245] The cells were plated and culture medium containing IFN-γ was added to the cells when the medium was changed on the next day. After 48 hours, the cells were digested and the expression of HLA-I / II was detected using a flow cytometer (Agilent Technologies, NovoCyte).

[0246] The flow cytometry results are as follows Figure 5As shown, HLA-ABC on the left detects HLA-I molecules; HLA-DR, DQ, and DP on the right detect HLA-II molecules; T cells serve as a positive control. It was observed that B2M / CIITA biallelic knockout (DKO) clones failed to express HLA-I / II molecules in response to IFN-γ stimulation, demonstrating reduced HLA-I and HLA-II function in DKO cells.

[0247] Karyotype detection of 1.5DKO

[0248] Karyotype detection was performed on the obtained B2M / CIITA biallelic knockout (DKO) positive clones. The specific detection method is as follows:

[0249] Chromosome specimens fixed on glass slides are treated with trypsin and then stained with Giemsa stain. Metaphase chromosomes are analyzed for number and morphology based on characteristics such as chromosome length, centromere position, ratio of long and short arms, and the presence of satellites to determine whether their karyotype is consistent with a normal karyotype.

[0250] Karyotype test results such as Figure 6 As shown, the DKO karyotype is normal and has no significant changes compared with the normal karyotype.

[0251] Example 2. Stemness and immune function of DKO cell lines

[0252] This example further examines whether the stemness and immune function of pluripotent stem cells change after knocking out both B2M / CIITA alleles.

[0253] 2.1 Expression of stemness genes in DKO cells

[0254] Immunofluorescence was used to detect the protein levels of the stemness genes POU5F1 and NANOG in WT and DKO cells. RT-qPCR was used to detect the expression of the stemness genes POU5F1, NANOG, and SOX2 at the RNA level in WT and DKO cells. Flow cytometry was used to detect the expression of the stemness genes SSEA-4 and Tra1-81 on the cell surface in WT and DKO cells. The specific detection methods are as follows:

[0255] Immunofluorescence assay: WT or DKO cells were plated in 12-well plates. After cells reached 60-80% confluence, the medium was aspirated and fixed with 4% paraformaldehyde. After permeabilization, cells were incubated with primary antibodies against POU5F1 and NANOG overnight at 4°C. After washing away the primary antibodies, fluorescently labeled secondary antibodies were incubated at room temperature. Images were then taken using a fluorescence microscope (Nikon Ts2R-FL).

[0256] RT-qPCR detection:

[0257] Using the Roche 480II instrument, the reaction system is as follows:

[0258] Pre-incubation, 95℃, 30s.

[0259] Amplification, 95°C for 10 s, 60°C for 30 s, 40 cycles.

[0260] Melting curve and Cooling are the default programs.

[0261] Mesenchymal stem cells (MSCs) served as a negative control for stemness gene expression.

[0262] Flow cytometry:

[0263] After harvesting the cells, incubate the antibodies in an EP tube at 4°C in the dark for 30 minutes. Then, select the appropriate fluorescence acquisition channel based on the antibody information and monitor the fluorescence on a fluorescence microscope. All antibodies were from BD Biosciences.

[0264] Immunofluorescence test results Figure 7A As shown in Figure 2, both WT and DKO cells expressed the stemness genes POU5F1 and NANOG at the protein level, and the expression of stemness genes POU5F1 and NANOG in DKO cells was not significantly different from that in WT cells. Figure 7B As shown in Figure 2, WT and DKO cells expressed stemness genes POU5F1, NANOG, and SOX2 at the RNA level, and there was no significant difference in the expression of stemness genes POU5F1, NANOG, and SOX2 in DKO cells compared with WT cells. Figure 7C As shown, both WT and DKO cells highly expressed stemness genes SSEA-4 (WT 100% and DKO 99.98%) and Tra1-81 (WT 96.75% and DKO 99.13%) on their cell surfaces.

[0265] Differentiation capacity of 2.2DKO cells

[0266] In this example, the differentiation ability of DKO cells was detected. The specific detection method was as follows: 100 μL containing 5×10 5 DKO cell suspension was prepared and the teratoma volume was larger than 1.5 cm 3 The tissues were then removed, sectioned into paraffin and stained with hematoxylin and eosin.

[0267] The staining results are as follows Figure 8As shown, B2M / CIITA biallelic knockout DKO cells can form teratomas in vivo and differentiate into cells of the inner, middle and outer germ layers. DKO cells have normal differentiation ability of the three germ layers.

[0268] 2.3DKO Cell Immune Function

[0269] T cell and NK cell cytotoxicity assays were performed using the xCELLigence RTCA Instrument to examine changes in DKO cell immune function. Reagents used in these cytotoxicity assays are listed in Table 3.

[0270] Equal amounts of WT and DKO cell lines were resuspended in Essential 8 medium containing human IL-2 and seeded onto Matrigel-coated 96-well E-plates. Activated T cells (XC11228, purchased from SAILYBIO) or NK cells (XC11013, purchased from SAILYBIO) were added for cytotoxicity assays. T cells were assayed for CD3, CD4, and CD8 by flow cytometry, while NK cells were assayed for CD16 and CD56 by flow cytometry before use to ensure the functionality of the T and NK cells used. RTCA assay data were analyzed using xCELLigence software to calculate cytotoxicity and escape function.

[0271] Table 3. Reagents used in the killing experiment

[0272] name Cat No. Specification factory PE anti-human CD4 980804 500 μl / tube Biolegend APC anti-human CD8 980904 500 μl / tube Biolegend FITC anti-human CD3 300440 500 times Biolegend APC anti-human CD16 301012 100 times Biolegend PE anti-human CD56 (NCAM) 318306 100 times Biolegend human IL-2 202-1L-050 / CF 50 μg R&D Y-27632 2HCl S1049 5mg Selleck Matrigel 354277 5ml Gibco <![CDATA[Essential 8 TM Culture medium]]> A1517001 500ml Gibco E-Plate VIEW 96PET 300601030 6 pieces / box Agilent

[0273] RTCA results are as follows Figure 9 As shown, WT cells escape NK cell cytotoxicity due to HLA-I expression, but are cytotoxic to T cells. DKO cells can escape T cell cytotoxicity but are more sensitive to NK cell cytotoxicity.

[0274] Example 3. Construction of DKO+CD47 cell line and verification of immune function

[0275] 3.1 Construction of DKO+CD47 cell line

[0276] In this example, a lentiviral vector was used to overexpress CD47 (NM_198793) in the DKO cells obtained in Example 1. The amino acid sequence of CD47 is shown in SEQ ID NO: 5.

[0277] The nucleic acid sequence encoding CD47 protein (SEQ ID NO: 6) was constructed into a lentiviral vector (pGC-EF1a) driven by EF1a and carrying a puromycin selection marker. The structure of the pGC-EF1a vector is as follows: Figure 10 The specific operation method is as follows:

[0278] The lentiviral vector was digested with BamHI / NheI, and the nucleic acid sequence encoding the CD47 protein (SEQ ID NO: 6) was ligated into the lentiviral vector. Sanger sequencing was used to verify the correctness of the inserted sequence, and viral packaging was performed. The lentiviral vector was transfected into the DKO cells constructed in Example 1. After 24 hours, the medium was changed, and after 48 hours, the medium was changed to puromycin-containing medium for selection.

[0279] The constructed stably transfected DKO+CD47 cells were subjected to flow cytometry (CD47 antibody purchased from Biolegend, FACS, Cat. No. 323108) and qPCR analysis. The qPCR primers were CD47-F: AGAAGGTGAAACGATCATCGAGC; CD47-R: CTCATCCATACCACCGGATCT.

[0280] Test results such as Figure 11A and 11B As shown, the expression level of CD47 in the constructed DKO+CD47 cell line was significantly higher than that in WT cells. The validated DKO+CD47 cell line was then expanded and subsequently functionally tested.

[0281] 3.2 Verification of the immune function of DKO+CD47

[0282] RTCA was used to detect whether the overexpressed DKO+CD47 cell line could successfully escape the killing of NK cells while escaping T cell killing. For the specific detection method, see Example 2.3.

[0283] RTCA test such as Figure 12 As shown, NK cells can effectively kill DKO cells, while WT and DKO+CD47-overexpressing cells can escape NK killing.

[0284] Example 4. Construction of DKO+GSN cell line and detection of stemness and differentiation ability

[0285] 4.1 Construction of DKO+GSN cell line and overexpression detection

[0286] The nucleic acid sequence encoding the GSN protein (the amino acid sequence of the GSN protein is the amino acid sequence encoded by SEQ ID NO: 4) was directly synthesized. The nucleic acid sequence is shown in SEQ ID NO: 4

[0287] As described in Example 3.1, a lentiviral vector (pGC-EF1a) was constructed that was driven by EF1a and carried a puromycin selection marker. The structure of the pGC-EF1a vector is as follows: Figure 10The vector was digested with BamHI / NheI, and the synthesized GSN nucleic acid sequence was ligated into a lentiviral vector. After successful ligation, Sanger sequencing was used to verify the correctness of the inserted sequence, and viral packaging was performed. The lentiviral vector was transfected into the DKO cells constructed in Example 1. After 24 hours, the medium was changed, and after 48 hours, the medium was switched to puromycin-containing medium for selection.

[0288] The constructed DKO+GSN cell line was used to detect the overexpression level of mRNA using qPCR and RT-PCR, and WT cells were used as negative controls. The primers used are shown in Table 5.

[0289] Table 4. qPCR detection primers for GSN

[0290] Primer sequences specific sequence GSN F1 GAAGCTCTGACCTCCGCTAA GSN R1 TCCCAAGAACCACCCTACAA

[0291] Test results such as Figure 13 As shown, GSN was highly expressed in the constructed DKO+GSN cell line.

[0292] 4.2 Expression of stemness genes in the DKO+GSN cell line

[0293] The expression of stemness genes in the DKO+GSN cell line was detected by immunofluorescence and flow cytometry. For specific detection methods, see Example 2.1.

[0294] Immunofluorescence test results Figure 14 As shown, the constructed DKO+GSN cells expressed stemness genes OCT4, NANOG, SOX2, TRA-1-60, and TRA-1-81 at the protein level.

[0295] Flow cytometry results Figure 15 As shown, the stemness genes SSEA-4, TRA-1-60, Tra1-81 and OCT4 were highly expressed on the surface of DKO+GSN cells, and the proportions of each stemness gene were 98.89%, 98.73%, 95.87% and 98.92%, respectively.

[0296] 4.3DKO+GSN cell line's ability to differentiate into three germ layers

[0297] DKO+GSN cells were used to test the ability of three germ layers to differentiate. To generate mesoderm, endoderm, and ectoderm cells, the dissociated DKO+GSN single cells were resuspended in three germ layer culture media supplemented with Y27632, and an appropriate number of cells were attached to a well plate coated with a matrigel-coated cell slide. After 24 hours, the culture medium was replaced with preheated differentiation medium. The medium was changed every day until the seventh day to obtain mesoderm, endoderm, and ectoderm cells. The expression of three germ layer marker proteins was detected by immunofluorescence to detect the three germ layer differentiation ability of the DKO+GSN cell line.

[0298] Immunofluorescence test results Figure 16 As shown, DKO+GSN cells express ectoderm marker proteins: PAX6 and GAD1; mesoderm marker proteins: Brachyury and NCAM; and endoderm marker proteins: SOX17 and FOXA2 at the protein level. 4.4 Teratoma formation ability of DKO+GSN cell line

[0299] This example tests the differentiation ability of DKO+GSN cells. The specific test method is as follows: 100 μL containing 5×10 5 DKO+GSN cell suspension was prepared and the teratoma volume was larger than 1.5 cm 3 The tissues were then removed, sectioned into paraffin and stained with hematoxylin and eosin.

[0300] Figure 17 The results of the teratoma formation ability test are shown, showing that DKO+GSN cells can form teratomas in vivo and differentiate into cells of the endoderm, mesoderm and ectoderm.

[0301] Example 5 Immune escape function of DKO+GSN cell line

[0302] To verify the escape function of DKO+GSN cells against different immune cells, experiments were performed using NK cells and a mixture of T cells and NK cells.

[0303] 5.1 Detection of immune escape function of DKO+GSN cells using RTCA

[0304] The evasion function of DKO+GSN cells against different immune cells was detected by RTCA. For the specific detection method, see Example 2.3. The PBNK cells used were obtained by adding IL-2 to PBMC (peripheral blood mononuclear cells, from SAILYBIO) during in vitro culture to increase the proportion of NK cells. The test results are as follows Figures 18A-18D As shown in the NK cell killing experiment detected by RTCA, the DKO cells constructed in Example 1 were completely killed by NK cells, while WT cells and DKO+GSN cells successfully escaped ( Figure 18A and Figure 18B In the RTCA-detected T cell + NK cell mixed cell (PBNK) killing experiment, only DKO + GSN cells successfully escaped, while WT cells and DKO cells were killed to varying degrees, with DKO cells being completely killed ( Figure 18C and Figure 18D ).in Figure 18B and 18D 5.2 Detection of NK cell IFN-γ spot secretion using Elispot

[0305] Elispot was used to detect IFN-γ secretion by NK cells to determine the immune escape function of DKO+GSN cells. The specific operation method is as follows:

[0306] WT cells, DKO cells, and DKO+GSN cells were plated in 6-well plates at a specific density. After 24 hours, the culture medium was discarded and a specific number of NK cells were added for culture. After 24 hours, NK cells were collected for subsequent IFN-γ secretion detection. At the same time, the WT cells, DKO cells, and DKO+GSN cells remaining after the NK cells were removed were observed. The results are shown in Figure 2. Figure 19 As shown in the figure, compared with DKO cells, fewer WT cells and DKO+GSN cells were killed by NK cells, indicating that the ability of DKO+GSN cells to escape NK cell killing was significantly higher than that of DKO cells.

[0307] The NK cells collected after 24 hours were plated in a 96-well plate coated with IFN-γ antibody and incubated in a 37°C incubator for 24 hours; affinity antibody and streptavidin were added and incubated for color detection of IFN-γ secretion spots.

[0308] Elispot test results Figure 20A and Figure 20B As shown in the figure, the number of spots formed by IFN-γ secreted by NK cells after co-culture of WT cells and DKO+GSN cells with NK cells was similar, and was significantly lower than that of DKO cells, indicating that overexpression of GSN can offset the NK cell activation caused by B2M / CIITA knockout.

[0309] 5.3 Detection of NK cell activity using FACS

[0310] WT cells, DKO cells, and DKO+GSN cells were plated at specified densities in 6-well plates. After 24 hours, the culture medium was removed and a specified number of NK cells were added for co-culture. NK cells were harvested 24 hours later and their surface activation marker CD107a (Biolegend, 328620) was detected by FACS.

[0311] FACS test results Figure 21 As shown, DKO+GSN cells can reduce NK cell activation compared with DKO cells.

[0312] Example 6. Verification of immune escape of differentiated cells of DKO+GSN cells

[0313] Plate cells onto Matrigel and, when confluence reaches 40%, switch to differentiation medium daily. Once confluent, subculture onto 0.1% gelatin-coated dishes and perform subculture every 3 days, continuing with daily medium changes. The differentiation cycle is 10 days.

[0314] The NK cell escape function of differentiated DKO+GSN cells was detected by RTCA. The specific detection method is shown in Example 2.3.

[0315] The results are as follows Figure 22A and Figure 22B As shown, Figure 22B Figure 2 shows the statistical diagram of multiple killing. DKO cells were still completely killed by NK cells after differentiation, while differentiated cells of WT cells and differentiated cells of DKO+GSN cells successfully escaped NK cell killing.

[0316] Although the present invention has been disclosed above with reference to preferred embodiments, this is not intended to limit the present invention. Anyone familiar with this technology can make various changes and modifications without departing from the spirit and scope of the present invention. Therefore, the scope of protection of the present invention should be based on the definition of the claims.

[0317] Sequence Listing

[0318]

[0319]

[0320]

Claims

1. A low-immunogenic pluripotent stem cell comprising: reduced endogenous major histocompatibility class I antigen (MHC-I) function compared to parental pluripotent stem cells; Reduced endogenous major histocompatibility class II antigen (MHC-II) function compared to the parental pluripotent stem cell; and Reduced sensitivity to NK cell killing compared to parental pluripotent stem cells, wherein the reduced sensitivity to NK cell killing is caused by increased expression of extracellular GSN protein. 2 . The low immunogenicity pluripotent stem cell according to claim 1 , wherein the MHC-I function is reduced by reducing the activity of MHC-I class proteins or MHC-I transcriptional regulators. 3 . The low immunogenic pluripotent stem cell according to claim 2 , wherein the MHC class I protein comprises an HLA-A protein, an HLA-B protein, or an HLA-C protein. The low immunogenicity pluripotent stem cell according to claim 2 , wherein the MHC-I transcriptional regulator comprises a B2M protein, a TAP1 protein, a TAP2 protein, a TAP-associated glycoprotein, or a NLRC5 protein. The low immunogenicity pluripotent stem cell according to claim 2 , wherein the MHC-I function is reduced by reducing the activity of the B2M protein. 6 . The low immunogenic pluripotent stem cell according to claim 5 , wherein the B2M protein is a human B2M protein comprising the amino acid sequence shown in SEQ ID NO: 1 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO:

1. 7 . The low immunogenicity pluripotent stem cell of claim 1 , wherein the MHC-II function is reduced by reducing the activity of MHC-II class proteins or MHC-II transcriptional regulators. The low immunogenicity pluripotent stem cell according to claim 7 , wherein the MHC class II protein comprises an HLA-DR protein, an HLA-DQ protein, or an HLA-DP protein. 9 . The low immunogenic pluripotent stem cell according to claim 7 , wherein the MHC-II transcriptional regulator comprises CIITA protein, RFXANK protein, RFX5 protein or RFXAP protein.

10. The low immunogenicity pluripotent stem cell according to claim 7, wherein the MHC-II function is reduced by reducing the activity of CIITA protein. The low immunogenic pluripotent stem cell according to claim 10 , wherein the CIITA protein is a human CIITA protein comprising the amino acid sequence shown in SEQ ID NO: 2 or an amino acid sequence having at least 90% identity with the amino acid sequence shown in SEQ ID NO:

2. 12 . The low-immunogenic pluripotent stem cell according to claim 1 , wherein the extracellular GSN protein is a human extracellular GSN protein, and the amino acid sequence thereof is the amino acid sequence encoded by SEQ ID NO:

4.

13. The low immunogenicity pluripotent stem cell according to claim 1, comprising: One or more changes that reduce the activity of endogenous B2M protein; One or more changes that reduce the activity of endogenous CIITA protein; and One or more alterations result in increased extracellular GSN protein expression in the low immunogenic pluripotent stem cells.

14. The low immunogenic pluripotent stem cell according to claim 13, comprising: one or more alterations that inactivate both alleles of the endogenous B2M gene; One or more alterations that inactivate both alleles of the endogenous CIITA gene; and One or more alterations result in increased expression of a GSN gene encoding an extracellular GSN protein in the low immunogenic pluripotent stem cells.

15. A method for producing the low immunogenic pluripotent stem cell according to any one of claims 1 to 14, the method comprising: reducing endogenous major histocompatibility class I antigen (MHC-I) function in the pluripotent stem cells; reducing endogenous major histocompatibility class II antigen (MHC-II) function in the pluripotent stem cells; and The expression of a protein that reduces the sensitivity of the pluripotent stem cells to NK cell killing is increased, wherein the protein is an extracellular GSN protein.

16. The method of claim 15, comprising: reducing the activity of B2M protein in the pluripotent stem cells; reducing the activity of CIITA protein in the pluripotent stem cells; and The expression of extracellular GSN protein in the pluripotent stem cells is increased.

17. The method of claim 16, comprising: Eliminating the activity of both alleles of the B2M gene in the pluripotent stem cells; Eliminating the activity of both alleles of the CIITA gene in the pluripotent stem cells; and The expression of a GSN gene encoding an extracellular GSN protein is increased in the pluripotent stem cells.

18. The method of claim 16, wherein the activity of the B2M protein in the pluripotent stem cells is reduced and / or the activity of the CIITA protein in the pluripotent stem cells is reduced by a technique selected from the group consisting of: Introduce gene expression modifying molecules, clustered regularly interspaced short palindromic repeats (CRISPR) technology, transcription activator-like effector nuclease (TALEN) technology, zinc finger nuclease (ZFN) technology or homologous recombination technology.

19. The method of claim 18, wherein the gene expression modifying molecule comprises siRNA, shRNA, microRNA, antisense RNA, antisense oligonucleotide ASO or anti-miRNA oligonucleotide AMO.

20. The method of claim 18, wherein Reducing the activity of B2M protein in the pluripotent stem cells by clustered regularly interspaced short palindromic repeats (CRISPR) / Cas9 gene editing technology; and / or The activity of CIITA protein in the pluripotent stem cells is reduced by clustered regularly interspaced short palindromic repeats (CRISPR) / Cas9 gene editing technology.

21. The method of any one of claims 15-20, wherein the expression of extracellular GSN protein is increased by modification of an endogenous locus.

22. The method of any one of claims 15-20, wherein the expression of extracellular GSN protein is increased by expression of a transgene.

23. The method of any one of claims 15 to 20, wherein the nucleic acid sequence encoding the extracellular GSN protein is synthesized and constructed into a lentiviral vector, and then at least one copy of the GSN gene encoding the extracellular GSN protein under the control of a promoter is introduced into the pluripotent stem cells via the lentiviral vector to increase the expression of the extracellular GSN protein.

24. The method of claim 23, wherein the amino acid sequence of the extracellular GSN protein is the amino acid sequence encoded by SEQ ID NO:

4.

25. The method of claim 24, wherein the nucleic acid sequence encoding the extracellular GSN protein is the nucleic acid sequence shown in SEQ ID NO: 4 or a nucleic acid sequence having at least 80% identity to the nucleic acid sequence shown in SEQ ID NO:

4.

26. A differentiated cell differentiated from a pluripotent stem cell with low immunogenicity prepared by the method of any one of claims 21, 23-25.

27. Use of the low immunogenicity pluripotent stem cell according to any one of claims 1 to 14 or the low immunogenicity pluripotent stem cell prepared by the method according to any one of claims 15 to 25 in preparing differentiated cells.

Citation Information

Patent Citations

  • CD24 expressing cells and uses thereof

    WO2021041316A1

  • Immunoengineered pluripotent cells

    CN110177869A

  • Universal donor stem cells and related methods

    CN113906048A